Hybridization, high genetic diversity, and molecular evidence of drug resistance to albendazole and levamisole in Haemonchus populations infecting goats in Thailand

Abstract

Background

Haemonchosis, due to infection with Haemonchus contributes to livestock morbidity globally, resulting in economic losses. Hybrids between Haemonchus contortus and H. placei have been evidenced, where sharing of hosts, geographical sympatry, and farming practices allow opportunities for hybridization. In Thailand, high prevelances of H. contortus infecting goats have been documented, and high levels of drug resistance are strongly suspected, due to unregulated and widespread use of anthelmintics (e.g. benzimidazoles and imidazothiazoles). Moreover, the exchange of genetic material facilitates the spread of anthelmintic resistance. Here, we aim to identify the Haemonchus species infecting goats, investigate their population genetic structure, and assess anthelmintic resistance to albendazole and levamisole.

Results

Using 188 Haemonchus adults obtained from goats across six provinces in Thailand, molecular identification was performed using the nuclear ITS2 region. The population genetic structure was investigated by amplifying the mitochondrial COI gene of representative H. contortus specimens. Genotypic resistance to albendazole and levamisole resistance status were assessed via the single-nucleotide polymorphisms in the β-tubulin and hco-acr-8 gene, respectively. Of the specimens, 97.3% were molecularly identified as H. contortus, while 2.7% were potential hybrids between H. contortus and H. placei. Hybrids were identified in Nakhon Pathom, Kanchanaburi, Ratchaburi, and Suphanburi provinces. The population genetic structure of H. contortus revealed high genetic diversity, high gene flow, and low genetic differentiation between populations. High levels of albendazole resistance were detected, with an overall frequency of 0.56 and 0.44 for the susceptible and resistant alleles, respectively. Compared to albendazole, lower levels of levamisole resistance were obtained, with an overall frequency of 0.87 and 0.13 for the susceptible and resistant alleles, respectively.

Conclusions

This study revealed the hybrid form of H. contortus and H. placei in goats, high genetic diversity of H. contortus populations, and the presence of albendazole and levamisole resistance. The growing challenge of drug resistance and hybridization in Haemonchus populations demonstrates the urgent need for regulated drug use and the implementation of sustainable management practices.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-025-05133-9.

Background

Haemonchosis, caused by gastrointestinal nematodes of the genus Haemonchus, is a major contributor to livestock morbidity on a global scale [1, 2]. This parasitic infection leads to severe anemia, edema, and weight loss, reducing reproductive efficiency, milk yields, and meat production, culminating in significant economic losses for farmers. Furthermore, anthelmintic treatment costs represent an additional financial strain on livestock producers [1, 3]. Over 10 Haemonchus species have been identified in ruminants, with H. contortus and H. placei being the most widespread in tropical and subtropical regions [3, 4]. These two species are closely related both morphologically and genetically and can be found in sympatry [5]. The sharing of hosts, geographical sympatry, and farming practices where animals are free roaming allows for co-infection and subsequent opportunities for hybridization.

Hybrids between H. contortus and H. placei have been documented in both experimental and field settings [6]. Through experimental transplantation of adults into a recipient host, evidence of hybridization between H. contortus and H. placei was established, with the F1 female progeny producing fertile offspring if backcrossed to either of its parental species [7, 8]. Genetic evidence of hybrids between both species using the nuclear Internal Transcribed Spacer 2 (ITS2) region was demonstrated in field ruminants in Pakistan and Brazil [9]. In Thailand, although genetic confirmation of hybrids is lacking, ecological conditions suggest their possible presence [10]. More importantly, the exchange of genetic material between both species may facilitate the spread of resistance alleles.

The growing problem of anthelmintic resistance poses a serious threat to the future of livestock farming. Several factors contribute to this escalation, including the high reproductive potential of Haemonchus, its broad host range, global livestock trade, and improper use of anthelmintics—all of which accelerate the selection of resistance alleles in these nematode populations [1, 11, 12]. Resistance to the three primary classes of anthelmintics—benzimidazoles, imidazothiazoles, and macrocyclic lactones has already been reported across Asia, Australia, and Europe, leaving limited treatment options [13, 14]. In Thailand, the unregulated and widespread use of anthelmintics among livestock owners raises an immediate red flag, particularly as high levels of drug resistance are strongly suspected. Recently, albendazole and levamisole resistant Haemonchus and Trichostrongylus populations were detected from goats in Ratchaburi Province [15]. Moreover, resistance to all three drug classes has been documented in goats from Sing Buri province, and a survey spanning eight other provinces highlighted widespread albendazole resistance in H. contortus [16, 17]. Additionally, the potential presence of Haemonchus hybrids in Thailand’s goats may play an important role in facilitating resistance spread.

External pressures—including environmental changes, competition between species, and intensive anthelmintic usage can influence the genetic structure of nematode populations, facilitating rapid adaptation [18, 19]. Examining the genetic structure of Haemonchus populations in Thailand may provide insights into their transmission patterns and drug resistance patterns. Previous studies utilizing mitochondrial genes like the cytochrome c oxidase subunit I (COI) and NADH dehydrogenase 4 (ND4) genes, nuclear ITS2 region, and microsatellite markers have consistently revealed low genetic differentiation and high genetic diversity among H. contortus populations [20–23]. This phenomenon was also observed in Thailand’s H. contortus populations, where little genetic sub-structuring, low differentiation, and high gene flow were reported among 13 populations spread across multiple provinces [21].

This study seeks to close these critical gaps by analyzing adult Haemonchus specimens from six goat-infecting populations in Thailand. First, we aim to identify the Haemonchus species and the presence of potential hybrids, and second, to investigate their population structure, and third, to assess anthelmintic drug resistance status (albendazole and levamisole). While current studies detecting resistance in Thailand primarily rely on methods which are effective at assessing a farm’s overall resistance status using pooled larval samples, the resistance status of individual Haemonchus worms cannot be determined. Here, by using adult specimens, we hope to generate valuable insights into the hybrid status of Haemonchus populations in Thailand and their resistance patterns, which may offer much-needed guidance for the sustainable use of anthelmintics to control haemonchosis in goats.

Methods

Ethics statement

The study was approved by the Ethical Committee (Approved code: MUVS-2025-04-18) and the Institutional Biosafety Committee (Approval No. IBC/MUVS-B-012/2568) of the Faculty of Veterinary Science, Mahidol University. Haemonchus adults were collected post-mortem from goats at private commercial slaughterhouses. Informed consent was obtained from the slaughterhouses.

Haemonchus specimen collection

Male and female worms were isolated from goat abomasa obtained from Ang Thong, Kanchanaburi, Nakhon Pathom, Ratchaburi, Satun, and Suphanburi (Fig. 1). The collected specimens were washed in normal saline, counted, and observed under a stereomicroscope (Olympus SZ51) and an inverted compound microscope (ZEISS Primovert) for genus-level identification. A total of 188 adult Haemonchus specimens were obtained, and they were subsequently kept in 70% ethanol at − 20 °C for preservation before molecular identification.

Fig. 1.

Map of the six provinces where adult Haemonchus were obtained. The numbers represent the number of male (M) and female (F) specimens obtained per province

Molecular identification using ITS2 PCR-RFLP

Individual specimens were washed thoroughly with sterile distilled water and transferred into 1.5 ml Eppendorf tubes. Using the Geneaid gDNA Mini Kit (Geneaid Biotech Ltd, Taipei, Taiwan) and following the manufacturer’s recommendations, total genomic DNA (gDNA) was isolated from each specimen. The gDNA was kept at 4 °C prior to downstream processing.

Following the primers and protocol from Stevenson et al. (1994), molecular identification was performed using PCR restriction fragment length polymorphism (PCR-RFLP) with the nuclear ITS2 region [24]. Briefly, PCR amplification was performed using primers (NC1: 5’ – ACGTCTGGTTCAGGGTTGTT – 3’ and NC2: 5’ – TTAGTTTCTTTTCCTCCGCT – 3’). Amplification was done in a T100™ thermocycler (Bio-Rad, USA) with a final PCR volume of 30 µl. Positive amplicons (221 bp) were purified using the Geneaid PCR Purification kit (Geneaid Biotech Ltd, Taipei, Taiwan) and the purified products were subjected to enzyme digestion using the BfaI restriction enzyme (New England Biolabs, MA, USA). The resulting PCR-RFLP band patterns were visualized on a 2% agarose gel stained with SYBR™ Safe (Thermo Fisher Scientific, MA, USA). Sequencing of the purified PCR products of representative H. contortus and potential hybrids were sent to a commercial company (Tsingke Biotech, Beijing, China) for sequencing using the FastNGS method to confirm results obtained from the PCR-RFLP band patterns.

Population genetic structure of H. contortus using the COI gene

Following molecular identification, representative H. contortus specimens from each province were selected to amplify the partial mitochondrial COI gene. Ten representative specimens were used for each province, except for Ang Thong and Satun provinces, where nine and two H. contortus specimens were used, respectively. Amplification of the partial COI gene followed the protocol of Hussain et al. (2014) [25]. Amplification was conducted in a final volume of 30 µl, which contained 15 µl of 2X iTaq™ master mix (iNtRON Biotechnology, Gyeonggi, South Korea), 10 µm of each primer (NEMAT-F: 5’ –CCTACTATAATTGGTGGGTTTGGTAA– 3’ and NEMAT-R: 5’ – TAGCCGCAGTAAAATAAGCACG – 3’) and 1 ng/µl of gDNA. The 709 bp amplicons were visualized on a 1% agarose gel stained with SYBR™ Safe (Thermo Fisher Scientific, MA, USA) and subsequently sent for sequencing by FastNGS (Tsingke Biotech, Beijing, China).

Electropherograms obtained after sequencing were checked using Bioedit 7.0 and aligned in ClustalX 2.1 with other H. contortus sequences obtained from the NCBI database [26, 27]. Haemonchus placei was used as the outgroup for analysis. Phylogenetic analysis using the maximum likelihood (ML) and neighbour joining (NJ) method was performed in MEGA X [28]. The best-fit nucleotide substitution model with 1000 bootstrap iterations was used for the ML phylogenetic tree. The phylogenetic tree was visualized and labeled in FigTree 1.3.1 [29]. Genetic distance (p-distance) was calculated using MEGA X to determine intraspecies genetic variation between populations [28]. The reference sequences used are in Additional file 1.

Genetic polymorphism indices, including the number of haplotypes, haplotype diversity (H_d), nucleotide diversity (π), genetic differentiation (F_ST), non-synonymous (Ka) and synonymous (Ks) substitutions, and neutrality tests were generated using DnaSP version 6 [30]. The median-joining haplotype network was constructed using PopART version 1.7 [31].

Molecular detection of albendazole and levamisole resistance of Haemonchus

For albendazole, detection of the F200Y mutation in the β-tubulin isotype 1 gene was conducted for all 188 Haemonchus specimens using the allele-specific PCR with the primers and conditions from Silvestre and Humbert (2000) [32]. The 20 µl PCR reaction mix contained 10 µl of 2X iTaqTM master mix (iNtRON Biotechnology, Gyeonggi, South Korea), 10 µm of each primer (Ph1: 5’ – GGAACGATGGACTCCTTTCG – 3’ and Ph4: 5’ – ATACAGAGCTTCGTTGTCAATACAGA – 3’ for the susceptible allele; and Ph2: 5’ – GATCAGCATTCAGCTGTCCA – 3’ and Ph3: 5’ – CTGGTAGAGAACACCGATGAAACATA – 3’ for the resistant allele) and 5 ng/µl of gDNA. The amplicon sizes for the susceptible and resistant alleles are 550 bp and 250 bp, respectively.

For levamisole, the S168T mutation in the hco-acr-8 gene was detected using the allele-specific PCR with the primers and conditions from Baltrusis et al. (2023) [33]. The PCR reactions for the susceptible and resistant allele was conducted separately, with two different forward primers (susceptible: 5’ – TCTAAGAGGAATCCATTGTCGC – 3’ and resistant: 5’ – TCTAAGAGGAATCCATTGTCGG – 3’) and a universal reverse primer (5’ – CCGATGGTGAGCCTCATATTACA – 3’). All amplicons (184 bp) were subsequently visualized on a 1.5% gel stained with SYBR™ Safe (Thermo Fisher Scientific, MA, USA).

The genotype status of each specimen for each drug was determined, and the percentage of each genotype (SS: homozygous susceptible, RR: homozygous resistant, and RS: heterozygous) was calculated. The susceptible and resistant allele frequencies were also calculated by taking the number of each allele divided by the total number of alleles in the population.

Results

Molecular identification of Haemonchus

Molecular identification using PCR-RFLP of the nuclear ITS2 region revealed that of the 188 adult Haemonchus specimens, 97.3% (n = 183) were H. contortus, while 2.7% (n = 5) were potential hybrid between H. contortus and H. placei (Additional file 2). Haemonchus placei was not found among the specimens. In Ang Thong and Satun provinces, all specimens were identified as H. contortus, while hybrids were found in Nakhon Pathom (1 male, 1 female), Kanchanaburi (1 male), Ratchaburi (1 female), and Suphanburi (1 female). The presence of double peaks in the electropherogram at two fixed difference positions between the ITS2 sequences of H. contortus and H. placei further supported the hybrid status of the specimens. Fig. 2 presents the nucleotide positions where double peaks were observed.

Fig. 2.

Evidence of the potential hybrid form of H. contortus and H. placei in the electropherogram and sequence alignment using the nuclear ITS2 region. An asterisk (*) indicates the position of the double peaks observed at the fixed difference positions

Population genetic structure of H. contortus

After the molecular identity of the specimens were confirmed, 51 representative H. contortus specimens across the six provinces were selected to determine their population genetic structure. Intraspecies genetic distances within our specimens ranged from 0% to 6.7%, averaging 4.0%. The ML phylogeny obtained using the partial mitochondrial COI gene revealed no distinction based on locality (Fig. 3). Similarly, the haplotype network showed no clear pattern and structure, with most haplotypes containing one sequence (Fig. 4). A total of 37 haplotypes were obtained from the six provinces, while 61 haplotypes were obtained overall (10 countries). Of the haplotypes from Thailand, the largest haplotype was H38, consisting of six sequences from Nakhon Pathom, Kanchanaburi, Ratchaburi, and Suphanburi provinces.

Fig. 3.

Maximum likelihood (HKY + G + I) phylogeny of Haemonchus using the partial mitochondrial COI gene. Only bootstrap values (ML/NJ) above 70 are shown. Representative sequences from each province are colour-coded – Ang Thong in purple, Kanchanaburi in turquoise, Nakhon Pathom in dark blue, Ratchaburi in yellow, Satun in green, and Suphanburi in red. The haplotypes that contain more than one sequence are indicated in the square brackets

Fig. 4.

Median-joining haplotype network of H. contortus using the partial mitochondrial COI gene. Each circle represents a haplotype, where the number of sequences for each haplotype is proportional to the size of the circle. The localities are colour-coded accordingly, while the dashes separating the circles indicate the number of mutation changes

Diversity indices presented in Table 1 revealed high haplotype diversity, with an overall of 0.976 (range of 0.944 to 1.000), while the nucleotide diversity was 0.035 (range of 0.032 to 0.042). The neutrality test values obtained for Tajima’s D and Fu and Li’s F statistics were − 0.943 and − 0.766, suggesting rapid population growth and expansion. The direction of selection was positive, with a > 1 value obtained from the Ka: Ks ratio. Genetic differentiation results revealed an overall F_ST value of 0.003 (range of 0 to 0.046) between populations, indicative of higher genetic differentiation within the population than between populations.

Table 1.

Diversity and neutrality indices of the H. contortus populations from the six provinces using the partial mitochondrial COI gene

Province	Number of sequences	Number of haplotypes	Haplotype diversity (Hd)	Nucleotide diversity (π)	Tajima’s D	Fu and Li’s F statistic
Ang Thong	9	7	0.944	0.036	−0.262	−0.071
Kanchanaburi	10	9	0.978	0.036	−1.002	−1.040
Nakhon Pathom	10	9	0.978	0.032	−0.512	−0.216
Ratchaburi	10	9	0.978	0.041	−0.793	−0.552
Suphanburi	10	10	1.000	0.032	−0.954	−0.747
Satun	2	2	1.000	0.042	NA	NA
Overall	51	37	0.976	0.035	−0.943	−0.766

NA indicates no values obtained due to only two sequences generated

Anthelmintic drug resistance status of Haemonchus 

Of the 188 Haemonchus specimens, 82.4% were of the heterozygous (RS) genotype, 14.9% homozygous susceptible (SS) genotype, and 2.7% were of the homozygous resistant (RR) genotype for albendazole. The RR genotype was present in four out of six provinces: Nakhon Pathom, Satun, Ratchaburi, and Suphanburi. Fig. 5 depicts the percentage of genotypes obtained for each province, while the genotype and sequence for each specimen is presented in Additional files 2 and 3. The overall frequency of the susceptible and resistant alleles was 0.56 and 0.44, respectively (Table 2), where the highest frequency of the albendazole resistant allele was from Satun, followed by Ratchaburi and Nakhon Pathom. For the five potential Haemonchus hybrids, two male specimens (Kanchanaburi and Nakhon Pathom) were of the SS genotype, while the three female specimens (Nakhon Pathom, Ratchaburi, and Suphanburi) were of the RS genotype.

Fig. 5.

Albendazole and levamisole genotype proportion obtained from the 188 Haemonchus specimens

Table 2.

Albendazole and levamisole susceptible and resistant allele frequencies

Province	No. of specimens	Albendazole		Levamisole
		Susceptible (S) allele frequency	Resistant (R) allele frequency	Susceptible (S) allele frequency	Resistant (R) allele frequency
Ang Thong	9	0.56	0.44	0.78	0.22
Kanchanaburi	51	0.57	0.43	0.90	0.10
Nakhon Pathom	54	0.55	0.45	0.94	0.06
Ratchaburi	47	0.52	0.48	0.68	0.32
Suphanburi	25	0.66	0.34	1.00	0
Satun	2	0.25	0.75	1.00	0
Overall	188	0.56	0.44	0.87	0.13

For levamisole, the proportion obtained were 73.4%, 26.6%, and 0% for the SS, RS, and RR genotypes, respectively. The RS genotype was present in Ang Thong, Kanchanaburi, Nakhon Pathom, and Ratchaburi provinces, with the highest proportion in Ratchaburi (63.8%). The overall frequency of the susceptible and resistant alleles was 0.87 and 0.13, respectively, where the highest resistant allele frequency was obtained from Ratchaburi. The homozygous susceptible genotype was found in all five Haemonchus hybrids.

A total of 23.9% of the specimens were found to contain the resistant allele for both albendazole (containing the RR and RS genotypes) and levamisole (the RS genotype). The highest proportion was from Ratchaburi, where 59.6% had the resistant allele for both drugs, followed by Ang Thong (33.3%), Kanchanaburi (15.7%), and Nakhon Pathom (11.1%).

Discussion

First, the hybrid form of H. contortus and H. placei was detected in four provinces. Although H. placei was not detected, the presence of the hybrid form is still possible. Since both species can infect the same host and live in sympatry, hybridization is a plausible outcome. The free-roaming of livestock and shared grazing areas on some farms in Thailand increase the chance of contact between large and small ruminants, which may consequently increase the likelihood of cross-species transmission. Although H. contortus, H. placei and their hybrids were previously morphologically identified from goats in Thailand, molecular sequencing using the nuclear ITS2 region confirmed that the specimens were H. contortus [10]. Given the morphological similarities between H. contortus, H. placei, and their hybrids, identification solely on morphology may not be reliable. Haemonchus contortus and H. placei hybrids in goats and sheep that were coinfected with both species have been genetically identified in the field, although hybrids were found in lower proportions compared to their parent species, H. contortus and H. placei [9, 34, 36]. Similarly, our molecular data showed that H. contortus was the dominant species, while only 2.7% of the specimens were hybrids. The presence of Haemonchus hybrid suggests incomplete reproductive barrier between these two closely related species, reflecting ongoing gene flow and weak species boundaries.

Second, the population genetic structure of H. contortus revealed high genetic diversity, high gene flow, and low genetic differentiation between populations. Neutrality indices suggest rapid population expansion, with no fixed nucleotide differences in the COI gene sequences between populations, supporting the hypothesis of frequent goat movement within Thailand. Congruent with our results, Pitaksakulrat et al. (2021) also revealed high levels of gene flow among the H. contortus sampled from 13 provinces [21]. The limited time for mutations to become fixed within populations aligns with findings from similar studies on H. contortus populations in Bangladesh, China, Greece, and other Thai provinces, thus supporting the hypothesis of goat movement affecting the transmission dynamics of H. contortus [3, 20–22, 35]. Goat movement due to the import and export of goats across countries is also evidenced, with the haplotype network revealing that the isolates from Thailand’s H. contortus population were genetically similar with H. contortus populations obtained from other countries, including those in the Asian, African and South American continents. Furthermore, positive selection pressure was observed, indicative of beneficial mutations being selected to ensure parasite survival and reproduction. Consequently, parasite populations with beneficial mutations can survive, and along with frequent host movement, the chance for spreading of anthelmintic resistant alleles between H. contortus populations may be facilitated.

Third, the RS genotype for albendazole was the most frequently detected across all six provinces. Although the RR genotype constituted only 2.7% of the overall population, the combined frequency of RR and RS genotypes resulted in a resistant allele frequency of 0.44. Similarly, Pitaksakulrat et al. (2021) reported a resistant allele frequency of 0.46 among eight adult Haemonchus populations from goats in Thailand, with the heterozygous RS genotype being the majority at 44.6% [16]. The highest frequency of the resistant allele was observed in the southern provinces. In Thailand, veterinarians and farmers commonly use benzimidazole (e.g. albendazole) and macrocyclic lactones (e.g. ivermectin) drug classes to treat gastrointestinal nematode infections [16, 36]. The lack of strict regulation on the use of anthelmintic drugs, particularly in goats, likely contributes to the development of resistance. Furthermore, the frequent movement of goats and their offspring between provinces may facilitate the spread of resistance alleles. Thailand’s significant role in the international trade of goats—exporting to and importing from regions such as Southeast Asia, Africa, the United States, and Australia—further amplifies the risk of transboundary exchange of resistant genetic material [36]. The potential for the spread of resistance alleles across national borders highlights the growing global concern of anthelminthic resistance in goats.

Fourth, levamisole resistant alleles were detected from four out of the six populations sampled. Although the RR genotype was not detected, the presence of the RS genotype is concerning, with the risk of further resistance spread. As compared to albendazole, levamisole is not as widely administered in Thailand. However, levamisole resistant populations of Haemonchus were recently genotypically detected from goat farms in Ratchaburi Province, where 92% of the farms carried resistant alleles [15]. Here, the presence of dual resistance (albendazole and levamisole) confirmed by genotyping in Thailand’s adult Haemonchus populations is concerning, with the possibility of dwindling treatment options for haemonchosis. Moreover, the low frequency of homozygous resistant parasites detected may result in no observable phenotyptic resistance when phenotypic tests are used to assess the efficacy of anthelmintic drug treatments. Also, genotypic screening of ivermectin resistance is currently not possible due to the lack of molecular markers and assays available. As ivermectin is also frequently used by farmers in Thailand, ivermectin-resistant Haemonchus populations may be present, further limiting effective control of haemonchosis. Thus, in Thailand’s context, the use of both phenotypic and genotypic tests to detect anthelminthic drug resistance are encouraged.

The presence of the potential hybrid form of Haemonchus, high gene flow, and widespread albendazole resistance is a cause for concern regarding appropriate treatment and control strategies for haemonchosis in livestock. Among the five hybrids, three female specimens (from Nakhon Pathom, Suphanburi, and Ratchaburi) carried the albendazole-resistant allele in the heterozygous state. Our findings suggest the possibility of interspecies introgression of the resistant allele, with hybrid females capable of backcrossing with either H. contortus or H. placei. Interspecies introgression may thus enable the transmission of resistant alleles to future generations. Additionally, the introgression of resistant alleles from H. contortus into H. placei could lead to H. placei resistant populations. The chances of large ruminants being infected with resistant H. placei populations may be increased, especially in regions with shared pastures or co-grazing practices. Interspecies competition also exists between H. contortus and H. placei in co-infections, where field-based experiments in sheep revealed that the hybrid form and H. placei were gradually replaced by H. contortus [37]. The same phenomenon could be possible in large ruminants, where H. placei is the dominant species, allowing resistant alleles that were previously introgressed from H. contortus or their hybrid to be fixed among H. placei populations. More importantly, the global livestock trade (including other ruminants aside from goats) are at risk of the growing issue of anthelmintic resistance, especially since H. contortus, H. placei, and their hybrids are not restricted to Thailand. Furthermore, no information of treatment failure is available for Haemonchus and their hybrid, which neccisiates the urgent need for integrated molecular surveillance and adaptive parasite control strategies.

Limitations of this study include the small sample size from Satun and Ang Thong, and the lack of representation from the northern, northeastern, or eastern provinces. The number of goat abomasum sampled may not be representative of the goat population. Nevertheless, the provinces represented in this study do not overlap with the previous studies on H. contortus population genetics and albendazole resistance in Thailand, thereby offering valuable new insights and helping to close the knowledge gap on Haemonchus infections in goats in Thailand [16, 21]. Also, information regarding the drug use, frequency, and animal movement was not obtained from the slaughterhouses, and other livestock (e.g. cattle) was not included in this study.

Conclusions

By examining the population genetic structure and anthelmintic resistance status of Haemonchus from six provinces in Thailand, we detected albendazole and levamisole resistance, high genetic diversity, and the presence of hybrid form of H. contortus and H. placei in goats. Selective pressures, such as drug resistance and host movement, may play a crucial role in shaping the genetic landscape of Haemonchus, influencing its population structure and resistance mechanisms. The growing challenge of drug resistance in Thailand’s Haemonchus populations underscores the urgent need for regulated anthelminthic drug use (e.g. drug rotation), sustainable management practices, and enhanced molecular surveillance. Future studies include expanding the geographical scope to increase the sample size, investigating the presence of Haemonchus in other livestock species, assessing the resistance status of other anthelmintics, conducting more detailed genetic analyses of hybrids using microsatellite markers, and monitoring the effect of resistance and treatment efficacy in goat farms over time through both phenotypic and genotypic tests. These will enhance our understanding of Haemonchus transmission and resistance patterns in livestock.

Authors’ contributions

AC performed investigation, methodology, formal analysis, and writing the original draft. UT performed fund acquisition, conceptualization, investigation, formal analysis, and reviewing the draft. CK performed methodology, resources, and reviewing the draft. WP performed methodology, resources, and reviewing the draft. SS performed conceptualization, investigation, resources, and reviewing the draft. All authors read and approved the final manuscript.

Funding

Open access funding provided by Mahidol University. This research was funded, in whole or in part, by the Cooperation for Excellence Project Mahidol University – NSTDA [MU-NSTDA-2566-01].

Data availability

All data generated or analysed during this study are included in this published article and its additional information files. The *COI* gene sequences of representative specimens are in the NCBI database under the accession numbers PV931840 – PV931890 and in additional file 3.

Declarations

Ethics approval and consent to participate

The study was approved by the Ethical Committee (Approved code: MUVS-2025-04-18) and the Institutional Biosafety Committee (Approval No. IBC/MUVS-B-012/2568) of the Faculty of Veterinary Science, Mahidol University. In this study, parasites were collected post-mortem from goats at two private, commercial slaughterhouses. Informed consent was obtained from the slaughterhouses. It is important to note that no animals were sacrificed specifically for this research. One slaughterhouse, located in Nakhon Pathom province, sourced its animals from Nakhon Pathom itself and the neighboring provinces of Ratchaburi, Kanchanaburi, Suphanburi, and Ang Thong. The other slaughterhouse involved in the study was in Satun province.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.