Abstract
Background & Aims
Intraductal tubulopapillary neoplasm (ITPN) is a rare, high-grade tumor of the pancreatic duct, characterized by distinct molecular features including frequent alterations in the components of switch/sucrose nonfermenting (SWI/SNF) chromatin remodeling complex and PI3K/AKT pathways. This study aimed to investigate the functional role of BRG1, a key SWI/SNF component, in pancreatic ductal cells, particularly in the context of PI3K/AKT pathway activation.
Methods
We generated conditional knockout mice by crossing Hnf1b-CreERT2, Brg1flox, and Ptenflox strains. Pancreatic organoids were used for subcutaneous xenografts in NOD/SCID mice. Twelve human ITPN specimens were analysed by immunohistochemistry.
Results
In the context of PI3K/AKT pathway activation, Brg1 deletion in pancreatic ductal cells led to the development of ITPN accompanied by invasive carcinoma components. An upregulation of the Yes-associated protein 1/transcriptional coactivator with the PDZ-binding motif (YAP/TAZ) pathway was observed in mutant pancreatic ductal cells. In the xenograft model, pancreatic tumour organoids progressed into invasive pancreatic ductal adenocarcinoma (PDAC) with high TAZ expression, indicating sustained YAP/TAZ pathway activation. Furthermore, administration of verteporfin, a YAP/TAZ pathway inhibitor, reduced tumour formation and partially reversed the dedifferentiation of pancreatic ductal cells. Consistent with the mouse data, analysis of 12 human ITPN specimens showed frequent downregulation of SWI/SNF components, with a significant inverse correlation between BRG1 and TAZ expression.
Conclusions
Simultaneous loss of Brg1 and Pten in pancreatic ductal cells results in ITPN formation via the activation of the YAP/TAZ pathway in the mouse model. The YAP/TAZ pathway is a key driver of ITPN formation and is a potential therapeutic target for ITPN and ITPN-derived PDAC.
Keywords: Brg1, ITPN, SWI/SNF Complex, YAP/TAZ Pathway
Graphical abstract
Summary.
Loss of Brg1 and Pten in pancreatic ductal cells results in formation of pancreatic intraductal tubulopapillary neoplasm in a mouse model. The underlying mechanism was identified as activation of Yes-associated protein 1/transcriptional coactivator with the PDZ-binding motif pathway.
Pancreatic ductal adenocarcinoma (PDAC) is one of the most fatal cancers worldwide.1 Moreover, its prevalence is increasing annually.1 Therefore, there is a need to elucidate its pathogenesis and establish treatments for PDAC. Surgery is currently the only curative treatment for PDAC.2,3 However, given that prognosis has slightly improved with the development of individualized treatments, it is important to identify the characteristics of each PDAC. Precancerous PDAC lesions include pancreatic intraepithelial neoplasia (PanIN), intraductal pancreatic mucinous neoplasm (IPMN), and intraductal tubulopapillary neoplasm (ITPN). In mouse models, IPMN and ITPN are thought to arise from the pancreatic ductal cells, whereas PanIN is thought to arise from the acinar cells.4,5 Distinguishing between these precancerous lesions is important because each lesion has different properties. For example, IPMN-derived PDAC has better prognosis and biological features than conventional PDAC.6
ITPN, first described by Yamaguchi et al in 2009,7 is a high-grade dysplasia that grows intraductally, forming tubulopapillary structure with minimal mucin production within the pancreatic duct, and frequently forms invasive carcinomas.8 It is characterized by a unique immunostaining pattern: MUC1 is positive, whereas MUC2 and MUC5AC are negative.8 ITPN is a rare subset of precancerous lesions, accounting for approximately 3% of intraductal pancreatic tumors7; however, it is a relatively recent disease concept and may not have been correctly diagnosed in the past. Currently, ITPN is treated in accordance with PDAC, and surgical procedures are performed in cases where surgery is feasible. However, the treatment of ITPN should be considered separately from that of conventional PDAC, because the properties of ITPN are entirely different from those of conventional PDAC. In fact, ITPN has a better prognosis compared with conventional PDAC.8
Genetic mutations also vary among precancerous lesions. Kras mutations are present in most cases of PanIN, IPMN, and PDAC, whereas Kras mutations are rarely found in ITPN.9 Instead, loss-of-function mutations in components of the switch/sucrose nonfermenting (SWI/SNF) chromatin remodeling complex, and gain-of-function mutations in PIK3CA are highly prevalent in ITPN.9,10 Recently, we found that the loss of Arid1a and Pten in pancreatic ductal cells induced ITPN formation via the Yes-associated protein 1/transcriptional coactivator with PDZ-binding motif (YAP/TAZ) pathway activation in mouse models.11
Brg1 is a major component of the SWI/SNF complex and is common to all 3 complexes, pBAF, cBAF, and ncBAF.12 Brg1 loss is associated with tumorigenesis in many cancers.13, 14, 15 In pancreatic tumorigenesis, Brg1 suppresses IPMN formation in the context of Kras mutations in pancreatic ductal cells.16 In contrast, Brg1 is indispensable for the formation and maintenance of PanIN and PDAC derived from pancreatic acinar cells.17,18 Therefore, Brg1 is thought to have both tumor-promoting and tumor-suppressive functions depending on the cell type. However, the functional role of BRG1 in ductal cells in the context of PI3K/AKT pathway activation remains unknown. Therefore, we aimed to examine the functional role of Brg1 in pancreatic ductal cells in the context of activation of the PI3K/AKT pathway using mouse models and investigate the clinical relevance of mouse data using human samples.
Ethics Approval Statement
Clinical human samples were used according to the study protocol approved by the Ethics Committee of Kyoto University Hospital (R2904). All experiments involving mice were approved by the Animal Research Committee of Kyoto University (Kyoto, Japan) and performed in accordance with Japanese government regulations.
Patient Consent Statement
Written informed consent was obtained from patients whose samples were used for immunohistochemical study.
Results
Loss of Brg1 and Pten in Pancreatic Ductal Cells Induced the Formation of ITPN and Invasive Carcinoma
To investigate the functional role of Brg1 in the context of PI3K/AKT pathway activation in pancreatic ductal cells, we used Hnf1bCreERT2 mice. According to a previous report, Hnf1bCreERT2 mouse was a suitable CreERT2 mouse line with high efficiency for genetic manipulation of pancreatic ductal cells.19 We crossed Brg1flox and/or Ptenflox mice with Hnf1bCreERT2 mice to generate Hnf1bCreERT2 (H), Hnf1bCreERT2; Ptenflox/flox (HP), Hnf1bCreERT2; Brg1flox/flox (HB), and Hnf1bCreERT2; Ptenflox/flox; Brg1flox/flox (HPB) mice (Figure 1A). At 42 days after the first tamoxifen administration, the pancreatic tissues were analyzed (Figure 1B). Macroscopically, HPB mice exhibited a dilated pancreatic duct (arrowheads) and an atrophic surrounding pancreas with jaundice, whereas H, HB, HP mice appeared normal (Figure 1C). Microscopically, hematoxylin and eosin (H&E) staining showed normal pancreatic ductal cells in H and HB mice and mild neoplastic changes in pancreatic ductal cells in HP mice. In contrast, in HPB mice, tumor cells were observed with tubulopapillary architecture and increased proliferation in the pancreatic duct, resembling human ITPN (Figure 1D). Moreover, invasive carcinoma components (arrowheads) were observed in all HPB mice (n = 4/4) 42 days after the first tamoxifen administration (Figure 1E).
Figure 1.
Loss of Brg1 and Pten in pancreatic ductal cells induces ITPN and invasive carcinoma formation. (A) Schematic illustration of pancreatic ductal cell-specific genetic recombination in HPB mice. Brg1flox mice and/or Ptenflox mice were crossed with Hnf1bCreERT2 mice to generate Hnf1bCreERT2 (H), Hnf1bCreERT2; Ptenflox/flox (HP), Hnf1bCreERT2; Brg1flox/flox (HB), and Hnf1bCreERT2; Ptenflox/flox; Brg1flox/flox (HPB) mice. (B) Experimental scheme of tamoxifen-induced genetic recombination. The arrowheads indicate tamoxifen administration. The pancreatic duct was analyzed 42 days after the first tamoxifen administration. (C) Macroscopic pancreatic images of H, HB, HP, and HPB mice. HPB mice exhibited a dilated pancreatic duct (arrowheads) and an atrophic surrounding pancreas with jaundice, whereas H, HB, HP mice appeared normal. Scale bars, 10 mm. n = 4 per group. (D) Representative images of H&E staining of the pancreas from H, HP, HB, and HPB mice. In HPB mice, the ductal cell proliferation led to papillary tumour formation in the pancreatic duct, resembling human ITPN. Scale bars, 200 μm (low magnification) and 50 μm (high magnification). n = 4 per group. (E) Histological images of H&E staining of HPB mice. Invasive carcinoma components (arrowheads) are observed in HPB mice 42 days after the first tamoxifen administration. Scale bars, 100 μm (low magnification) and 20 μm (high magnification). n = 4. (F) Immunohistochemistry of mucin (MUC) staining in HPB mice. The pancreatic ductal cells of HPB mice were negative for MUC2 and MUC5AC, whereas positive for MUC1. Scale bar, 20 μm. n = 4 per group.
To better characterise the neoplastic cells of the pancreatic duct in HPB mice, immunohistochemistry (IHC) for mucins was performed. Muc2 and Muc5ac were negative, whereas Muc1 was positive, in the pancreatic ductal cells of HPB mice (Figure 1F). This characteristic mucin expression pattern is compatible with that of human ITPN. Therefore, these data indicate that the loss of Brg1 and Pten in pancreatic ductal cells induces ITPN formation in a mouse model.
In a previous study, we have shown that loss of Arid1a, one of the components of SWI/SNF complex, and Pten in pancreatic ductal cells induced ITPN formation in Hnf1bCreERT2; Ptenflox/flox; Arid1aflox/flox (HPA) mice,11 To investigate the functional similarities and differences between Brg1 and Arid1a in the context of PI3K/AKT pathway activation, we compared the phenotypes of HPA and HPB mice. As shown in Figure 2A and B, in HPB mice, the development of ITPN was detected 21 days after the first tamoxifen administration, whereas it was observed at 35 days after the first tamoxifen administration in HPA mice. Moreover, invasive carcinoma components were found at 35 days in HPB mice, whereas they were found at 56 days in HPA mice. The HPB mice did not survive >56 days after the first tamoxifen administration, most likely because of obstructive jaundice and liver dysfunction. Thus, HPB mice phenocopied HPA mice in terms of the formation of ITPN and ITPN-derived PDAC; however, the formation and progression of ITPN were more accelerated in HPB mice than in HPA mice.
Figure 2.
ITPN formation in HPB mice was faster than that in HPA mice. (A) Representative images of H&E-stained pancreases from HPA and HPB mice. In HPB mice, ITPN was observed 21 days after the first tamoxifen administration, whereas it was found 35 days after the first tamoxifen administration in HPA mice. Invasive carcinoma component was found 35 days after the first tamoxifen administration in HPB mice, whereas it was found at 56 days after the first tamoxifen administration in HPA mice. Scale bars, 100 μm (low magnification) and 20 μm (high magnification). n = 4 per group. (B) Summary of the microscopic comparisons between HPA and HPB mice. Blue, mild dysplasia; yellow, ITPN; red, ITPN with invasive carcinoma components.
HPB Mice Exhibited Increased Proliferation and Dedifferentiation of Pancreatic Ductal Cells
To better characterize the pancreatic ductal cells in HPB mice, we performed immunostaining. First, the expression of phospho-AKT and loss of Brg1 expression were confirmed in the pancreatic ductal cells of HPB mice (Figure 3A), indicating efficient Cre-mediated recombination. Moreover, CK19 was expressed in tumor cells in HPB mice, as was expressed in pancreatic ductal cells of H, HB, and HP mice (Figure 3B).
Figure 3.
IHC for pAKT, Brg1, and CK19. (A) IHC for pAKT and Brg1 in the pancreas of H, HB, HP, and HPB mice. Inserts are magnified to highlight pancreatic ductal cells. Scale bar, 20 μm. n = 5 per group. (B) IHC for CK19 in the pancreas of H, HB, HP, and HPB mice. Inserts are magnified to highlight pancreatic ductal cells. Scale bar, 20 μm. n = 5 per group.
Notably, pancreatic ductal cells from H, HB, and HP mice had a low Ki-67 positivity rate, whereas those from HPB mice had a significantly higher Ki-67 positivity rate of 49.3% (Figure 4A, C). These results indicate that pancreatic ductal cells in HPB mice exhibit significantly higher proliferative activity than those in H, HB, and HP mice.
Figure 4.
HPB mice exhibited increased proliferation and dedifferentiation of pancreatic ductal cells. (A) IHC detection of nuclear Ki-67 expression in the pancreatic sections from H, HB, HP, and HPB mice. Scale bar, 20 μm. (B) IHC detection of nuclear Pdx1, Sox9, and Hnf1β expression in the pancreatic sections from H, HB, HP, and HPB mice. Scale bar, 20 μm. (C) Quantification of Ki-67 by IHC. The Ki-67 positivity rate was significantly higher in HPB mice than in H, HB, and HP mice. Data are presented as the means ± SDs (n = 3 per group). P value was evaluated using a 1-way ANOVA with Dunnett’s post-hoc test. (D) Quantification of Pdx1, Sox9, and Hnf1β by IHC. The Pdx1 positivity rate was significantly higher in HPB mice than in H, HB, and HP mice, whereas the positivity rates for Sox9 and Hnf1β were significantly lower in HPB mice than in the H, HB, and HP mice. Data are presented as the means ± SDs (n = 3 per group). P value was evaluated using a 1-way ANOVA with Dunnett’s post-hoc test.
Dedifferentiation of tumour cells leads to cancer progression with acquisition of cancer stemness.20 Moreover, dedifferentiation occurs before tumor initiation in pancreatic cancer.21 Therefore, we assessed the differentiation of pancreatic ductal cells. The positivity rate for Pdx1, the immature pancreatic ductal cell marker, was significantly higher in HPB mice than that in H, HB, and HP mice (Figure 4B, D). In contrast, the positivity rates of Hnf1β and Sox9, the mature pancreatic ductal cell markers, were significantly lower in HPB mice than those in H, HB, and HP mice (Figure 4B, D). These results indicate the dedifferentiation of pancreatic ductal cells in HPB mice, which might have contributed to ITPN formation.
RNA-sequencing Analysis of Pancreatic Ductal Cells in HPB mice Revealed the Activation of the YAP/TAZ Pathway
IHC studies have indicated that the loss of Brg1 in pancreatic ductal cells in the context of PI3K/Akt activation results in dedifferentiation, leading to the formation of ITPN and invasive cancer. To provide insights into the mechanism of tumorigenesis and dedifferentiation in HPB mice, we performed RNA sequencing (RNA-seq) analysis of pancreatic ductal cells isolated from the whole pancreatic tissue using ductal cell-specific Dolichos biflorus agglutinin lectin labeling, followed by magnetic bead separation 21 days after the first tamoxifen administration (Figure 5A). RNA-seq analysis revealed 417 upregulated and 609 downregulated genes with high fold changes (>2 log or <2 log) in HPB mice compared with HP mice (Figure 5B). Gene set enrichment analysis (GSEA) revealed that several gene sets were significantly enriched and depleted in HPB mice (Figure 5C). In a previous study,11 we demonstrated the significance of the YAP/TAZ pathway in pancreatic ductal cells of HPA mice. GSEA consistently revealed that the YAP-conserved signature was upregulated in HPB mice, although this difference was not statistically significant (Figure 5D). Notably, activation of the YAP/TAZ pathway promotes dedifferentiation via epithelial–mesenchymal transition and the transcription of growth factors.22, 23, 24 These findings are consistent with our results, showing that HPB mice exhibited dedifferentiation of pancreatic ductal cells, resulting in the formation of ITPN and its invasive cancer. Therefore, we focused on the YAP/TAZ pathway as a possible mechanism underlying tumorigenesis in HPB mice.
Figure 5.
RNA-seq analysis of pancreatic ductal cells in HPB mice revealed the activation of the YAP/ TAZ pathway. (A) Experimental scheme for tamoxifen-induced genetic recombination and analysis. The arrowheads indicate tamoxifen administration. At 21 days after the first tamoxifen administration, pancreatic ductal cells were separated using ductal cell-specific Dolichos biflorus agglutinin lectin labeling, followed by magnetic bead separation. (B) Volcano plot showing the differentially expressed genes in HPB and HP mice. RNA-seq analysis of genes with high fold changes (>2 log or <2 log) revealed 417 upregulated and 609 downregulated genes in HPB mice compared with HP mice. (C) Representative results of gene set enrichment analysis comparing pancreatic ductal cells isolated from HP and HPB mice using “Hallmark gene sets.” NES, normalized enrichment score. (D) GSEA plot of the YAP-conserved signature comparing pancreatic ductal cells isolated from HP and HPB mice. FDR, false discovery rate. (E) qRT-PCR analysis of ductal cells isolated from HP or HPB mice. The expressions of Ankrd1, Cyr61, and Igfbp3 were significantly upregulated in HPB mice. The expressions of Ctgf and Birc5 were upregulated in HPB mice, although the difference was not statistically significant. Data are presented as the means ± SDs (n = 3 per group). The P values were evaluated using a 2-tailed Student’s t-test. (F) IHC for Taz, Cyr61, Birc5, and Ctgf in the pancreas of H, HB, HP, and HPB mice. Scale bar, 20 μm. n =5 per group.
Next, we performed quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of pancreatic ductal cells isolated from HP or HPB mice. Representative downstream genes of the YAP/TAZ pathway were evaluated. The expressions of Ankrd1, Cyr61, and Igfbp3 were significantly upregulated in HPB mice compared with that in HP mice, and the expressions of Ctgf and Birc5 were upregulated in HPB mice, although not significantly (Figure 5E).
Moreover, we evaluated the expression levels of Taz and representative downstream genes of the YAP/TAZ pathway using IHC. Notably, Taz expression was higher in HPB mice than in HP mice. Moreover, the expressions of Cyr61, Birc5, and Ctgf were increased in HPB mice (Figure 5F). These results suggest that the YAP/TAZ pathway is upregulated in the pancreatic ductal cells of HPB mice.
ITPN Organoids Could Progress Into Invasive Pancreatic Ductal Adenocarcinoma in a Xenograft Model
As shown in Figure 2, HPB mice did not survive >56 days after the first tamoxifen administration, possibly because of liver dysfunction. Therefore, we could not investigate how ITPN could progress into invasive PDAC over a longer period in HPB mice. To circumvent this problem, we next evaluated the tumorigenicity in a xenograft model. At 35 days after the first tamoxifen administration, the pancreas was harvested from HPB or HP mice (Figure 6A). After tumor organoids derived from HPB or HP mice were established (Figure 6B), they were subcutaneously injected into NOD/SCID mice. Xenograft tumors developed in 3 of the 4 HPB organoids 3 months after the injection of organoids (Figure 6C, D), whereas no tumors developed in HP organoids (Figure 6D). Cystic components were formed in all cases. In one case (case 1), the cystic component underwent spontaneous destruction by necrosis; therefore, a histological examination could not be performed. Solid components were observed in addition to cystic components in 2 cases (cases 2 and 3). Histologically, the solid components exhibited invasive PDAC, characterized by atypical glands infiltrating desmoplastic stroma in a tubular arrangement, which was consistent with a histological pattern of invasion (Figure 6E). IHC confirmed the loss of Brg1 expression in the HPB xenograft models (Figure 6F). To determine the characteristics of invasive PDAC that developed from ITPN, we compared PDAC that developed from ITPN in HPB mice with those from KPC mice. Immunostaining revealed no significant differences in Ki-67 positivity rates in tumor cells between PDAC from HPB and KPC mice (Figure 6F, G). Notably, the Taz nuclear staining positivity rate was significantly higher in ITPN-derived PDAC cells from HPB mice than in cells from KPC mice (Figure 6F, G). These data indicate that ITPN can progress into invasive PDAC and that activation of the YAP/TAZ pathway is retained in invasive PDAC in the mouse model.
Figure 6.
ITPN could develop into invasive PDAC in a tumor-organoid implanted mouse model. (A) Experimental scheme of tamoxifen-induced genetic recombination and xenograft formation. The arrowheads indicate tamoxifen administration. Thirty-five days after the first tamoxifen administration, the pancreas was harvested from HPB and HP mice. After the construction of pancreatic organoids from HPB and HP mice, they were injected into NOD/SCID mice. (B) Images of organoid cultures of pancreatic ductal cells isolated from HPB and HP mice 35 days after tamoxifen administration. Scale bar, 100 μm. (C) Macroscopic images of xenograft tumors from HPB mice injected into NOD/SCID mice. Xenograft tumors developed in all HPB organoids 84 days after injection. The arrowheads indicate xenograft tumors. (D) Tumor formation in organoids established from HP and HPB mice injected into NOD/SCID mice. n = 4 per group. (E) Comparison of xenograft tumors developed from pancreatic organoids in HPB and KPC mice. The solid component derived from ITPN is histologically indistinguishable from that of conventional PDAC. Scale bars, 200 μm (low magnification) and 20 μm (high magnification). (F) IHC study of xenograft tumours developed from pancreatic organoids in HPB and KPC mice. Cells exhibiting nuclear staining were interpreted as positive for transcriptional coactivator with the PDZ-binding motif (TAZ). Scale bar, 20 μm. (G) Quantification for IHC study for Ki-67 and Taz in HPB and KPC mice. There was no significant difference in Ki-67 positivity rates in tumour cells between PDAC cells from HPB and KPC mice. The Taz nuclear positivity rate was significantly higher in ITPN-derived PDAC cells from HPB mice than PDAC cells from KPC mice. Data are presented as the means ± SDs (n = 3 per group). The P values were evaluated using a 2-tailed Student’s t-test.
Pharmacologic YAP/TAZ Pathway Inhibition Attenuates Proliferation of Pancreatic Ductal Cells in Organoids Derived From HPB Mice
We found that the YAP/TAZ pathway and its downstream gene expressions were elevated in the pancreatic ductal cells of HPB mice compared with HP mice. Therefore, to determine whether pharmacological inhibition of the YAP/TAZ pathway suppresses the dedifferentiation of pancreatic ductal cells and tumor formation in HPB mice, we evaluated the proliferation of the organoids derived from HPB mice treated with verteporfin (VP), an inhibitor of connection of YAP/TAZ and TEAD, or vehicle as a control. The experimental scheme is shown in Figure 7A. Microscopically, the surface area was smaller in organoids treated with VP than in those treated with vehicle (Figure 7B, C). Quantitative analysis confirmed that organoids treated with VP had a significantly smaller surface area compared with organoids treated with vehicle (Figure 7D). Furthermore, we performed qRT-PCR analysis of organoids treated with VP or vehicle as a control. The expressions of Birc5, Igfbp3, and Axl, the representative downstream target genes of YAP/TAZ pathway, were reduced in organoids treated with VP (Figure 7E), indicating that VP effectively downregulates the YAP/TAZ pathway. Moreover, the expression of Hnf1b, the mature pancreatic ductal cell marker gene, was significantly increased, whereas the expression of Pdx1, the immature pancreatic ductal cell marker gene, was significantly decreased in organoids treated with VP compared with controls (Figure 7E). Notably, the expressions of Pcna, Ccnd1, and Mki67, the proliferation marker genes, were significantly decreased in organoids treated with VP (Figure 7E). These findings indicate that VP suppresses dedifferentiation and proliferation of pancreatic ductal cells in the organoid model.
Figure 7.
Pharmacologic YAP/TAZ pathway inhibition attenuates proliferation of pancreatic ductal cells in organoids derived from HPB mice. (A) Experimental scheme of pharmacologic YAP/TAZ pathway inhibition for organoids derived from HPB mice. About 24 hours after passage, organoids were treated with VP or vehicle. (B) Microscopic overall images of organoids treated with 10 μM VP or vehicle from day1 to day4. Scale bar, 200 μm. (C) Representative individual organoids treated with 10 μM VP or vehicle from day1 to day4. Scale bar, 20 μm. (D_ Comparison of surface area of individual organoids treated with VP or vehicle from day1 to day4. Data are presented as the means ± SDs (n = 3 per group). The P values were evaluated using 1-way ANOVA with Dannett’s post-hoc test. ∗: p < 0.05 (E) qRT-PCR analysis of organoids treated with 10 μM VP or vehicle. The expressions of Birc5, Igfbp3, and Axl, the representative downstream target genes of YAP/TAZ pathway, were significantly downregulated in organoids treated with VP. The expression of Hnf1b, the mature pancreatic ductal cell marker gene, was significantly increased, whereas the expression of Pdx1, the immature pancreatic ductal cell marker gene, was significantly decreased in organoids treated with VP. The expressions of Pcna, Ccnd1, and Mki67, the proliferation marker genes, were significantly decreased in organoid treated with VP. Data are presented as the means ± SDs (n = 5 per group). The P values were evaluated using a 2-tailed Student’s t-test.
Inhibition of the YAP/TAZ Pathway Suppressed Dedifferentiation of Pancreatic Ductal Cells and Tumor Formation in HPB Mice
Next, to assess the in vivo effect of YAP/TAZ pathway inhibition, we treated HPB mice with VP or vehicle as a control (Figure 8A). On day 28 after the first tamoxifen administration, tumor formation in the pancreatic ductal cells was partially suppressed in HPB mice treated with VP (n = 5 per group) (Figure 8B, C). Consistent with this finding, the Ki-67 positivity rate was significantly lower in the HPB mice treated with VP (Figure 8D, E).
Figure 8.
Blocking of YAP/TAZ activation inhibits the dedifferentiation of pancreatic ductal cells and tumor formation in HPB mice. (A) Experimental scheme for the tamoxifen-induced genetic recombination and treatment protocol. HPB mice were treated with VP, an inhibitor of the connection of YAP/TAZ and TEAD or vehicle. (B) Representative images of H&E staining of the pancreas from HPB mice treated with VP or vehicle. At 28 days after the first tamoxifen injection, tumor formation in the pancreatic ductal cells was partially suppressed in HPB mice following VP administration. Scale bar, 20 μm. (C) Tumor formation in HPB mice treated with VP or vehicle. n = 5 per group. Scale bar, 20 μm. (D) IHC for Ki-67, Pdx1, Sox9 and Hnf1β in HPB mice treated with VP or vehicle. n = 3 per group. Scale bar, 20 μm. (E) Quantification of IHC staining for Ki-67, Pdx1, Sox9, and Hnf1β in HPB mice treated with VP or vehicle. The Ki-67 positivity rate was significantly higher in HPB mice treated with VP. The Pdx1 positivity rate was significantly reduced, whereas Sox9 and Hnf1β positivity rates were significantly elevated in HPB mice following VP administration. Data are presented as the means ± SDs (n = 3 per group). The P values were evaluated using a 2-tailed Student’s t-test. (F) IHC for Yap, Taz, Birc5, and Ctgf in HPB mice treated with VP or vehicle. n = 3 per group. Scale bar, 20 μm.
To confirm the effect of VP in HPB mice, we performed IHC analyses of Yap and Taz to compare their expression between the control and treatment groups. We found that the expression levels of both Yap and Taz were reduced in HPB mice treated with VP (Figure 8F). Furthermore, the expressions of Birc5 and Ctgf, representative downstream targets of the YAP/TAZ pathway, were also reduced in HPB mice treated with VP (Figure 8F). These findings indicate that VP effectively suppressed YAP/TAZ signaling in HPB mice.
Moreover, the expression of Pdx1 was significantly lower in HPB mice treated with VP compared with those treated with vehicle. Expressions of Sox9 and Hnf1b were significantly higher in HPB mice treated with VP compared with those treated with vehicle, indicating that the dedifferentiation of pancreatic ductal cells observed in HPB mice was partially cancelled by VP treatment (Figure 8D, E).
These data indicate that blocking of YAP/TAZ activation inhibits the dedifferentiation of pancreatic ductal cells and tumor formation in HPB mice. Therefore, the loss of Brg1 and Pten in pancreatic ductal cells results in ITPN formation, at least in part, via the activation of the YAP/TAZ pathway in the mouse model.
Evaluation of SWI/SNF Components and TAZ Expression in Human ITPN Samples
In a previous study, we evaluated the expression of ARID1A in human ITPN samples.11 As the sample size in the previous study was small (5 cases), we recruited 12 human ITPN samples from 5 institutes for this study. We evaluated the expression of SWI/SNF components, including BRG1, BRM, ARID1A, and PBRM1, in human ITPN samples (Figure 9A). BRG1 expression was weak in 3 cases (25%), moderate in 2 cases (17%), and strong in 7 cases (58%). Notably, BRM expression was weak (17%) or negative (34%) in one-half of the ITPN cases. ARID1A expression was weak in 2 cases (17%). PBRM1 expression was weak in 1 case (8%). In summary, the expression of any SWI/SNF components was reduced in approximately one-half of human ITPN cases (Figure 9A, highlighted in yellow). Moreover, we evaluated BRG1 expression in human IPMN and ITPN samples (Figure 9B). Notably, human IPMNs did not show reduced (negative or weak) BRG1 expression.
Figure 9.
Evaluation of SWI/SNF components and TAZ expression in human ITPN samples. (A) Expression of SWI/SNF components, including BRG1, BRM, ARID1A, and PBRM1, in human ITPN specimens. Additionally, the expression levels of pAKT and TAZ were analyzed. Black, blue, green, and red indicate negative, weak, moderate, and strong expression, respectively. Cases with reduced expression of any SWI/SNF complex component are shown in yellow. (B) Summary of BRG1 staining for human IPMN and ITPN samples. Immunohistochemistry for BRG1 in IPMN (n = 20), ITPN (n = 12), and adjacent normal pancreas (n = 3) specimens. Images of the adjacent normal pancreas were captured from the same tissue slide as IPMN or ITPN, if available. Scale bar, 20 mm. Tables on the right show the number of samples classified as ITPN or IPMN and their staining intensity. Statistical analysis was performed using the Mann–Whitney U test. (C) Analysis of Spearman’s correlation coefficients and scatterplots with jitter and linear regression. There was a significant negative correlation between BRG1 and TAZ expression (−0.803). There was a moderate negative correlation between ARID1A or BRM and TAZ expression (−0.422 and −0.518, respectively). No correlation was observed between PBRM1 or pAKT and TAZ expression (0.147 and 0.125, respectively). (D) Representative cases are shown. Scale bar, 20 μm.
As described above, we elucidated that the loss of Brg1 and Pten in pancreatic ductal cells resulted in ITPN formation via the activation of the YAP/TAZ pathway in a mouse model. Given that the loss of Arid1a and Pten induces ITPN formation via a similar mechanism in a mouse model,11 we hypothesised that activation of the YAP/TAZ pathway is a characteristics of ITPN with loss of function of any SWI/SNF components. Therefore, we next evaluated the expression of the SWI/SNF components and TAZ in human ITPN samples using Spearman’s rank correlation coefficients. Notably, there was a significant negative correlation between BRG1 and TAZ expressions (Figure 9C) (−0.803). In contrast, there was a moderate negative correlation between ARID1A or BRM and TAZ expressions (−0.422 and −0.518, respectively). No correlation was observed between PBRM1 or pAKT and TAZ expressions (0.147 and 0.125, respectively). Representative cases are shown in Figure 9D. In agreement with the mouse data, these results demonstrated an inverse correlation between expressions of TAZ and SWI/SNF complex components, including BRG1, in human ITPN samples. Therefore, these data support our conclusion that the loss of Brg1 cooperates with the PI3K/AKT pathway in pancreatic ductal cells to form ITPN by activating the YAP/TAZ pathway.
Discussion
In this study, we showed that the loss of Brg1 and Pten in pancreatic ductal cells induced the dedifferentiation and formation of ITPN and ITPN-derived PDAC in a mouse model. We found that HPB mice phenocopied HPA mice in terms of pancreatic tumorigenesis and that HPB mouse was a good mouse model that recapitulated the features of human ITPN. In HPB mice, ITPN initiation and progression occur earlier and more rapidly than in HPA mice, although this difference has not been fully investigated. Given that Arid1a is a component of cBAF only, whereas Brg1 is a common subunit of cBAF, pBAF, and ncBAF, it is assumed that none of the SWI/SNF complexes function in HPB mice and that tumor progression is faster in HPB mice than in HPA mice. Furthermore, because Brg1 serves as the ATPase of these complexes, loss of Brg1 is expected to severely impair their chromatin remodeling activity.
Notably, Brg1 functions in a context-dependent manner, being either tumor-promoting or tumor-suppressing. In PDAC and its precursor PanIN, which are derived from acinar cells, Brg1 loss induces tumor regression through downregulation of the hypoxia pathway and suppression of SOX9 expression, respectively.17,18 In contrast, in IPMN, which is derived from pancreatic ductal cells, Brg1 loss induces tumor progression.16 Our study revealed that in ITPN, which is also derived from pancreatic ductal cells, Brg1 loss induces tumor initiation and progression by activation of the YAP/TAZ pathway. These results suggest that Brg1 functions in a tumor-promoting vs tumor-suppressing manner via different target genes or pathways, depending on the origins of the cells, that is, pancreatic acinar cells vs pancreatic ductal cells.
In this study, we elucidated the key mechanism by which ITPN is formed from pancreatic ductal cells and found that the YAP/TAZ pathway was upregulated in HPB mice. Representative downstream genes of the YAP/TAZ pathway were upregulated in pancreatic ductal cells of HPB mice. Moreover, IHC revealed that the Taz nuclear positivity rate was higher and that Cyr61, Birc5, and Ankrd1, downstream genes of the YAP/TAZ pathway, were upregulated in HPB mice. Furthermore, blocking YAP/TAZ activation suppressed proliferation of pancreatic ductal cells in the organoid model, and inhibited the dedifferentiation of pancreatic ductal cells and ITPN formation in HPB mice. Therefore, our study, along with a previous study,11 indicated that the YAP/TAZ pathway is a key mechanism for ITPN formation, especially in the context of the deletion of SWI/SNF components in mouse models.
Using organoids and xenograft models, we successfully developed a mouse model of ITPN-derived invasive PDAC for the first time. All tumors had cystic components, and 2 of the 3 had both cystic and solid components. This may partly reflect the characteristics of ITPN and ITPN-derived PDAC. Among the solid components, ITPN-derived PDAC is histologically indistinguishable from conventional PDAC. Notably, the Ki-67 positivity rate was similar in PDAC developed from HPB and KPC mice, suggesting that ITPN-derived PDAC grows as fast as conventional PDAC. Moreover, Taz expression was higher in ITPN-derived PDAC that developed in HPB mice than in KPC mice. Therefore, upregulation of the YAP/TAZ pathway is retained in invasive ITPN-derived PDAC and is a characteristic feature of ITPN-derived PDAC.
Finally, IHC analysis of human ITPN specimens revealed that TAZ was overexpressed in 42% of human ITPNs (5/12). Although not in all cases, this suggests that the upregulation of the YAP/TAZ pathway is a characteristic of human ITPN. Moreover, BRG1 expression was significantly inversely correlated with TAZ expression, and expression of other SWI/SNF components, including BRM and ARID1A, also tended to be inversely correlated with TAZ expression. Our data indicate that the YAP/TAZ pathway is a key mechanism in human ITPN, especially in the context of the deletion of SWI/SNF components, which is consistent with our mouse data.
Our study has 2 implications for human ITPN and ITPN-derived PDAC. First, we present the potential therapeutic benefits of YAP/TAZ inhibitors for ITPN and ITPN-derived PDAC. We have shown that VP inhibits ITPN formation in mouse models and that 42% of human ITPN show increased expression of TAZ. Moreover, we found that YAP/TAZ activation was retained in ITPN-derived PDAC and that Taz expression was higher compared with that in conventional PDAC. Future studies are required to investigate whether YAP/TAZ inhibitors prevent the progression of ITPN to invasive ITPN-derived PDAC and whether YAP/TAZ inhibitors are effective against ITPN-derived PDAC in humans. Second, we propose that human ITPN and ITPN-derived PDAC should be treated without observation. In xenograft models, we observed ITPN-derived PDAC and increased Taz expression. Given that the tumor activity of ITPN-derived PDAC is comparable to that of conventional PDAC, ITPN-derived PDAC has a malignant potential similar to that of conventional PDAC. Surgery should be considered in possible cases rather than follow-up as in low-risk IPMNs.
This study has some limitations. First, Cre-mediated recombination of Brg1 was not significantly high. Oral gavage of tamoxifen was administered 6 times to increase the efficiency of Cre-mediated recombination; however, some escapers remained. This might have led to a small number of differentially expressed genes and the lack of significant differences in several pathways. Second, we could not elucidate the exact mechanism by which Brg1 controls the YAP/TAZ pathway. In a previous study, immunoprecipitation (IP) revealed that Arid1a loss induced the disconnection of Brg1 and YAP/TAZ.11 In this study, IP could not be performed because it was not possible to extract high-quality protein of Brg1-deleted organoids in vitro owing to sample availability. Finally, no mutations in BRG1 have been reported in human ITPN, and the level of expression of BRG1 was semi-quantitatively evaluated using IHC. Although public epigenomic data on human ITPNs are unavailable due to the rarity of the disease, epigenetic mechanisms such as DNA methylation may influence BRG1 protein expression.
In conclusion, loss of Brg1 cooperates with PI3K/AKT pathway in pancreatic ductal cells to form ITPN through the activation of the YAP/TAZ pathway in mice. Consistent with the mouse data, human ITPN specimens showed frequent downregulation of SWI/SNF components with a significant inverse correlation between BRG1 and TAZ expression. Our data identified the YAP/TAZ pathway as a central driver of ITPN formation, particularly in the context of SWI/SNF dysfunction, and suggested the therapeutic potential of YAP/TAZ inhibitors for ITPN and ITPN-derived PDAC.
Materials and Methods
Mice
Experimental animals were generated by crossing Hnf1b-CreERT2 mice (a gift from Jorge Ferrer, Imperial College),19 Brg1flox mice, and Ptenflox mice (Stock No. 004597; Jackson Laboratory). For the induction of Cre-mediated recombination, tamoxifen (Sigma-Aldrich) was administered 6 times: once a day by oral gavage at a dose of 400 mg/kg, every 2 days including 1 week of drug withdrawal. The courses are outlined in Figure 1B. For comparison with conventional PDAC, we generated Ptf1a-Cre; LSL-KrasG12D; p53flox/+(KPC) mice by crossing Ptf1a-Cre mice (a gift from Yoshiya Kawaguchi, Kyoto University),25 LSL-KrasG12D mice (a gift from David Tuveson, Cold Spring Harbor Laboratory),26 and p53flox/+ mice (purchased from The Jackson Laboratory, JAX strain 008462). The mice were crossed with a mixed background with no selection for a specific sex. All experiments involving mice were approved by the Animal Research Committee of Kyoto University and performed in accordance with Japanese government regulations.
Histology and IHC
For histological analyses, mouse organs were isolated and fixed overnight in 4% paraformaldehyde, dehydrated in 70% ethanol for 2 days, embedded in paraffin, and sectioned at 5 μm thickness. Paraffin-embedded sections were stained with H&E. For IHC, antigen retrieval was performed by boiling the sections in 10 mM citric acid buffer (pH 6.0) or ethylenediaminetetraacetic acid buffer (pH 8.0) for 15 minutes at 98°C. Blocking was performed by incubating the sections with a blocking solution (Cat. no. X0909; Dako). The samples were then incubated with primary antibodies overnight at 4°C in a humidified chamber, followed by secondary antibody incubation for 1 hour at room temperature. Peroxidase-streptavidin labeling was performed using a VECTASTAIN Elite ABC Standard Kit (Cat. no. PK-6100; Vector Laboratories). The sections were then stained with a diaminobenzidine substrate (Cat. no. K3468; Dako) and counterstained with hematoxylin (Cat. no. 109249; Sigma-Aldrich). The primary antibodies used in this study are listed in Table 1. For IHC analysis, different high-power field sections from each of the 3 mice were quantitatively analysed to determine the proportion of epithelial cells positively stained for Ki-67, Pdx1, Sox9, Hnf1β, and Taz.
Table 1.
Primary Antibodies for IHC
| Antibodies | Source | Dilution | Catalog no. |
|---|---|---|---|
| MUC1 | Abcam | 1:200 | ab15481 |
| MUC2 | SantaCruz | 1:200 | sc-15334 |
| MUC5AC | Abcam | 1:200 | Ab3649 |
| Phospho-Akt S475 | Cell Signaling | 1:200 | #4060 |
| BRG1 | Abcam | 1:200 | ab110641 |
| CK19 | Abcam | 1:200 | ab52625 |
| Ki67 | BioLegend | 1:100 | 652402 |
| PDX1 | Abcam | 1:10000 | ab47308 |
| SOX9 | Millipore | 1:1000 | AB5535 |
| HNF1β | Proteintech | 1:200 | 12533-1-AP |
| TAZ | CST | 1:400 | #72804 |
| CYR61 | CST | 1:50 | #39382 |
| BIRC5 | CST | 1:400 | #2808 |
| CTGF | Abcam | 1:200 | AB6992 |
| ANKRD1 | Sigma-Aldrich | 1:200 | MABS1228 |
| BRM | CST | 1:200 | #11966S |
| ARID1A | Abcam | 1:200 | ab182560 |
| PBRM1 | Bethyl | 1:500 | A301-591A |
IHC, immunohistochemistry.
Three-dimensional Culture and Xenograft
For the xenograft models, organoid cultures were established from murine pancreatic tissues. Mouse pancreatic tissues were minced into small pieces and digested with dissociation buffer at 37°C for 15 to 20 minutes. The dissociation buffer consisted of Dulbecco’s Modified Eagle Medium (DMEM) with 10 % fetal bovine serum (FBS), 1 mg/mL collagenase D (Roche Diagnostics Deutschland GmbH), 0.5 mg/mL dispase (Invitrogen), and 40 μg/mL DNase (Roche Diagnostics Deutschland GmbH). The tissue suspension was passed through a 100-mmol/L cell strainer and washed twice with DMEM containing 10% FBS. Washed cells were mixed with 20 μL Matrigel per well on a 48-well plate. Passaging was performed at 1:4 to 1:8 split ratios once per week. For passaging, organoids were digested in TrypLE (Invitrogen) for 10 minutes at 37°C. Centrifuged cells were mixed with 20 μL Matrigel per well on a 48-well plate. Expansion Medium (L-WNR Conditioned Medium-based, detailed below) was used.
After passaging thrice, the organoids were passaged at 5.0 × 104 cells/well. The organoids were obtained from 3 wells 3 days after passage. Harvested organoids were suspended in 50 μL Matrigel + 50 μL Ad-DMEM/F12 and subcutaneously injected into NOD/SCID mice (NOD.CB17- Prkdcscid/J; purchased from The Jackson Laboratory, JAX strain 001303) at one site. Organoids established from 4 individual HP or HPB mice were transplanted. After 3 months, tumorigenicity was assessed.
Expansion Medium (L-WNR Conditioned Medium-based)
The Expansion Medium comprised a 50% conditioned medium of the L-cell line secreting Wnt3a, R-spondin3, and Noggin (L-WRN CM), supplemented with 10 mmol/L Y-27632 (Tocris Bioscience) and 2 mmol/L SB 431542 (Tocris Bioscience). L-WRN CM was prepared using the L-WRN cell line (ATCC; CRL-327627).
Pancreatic Duct Isolation, RNA Isolation, and qRT-PCR
To isolate pancreatic ductal cells, we used ductal cell-specific Dolichos biflorus agglutinin lectin labelling, followed by magnetic bead separation.28 The pancreases from 3 HP and 3 HPB mice were harvested 3 weeks after tamoxifen administration. Each pancreatic sample was digested, as described in the organoid culture section. The filtered cell suspension was incubated on ice for 10 minutes with 200 mL of 1:200 diluted DBA lectin–fluorescein isothiocyanate (Cat. no. FL-1031; Vector Laboratories) in sorting buffer (Hank’s balanced salt solution containing 0.5% bovine serum albumin [Sigma-Aldrich] and 2 mM ethylenediaminetetraacetic acid [Invitrogen]). The cells were washed with 700 mL sorting buffer and centrifuged, and the pellet was incubated for 15 minutes on ice with anti-fluorescein isothiocyanate microbeads (Cat. no. 130-048-701; Miltenyi Biotec). The cells were washed again in 1 mL of sorting buffer and centrifuged, after which the pellet was resuspended in sorting buffer and magnetically sorted using a mass spectroscopy column (Cat. no. 130- 042-201; Miltenyi Biotec). From isolated pancreatic ductal cells, total RNA was extracted using the RNeasy Micro Kit (Qiagen). Extracted RNAs were used for RNA-seq, which was performed by Macrogen, Inc on the Novaseq6000 platform with 2 × 100 bp paired-end sequencing using the SMART-Seq v4 Ultra Low Input RNA kit and Nextera XT DNA Library Preparation Kit. Adaptors and low-quality bases were trimmed from the reads using Trimmomatic (version 0.39)29 with default parameters. Reads were mapped to the Mus musculus reference genome build mm10 using STAR (version 2.7.3a)30 and counted using RNA-seq by Expectation-Maximization (version 1.3.1).31 Read count data were normalized using the DEseq2 method.32 Normalized count data were used for GSEA,33 and differentially expressed genes were determined using a false discovery rate cutoff value of <0.05.
Single-stranded complementary DNA was synthesised using a ReverTra Ace qPCR RT Kit (TOYOBO). qRT-PCR was performed using SYBR Green Master Mix (Roche Diagnostics Deutschland GmbH) and a LightCycler 480 (Roche Diagnostics Deutschland GmbH). The expression levels were standardized by comparing them to the levels of b-actin. The primer sequences are listed in Table 2.
Table 2.
Primer Sets for qRT-PCR Analyses
| Gene Symbol | Forward | Reverse |
|---|---|---|
| Actb | CTGACTGACTACCTCATGAAGATCCT | CTTAATGTCACGCACGATTTCC |
| Ctgf | TGCGAAGCTGACCTGGAGGAAA | CCGCAGAACTTAGCCCTGTATG |
| Ankrd1 | GCTTAGAAGGACACTTGGCGATC | GACATCTGCGTTTCCTCCACGA |
| Birc5 | GAGGCTGGCTTCATCCACTG | CTTTTTGCTTGTTGTTGGTCTCC |
| Cyr61 | CTGCGCTAAACAACTCAACGA | GCAGATCCCTTTCAGAGCGG |
| Igfbp3 | CACACCGAGTGACCGATTCC | GTGTCTGTGCTTTGAGACTCAT |
| Axl | GGAACCCAGGGAATATCACAGG | AGTTCTAGGATCTGTCCATCTCG |
| Hnf1b | GTTACTGCCGTCCCCGAATTT | CGGCTTGGTGTCGAGATCC |
| Pdx1 | TTCCCGAATGGAACCGAGC | GCGTGAGCTTTGGTGGATT |
| Pcna | TTGCACGTATATGCCGAGACC | GGTGAACAGGCTCATTCATCTCT |
| Ccnd1 | GCGTACCCTGACACCAATCTC | ACTTGAAGTAAGATACGGAGGGC |
| Mki67 | ATCATTGACCGCTCCTTTAGGT | GCTCGCCTTGATGGTTCCT |
qRT-PCR, quantitative reverse-transcription polymerase chain reaction.
VP Administration
VP was administered according to a previous report.34 VP (AOBIOUS) or vehicle was administered via intraperitoneal injection. VP was dissolved in dimethyl sulfoxide (100 mg/mL), aliquoted, and stored at −80°C. The working solution was freshly prepared in phosphate-buffered saline (PBS) at a concentration of 10 mg/mL before use. The mice were administered 100 mg/kg 3 times per week after the first tamoxifen administration. After 4 weeks of treatment, the mice were sacrificed, and pancreatic tissue was collected for histological analysis.
Clinical Samples
Surgically resected specimens from 12 human intraductal tubulopapillary neoplasms were obtained from patients admitted to Kyoto University Hospital (n = 5), Kindai University Hospital (n = 3), Kitano Hospital (n = 2), Kyoto Katsura Hospital (n = 1), and Hyogo Prefectural Amagasaki General Medical Center (n = 1). The study protocol was approved by the Ethics Committee of the Kyoto University Hospital (R2904). IHCs of human specimens were simultaneously performed under the same conditions for each antibody. The expression of each protein was semi-quantified at 4 levels: strong (red; 3), moderate (green; 2), weak (blue; 1), and negative (black; 0). Associations among BRG1, BRM, ARID1A, PBRM1, and TAZ expression levels in human specimens were assessed using Spearman’s correlation coefficients. Scatterplots with jittering and linear regression fitting were generated using Python (version 3.11.8). To improve the visibility of the overlapping data points, jittering was applied to the duplicated data points. Jittering was performed by adding a small random value (±0.1) to both the X and Y coordinates for duplicated data, whereas unique data points remained at their original positions. A linear regression line was fitted to the data using the scipy.stats.linregress function. The regression line was plotted using the following equation: y = ax + b, where a is the slope and b is the intercept, obtained from the least-squares linear regression model. The X-axis range was set to −0.2 to 3.5, and the Y-axis range was set to 0 to 3.5. The major ticks for both axes were set at 0, 1, 2, and 3.
Statistical Analyses
Data are presented as means ± standard deviations (SDs). A 2-tailed Student’s t-test was performed to analyze the statistical differences between the 2 groups. One-way analysis of variance (ANOVA) and Dunnett’s test were performed to analyze the statistical differences among 3 or more groups. P values < .05 were considered statistically significant. All statistical analyses were performed using GraphPad Prism (version 10.4.1; GraphPad Software Inc).
Acknowledgments
The authors thank all members of the AF laboratory for their technical assistance and helpful discussions. We also thank D. Reisman of the University of Florida, with permission from P. Chambon, for sharing Brg1flox mice and J Ferrer for sharing Hnf1bCreERT2 mice.
CRediT Authorship Contributions
Kei Iimori (Conceptualization: Lead; Data curation: Lead; Formal analysis: Lead; Funding acquisition: Supporting; Investigation: Lead; Methodology: Lead; Validation: Lead; Visualization: Lead; Writing – original draft: Lead)
Akihisa Fukuda (Conceptualization: Equal; Funding acquisition: Lead; Resources: Lead; Supervision: Lead; Writing – review & editing: Lead)
Munemasa Nagao (Methodology: Supporting; Supervision: Supporting; Writing – review & editing: Supporting)
Sho Matsuyama (Supervision: Supporting)
Munehiro Ikeda (Supervision: Supporting)
Yoko Masui (Supervision: Supporting)
Shinnosuke Nakayama (Supervision: Supporting)
Naoki Aoyama (Supervision: Supporting)
Kenta Mizukoshi (Supervision: Supporting)
Munenori Kawai (Supervision: Supporting)
Go Yamakawa (Supervision: Supporting)
Kosuke Iwane (Supervision: Supporting)
Mayuki Omatsu (Supervision: Supporting)
Yu Muta (Supervision: Supporting)
Takahisa Maruno (Supervision: Supporting; Writing – review & editing: Supporting)
Kosuke Minaga (Resources: Equal)
Katsutoshi Kuriyama (Resources: Equal)
Shujiro Yazumi (Resources: Equal)
Osamu Araki (Resources: Equal)
Yuki Yamauchi (Resources: Equal)
Takayuki Anazawa (Resources: Equal)
Kazuyuki Nagai (Resources: Equal)
Jorge Ferrer (Resources: Supporting)
Yuki Nakanishi (Funding acquisition: Supporting; Supervision: Equal; Writing – review & editing: Equal)
Tatsuaki Tsuruyama (Supervision: Equal; Writing – review & editing: Equal)
Etsuro Hatano (Resources: Equal)
Hiroshi Seno (Funding acquisition: Lead; Supervision: Equal; Writing – review & editing: Equal)
Footnotes
Conflicts of interest The authors disclose no conflicts.
Funding This work was supported in part by Grants-in-Aid from the JSPS KAKENHI (23K21432, 23H02891, 23K27582, 23KJ1332, 24K02438, 25K02638), Japan Agency for Medical Research and Development, P-PROMOTE (23ama221326h0001, 24ama221326h0002, 24ama221515h0003, 24ama221139h0001, 25ama221444h0001, 25ama221139h0002, 25ama221326h0001), Moonshot Research and Development Program (JPMJMS2022, JP22zf0127009), COI-NEXT (JPMJPF2018), Fusion Oriented REsearch for disruptive Science and Technology (FOREST, 23719768), and foundations of Takeda Science, Princess Takamatsu Cancer Research, Astellas, Daiichi Sankyo of Life Science, Yasuda, Uehara, Naito, and Kyoto University.
Data Availability All original RNA sequencing data were deposited in the Gene Expression Omnibus database at National Center for Biotechnology Information (GSE304938). The data that support the findings of this study are included in this article and accompanying table or are available from the corresponding author upon reasonable request.
References
- 1.Siegel R.L., Giaquinto A.N., Jemal A. Cancer statistics, 2024. CA Cancer J Clin. 2024;74:12–49. doi: 10.3322/caac.21820. [DOI] [PubMed] [Google Scholar]
- 2.Bilimoria K.Y., Bentrem D.J., Ko C.Y., et al. National failure to operate on early stage pancreatic cancer. Ann Surg. 2007;246:173–180. doi: 10.1097/SLA.0b013e3180691579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Doi R., Imamura M., Hosotani R., et al. Japan Pancreatic Cancer Study Group Surgery versus radiochemotherapy for resectable locally invasive pancreatic cancer: final results of a randomized multi-institutional trial. Surg Today. 2008;38:1021–1028. doi: 10.1007/s00595-007-3745-8. [DOI] [PubMed] [Google Scholar]
- 4.Hingorani S.R., Petricoin E.F., Maitra A., et al. Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell. 2003;4:437–450. doi: 10.1016/s1535-6108(03)00309-x. [DOI] [PubMed] [Google Scholar]
- 5.Hingorani S.R., Wang L., Multani A.S., et al. Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell. 2005;7:469–483. doi: 10.1016/j.ccr.2005.04.023. [DOI] [PubMed] [Google Scholar]
- 6.Yamaguchi K., Kanemitsu S., Hatori T., et al. Pancreatic ductal adenocarcinoma derived from IPMN and pancreatic ductal adenocarcinoma concomitant with IPMN. Pancreas. 2011;40:571–580. doi: 10.1097/MPA.0b013e318215010c. [DOI] [PubMed] [Google Scholar]
- 7.Yamaguchi H., Shimizu M., Ban S., et al. Intraductal tubulopapillary neoplasms of the pancreas distinct from pancreatic intraepithelial neoplasia and intraductal papillary mucinous neoplasms. Am J Surg Pathol. 2009;33:1164–1172. doi: 10.1097/PAS.0b013e3181a162e5. [DOI] [PubMed] [Google Scholar]
- 8.Basturk O., Adsay V., Askan G., et al. Intraductal tubulopapillary neoplasm of the pancreas: a clinicopathologic and immunohistochemical analysis of 33 cases. Am J Surg Pathol. 2017;41:313–325. doi: 10.1097/PAS.0000000000000782. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Basturk O., Berger M.F., Yamaguchi H., et al. Pancreatic intraductal tubulopapillary neoplasm is genetically distinct from intraductal papillary mucinous neoplasm and ductal adenocarcinoma. Mod Pathol. 2017;30:1760–1772. doi: 10.1038/modpathol.2017.60. [DOI] [PubMed] [Google Scholar]
- 10.Mafficini A., Simbolo M., Shibata T., et al. Integrative characterization of intraductal tubulopapillary neoplasm (ITPN) of the pancreas and associated invasive adenocarcinoma. Mod Pathol. 2022;35:1929–1943. doi: 10.1038/s41379-022-01143-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Fukunaga Y., Fukuda A., Omatsu M., et al. Loss of Arid1a and Pten in pancreatic ductal cells induces intraductal tubulopapillary neoplasm via the YAP/TAZ pathway. Gastroenterology. 2022;163:466–480.e6. doi: 10.1053/j.gastro.2022.04.020. [DOI] [PubMed] [Google Scholar]
- 12.Mashtalir N., D’Avino A.R., Michel B.C., et al. Modular organization and assembly of SWI/SNF family chromatin remodeling complexes. Cell. 2018;175:1272–1288.e20. doi: 10.1016/j.cell.2018.09.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Xu J., Chi Z. Esophageal carcinoma with SMARCA4 mutation: a narrative review for this rare entity. Transl Gastroenterol Hepatol. 2024;9:24. doi: 10.21037/tgh-23-84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Reisman D.N., Sciarrotta J., Wang W., et al. Loss of BRG1/BRM in human lung cancer cell lines and primary lung cancers: correlation with poor prognosis. Cancer Res. 2003;63:560–566. [PubMed] [Google Scholar]
- 15.Karanian-Philippe M., Velasco V., Longy M., et al. SMARCA4 (BRG1) loss of expression is a useful marker for the diagnosis of ovarian small cell carcinoma of the hypercalcemic type (ovarian rhabdoid tumor): a comprehensive analysis of 116 rare gynecologic tumors, 9 soft tissue tumors, and 9 melanomas. Am J Surg Pathol. 2015;39:1197–1205. doi: 10.1097/PAS.0000000000000475. [DOI] [PubMed] [Google Scholar]
- 16.von Figura G., Fukuda A., Roy N., et al. The chromatin regulator Brg1 suppresses formation of intraductal papillary mucinous neoplasm and pancreatic ductal adenocarcinoma. Nat Cell Biol. 2014;16:255–267. doi: 10.1038/ncb2916. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Tsuda M., Fukuda A., Roy N., et al. The BRG1/SOX9 axis is critical for acinar cell-derived pancreatic tumorigenesis. J Clin Invest. 2018;128:3475–3489. doi: 10.1172/JCI94287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Araki O., Tsuda M., Omatsu M., et al. Brg1 controls stemness and metastasis of pancreatic cancer through regulating hypoxia pathway. Oncogene. 2023;42:2139–2152. doi: 10.1038/s41388-023-02716-4. [DOI] [PubMed] [Google Scholar]
- 19.Solar M., Cardalda C., Houbracken I., et al. Pancreatic exocrine duct cells give rise to insulin-producing beta cells during embryogenesis but not after birth. Dev Cell. 2009;17:849–860. doi: 10.1016/j.devcel.2009.11.003. [DOI] [PubMed] [Google Scholar]
- 20.Malta T.M., Sokolov A., Gentles A.J., et al. Cancer Genome Atlas Research Network. Machine learning identifies stemness features associated with oncogenic dedifferentiation. Cell. 2018;173:338–354.e15. doi: 10.1016/j.cell.2018.03.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Rhim A.D., Mirek E.T., Aiello N.M., et al. EMT and dissemination precede pancreatic tumor formation. Cell. 2012;148:349–361. doi: 10.1016/j.cell.2011.11.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Diepenbruck M., Waldmeier L., Ivanek R., et al. Tead2 expression levels control the subcellular distribution of Yap and Taz, zyxin expression and epithelial-mesenchymal transition. J Cell Sci. 2014;127:1523–1536. doi: 10.1242/jcs.139865. [DOI] [PubMed] [Google Scholar]
- 23.Prall O.W.J., Rogan E.M., Musgrove E.A., et al. C-myc or cyclin D1 mimics estrogen effects on cyclin E-Cdk2 activation and cell cycle reentry. Mol Cell Biol. 1998;18:4499–4508. doi: 10.1128/mcb.18.8.4499. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Choi W., Kim J., Park J., et al. YAP/TAZ initiates gastric tumorigenesis via upregulation of MYC. Cancer Res. 2018;78:3306–3320. doi: 10.1158/0008-5472.CAN-17-3487. [DOI] [PubMed] [Google Scholar]
- 25.Kawaguchi Y., Cooper B., Gannon M., et al. The role of the transcriptional regulator Ptf1a in converting intestinal to pancreatic progenitors. Nat Genet. 2002;32:128–134. doi: 10.1038/ng959. [DOI] [PubMed] [Google Scholar]
- 26.Jackson E.L., Willis N., Mercer K., et al. Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras. Genes Dev. 2001;15:3243–3248. doi: 10.1101/gad.943001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Miyoshi H., Stappenbeck T.S. In vitro expansion and genetic modification of gastrointestinal stem cells in spheroid culture. Nat Protoc. 2013;8:2471–2482. doi: 10.1038/nprot.2013.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Reichert M., Takano S., Heeg S., et al. Isolation, culture and genetic manipulation of mouse pancreatic ductal cells. Nat Protoc. 2013;8:1354–1365. doi: 10.1038/nprot.2013.079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Bolger A.M., Lohse M., Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Dobin A., Davis C.A., Schlesinger F., et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15–21. doi: 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Li B., Dewey C.N. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics. 2011;12:323. doi: 10.1186/1471-2105-12-323. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Love M.I., Huber W., Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Subramanian A., Tamayo P., Mootha V.K., et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102:15545–15550. doi: 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zhang L., He X., Liu X., et al. Single-cell transcriptomics in medulloblastoma reveals tumor-initiating progenitors and oncogenic cascades during tumorigenesis and relapse. Cancer Cell. 2019;36:302–318.e7. doi: 10.1016/j.ccell.2019.07.009. [DOI] [PMC free article] [PubMed] [Google Scholar]










