Prospective investigation of feline bocavirus persistence and shedding in naturally infected cats from varied household settings

Abstract

Objectives

Feline bocavirus (FBoV) is a single-stranded DNA virus of the genus Bocaparvovirus, family Parvoviridae. First identified in 2012, it comprises three species – FBoV-1, FBoV-2 and FBoV-3 – and is globally distributed. Although associated with gastrointestinal disease in cats, its pathogenesis and shedding patterns remain unclear. This study investigated the shedding dynamics of FBoV in naturally infected cats with gastrointestinal signs.

Methods

A longitudinal sampling approach was employed in three separate multi-cat households, involving seven symptomatic cats across multiple time points. Initial FBoV screening was performed using conventional PCR and three singleplex TaqMan-based quantitative PCR (qPCR) assays were developed to detect and quantify FBoV-1, FBoV-2 and FBoV-3. The established singleplex qPCR assays were used for subsequent monitoring. Coinfection with other enteric viruses, particularly feline coronavirus (FCoV), was also evaluated.

Results

FBoV-1 and FBoV-2 were detected in multiple cats from house A, with coinfection observed in 5/9 (55.6%) cats and FBoV-1 alone in 1/9 cats. In contrast, only FBoV-1 was identified in cats from houses B and C. FCoV was frequently codetected in all households. qPCR revealed significant variation in viral load over time and across sample types. Positive viral detection persisted for 10–14 days after the resolution of clinical signs in most cases. Notably, one hospital-resident cat continued to present FBoV-1 for up to 65 days.

Conclusions and relevance

This is the first study to characterise FBoV load, and possibly shedding dynamics, in naturally infected cats using route-specific sampling and species-specific quantification. Findings demonstrate that FBoV can be present well beyond the clinical phase of illness, highlighting the possible risk of prolonged transmission or shedding in multi-cat environments. These insights are important for understanding FBoV pathogenesis and developing effective feline disease control strategies.

Introduction

Feline bocavirus (FBoV) is a non-enveloped, single-stranded DNA virus of the Parvoviridae family. First identified in 2012, it is increasingly recognised as part of the feline enteric virome.^{1 –4} The FBoV genome spans approximately 5.5 kb in length and encodes three open reading frames (ORFs): ORF1 encodes the non-structural protein NS1; ORF2 encodes the overlapping capsid proteins VP1 and VP2; and ORF3 encodes the nuclear phosphoprotein NP1. ⁵ To date, three distinct genotypes – FBoV-1, FBoV-2 and FBoV-3 – have been detected in domestic cats worldwide.^{4,6 –13}

Despite its global detection, particularly in faecal samples, the pathogenic potential of FBoV remains poorly defined. The virus has been found in both symptomatic and asymptomatic cats and is commonly codetected with other enteric pathogens, such as feline panleukopenia virus (FPLV) and feline coronavirus (FCoV).^9,14 Coinfections involving these viruses are often associated with more severe gastrointestinal signs, especially in kittens. Among the three FBoV genotypes, only FBoV-1 has occasionally been linked to gastrointestinal signs,^9,13 while the clinical relevance of FBoV-2 and FBoV-3 remains largely unexplored.

Feline viral gastroenteritis is a significant health concern, particularly in young animals. Clinical signs typically include diarrhoea, vomiting, anorexia and fever. Kittens, because of their immature immune systems, are more susceptible to severe outcomes, and untreated infections can be fatal. ² While FPLV and FCoV are the most commonly diagnosed viral agents, with well-established diagnostic tools, ¹⁵ other recently discovered viruses such as FBoV may be overlooked in clinical practice.^2,3 This diagnostic gap may contribute to inappropriate case management and increased transmission risk, particularly in multi-cat environments such as households and shelters.

A major limitation in the current understanding of FBoV lies in the lack of standardised tools for genotype-specific detection and quantification, particularly for FBoV-2 and FBoV-3. Although conventional PCR has been used for FBoV surveillance, ¹⁶ genotype-specific quantitative real-time PCR (qPCR) assays – especially for FBoV-2 and FBoV-3 – are still under development. In addition, there is a lack of data on viral load dynamics, duration of shedding, and the association between viral persistence and clinical resolution. These critical parameters are needed to evaluate whether FBoV acts as a primary pathogen, a cofactor or a commensal component of the feline enteric virome.

Bocaviruses in other species, such as humans and dogs, are known for their environmental stability and potential for prolonged shedding.^{17 –20} These characteristics suggest that FBoV may pose similar risks in feline populations, particularly in densely populated living conditions. However, to date, no longitudinal studies have monitored the shedding patterns or viral kinetics of FBoV in naturally infected cats using genotype-specific qPCR methods.

In this study, we address these knowledge gaps by investigating the infection dynamics, viral load fluctuations and shedding patterns of FBoV in symptomatic cats from three different households. We developed the novel TaqMan-based singleplex qPCR assays targeting FBoV-1, FBoV-2 and FBoV-3 and applied them in a longitudinal setting. Our approach enables the first genotypic-specific, quantitative evaluation of FBoV load over time in naturally infected cats and provides insight into codetections with FCoV. Our findings aim to clarify the role of FBoV in feline gastroenteritis and to inform future strategies for surveillance, diagnostics and disease management in domestic cats.

Materials and methods

Ethics

The research protocol was approved by the Institutional Animal Care and Use Committee (number 2231029) and the Institutional Biosafety Committee (number 2231032) of Chulalongkorn University. All sample collections were performed by licensed veterinarians with the consent of the cat owners.

Case scenario and sample collection

In this study, we conducted research on a total of 11 cats from three different households, as summarised in Figure 1. Nine cats were from house A, of which five were followed longitudinally and four were sampled at a single time point. One longitudinal case each was included from house B and house C. During the hospital visits, faecal samples from all cats in this study were examined for parasites. The findings were recorded accordingly.

Figure 1.

Case scenario of sample collection from different cat households. The study includes cats from three different households. Samples collected consist of oropharyngeal and rectal swabs, which are obtained longitudinally unless otherwise stated. In total, the study analysed samples from one necropsied cat, seven longitudinal collected samples and additional samples collected at a single time point (not shown). Key scenarios are labelled and highlighted for emphasis

House A scenario

House A was a cattery that experienced a postpartum diarrhoea outbreak in one litter. Queen 1 and her four kittens were hospitalised; the kittens presented with yellowish diarrhoea, while queen 1 was asymptomatic. Despite supportive treatment, one kitten died and was necropsied. Tissue samples – including lymph node, small and large intestines, spleen, lung, heart, kidney and brain – were collected and preserved as fresh-frozen samples at – 80°C for downstream viral screening.

After the necropsy, oropharyngeal (OS) and rectal swab (RS) specimens were collected from queen 1 and her three surviving kittens (kittens 1, 2 and 3), along with a vaginal swab (VS) from queen 1. These samples were collected longitudinally over a 1-month period, depending on the owner’s availability.

Kittens 1 and 2 were discharged after initial improvement but returned with recurrent diarrhoea alongside kitten 4 (from queen 2), which was newly admitted with bloody diarrhoea. Notably, queen 2 had a history of diarrhoea in a previous litter but not the current one. The recurrence of signs raised concerns for a secondary outbreak (Figure 1). Subsequently, longitudinal OS and RS samples were also collected from kitten 4. In addition, to assess potential viral circulation within the cattery, all adult cats in house A – including queens 1–4 and tom 1 – were sampled at a single time point using both OS and RS swabs.

To investigate the possibility of indirect transmission, environmental swabs were collected from both the hospital and household settings. Specifically, two sets of swabs were taken from the cages housing the kittens during hospitalisation. At house A, five rounds of environmental sampling were conducted from the cattery floor where queen 1 resided and from shared areas accessed by multiple cats. All environmental samples were processed in parallel with the clinical specimens. A detailed timeline of sample collection and specimen types from each individual and environment is presented in Figure 2.

Figure 2.

Timeline of sample collection for each cat across multiple time points. After the necropsy of one kitten from house A, clinical samples were collected from nine cats, five of which were sampled longitudinally, along with environmental swabs. The top timeline represents sample collection for the kittens, while the bottom timeline corresponds to the adult cats. Key events are labelled and visually highlighted. Sample collection spanned from day 26 (D26) to day 40 (D40), depending on the owner’s availability. Queens 1 and 2 are marked with a green star () and a pink star (), respectively. Kittens 1–4 are represented by green circles () and orange circles (), respectively. Environmental swabs are indicated by blue triangles ()

House B scenario

Kitten 5, a single-housed domestic cat, was presented to the veterinary hospital with clinical signs of anorexia, vomiting and yellowish watery diarrhoea, which had persisted for approximately 1 week before admission. OS and RS samples were collected at the initial visit and during subsequent hospital appointments. Diarrhoea and intermittent vomiting persisted until day 20, after which the kitten showed clinical improvement, with full resolution of signs by day 32.

However, on day 33, the owner introduced a new kitten into the household. Shortly thereafter, kitten 5 experienced a relapse of diarrhoea. Although no samples were collected from the newly introduced kitten and its health status remained unknown, the temporal association raised concerns about possible re-exposure or stress-induced reactivation. Sample collection for kitten 5 continued for a total of 43 days. The longitudinal sampling timeline and clinical progression are summarised in Figure 3.

Figure 3.

Sample collection timeline for houses B and C: kitten 5 (house B, top timeline) is labelled as a pink triangle (), and kitten 6 (house C, bottom timeline) is labelled as a blue rectangle () across different time points. Key clinical events are labelled and visually highlighted. The duration of the sample collection ranges from day 43 (D43) to day 65 (D65), depending on sample availability

House C scenario

Kitten 6 was a resident cat at the veterinary hospital, typically housed within the facility for long-term care. It presented with mild clinical signs, including depression, anorexia, vomiting and dark brown diarrhoea. A point-of-care diagnostic panel was performed, yielding negative results for FCoV, FPLV, feline leukaemia virus and feline immunodeficiency virus. OS and RS samples were collected longitudinally over a 65-day period after the onset of signs. Although kitten 6 showed clinical recovery by day 12, sample collection continued based on the veterinarian’s availability. The extended sampling period allowed for the observation of potential prolonged viral shedding under controlled hospital conditions. The sampling timeline for kitten 6 is depicted in Figure 3. Clinical signs and related medical observations were documented throughout the monitoring period.

Nucleic acid extraction, FBoV detection and selective viral screening

Fresh-frozen tissues from a necropsied kitten from house A – including lymph node, small and large intestines, spleen, lung, heart, kidney and brain – were processed for analysis. The samples were homogenised using a Bead Rupture 12 (Omni International). The supernatants were collected, and viral genomic materials were extracted using the Viral Nucleic Acid Extraction II kit (Geneaid). The quality and quantity of the extracted nucleic acids were assessed using a spectrophotometer (NanoDrop; Thermo Scientific) with a 260/280 absorbance ratio and stored at –80°C until further use.

The samples were tested for the presence of FBoV genomic material using conventional PCR and PanFBoV primers targeting the NP gene, as previously described. ¹ Briefly, the assays were carried out in a 25 µl reaction mixture containing 12.5 μl of GoTaq Green Master Mix (Promega), 0.4 μM of each primer, 3 µl of the template and sterile PCR-grade water. The amplification process began with an initial denaturation at 94°C for 5 mins, followed by 40 cycles of denaturation at 94°C for 45 s, annealing at 51°C for 45 s, extension at 72°C for 30 s, with a final extension at 72°C for 10 mins. The amplicons were visualised using an automated capillary electrophoresis device (QIAxcel DNA Screening Kit; Qiagen) and subsequently were sent for DNA sequencing using a next-generation sequencing-based method (Celemics). ⁸ The thermocycling was performed using SensoQuest Labcycler 48 (Sensoquest).

Clinical samples (OS, RS, VS) collected from houses A, B and C were subjected to viral DNA extraction and FBoV detection, as described above. Furthermore, all clinical and tissue samples were subjected to additional screening for other common feline viruses, including FCoV, FPLV, feline herpesvirus1 and feline calicivirus. The primers used for selective viral screening are listed in Table S1 in the supplementary material.

Plasmid standard control for viral load quantification

To enable accurate viral load quantification and assess the sensitivity of each singleplex qPCR assay, three plasmid standards were constructed. Each plasmid contained a 500 base pair (bp) partial fragment of the NS1 gene specific to each FBoV genotype. Sequence alignments of the NS1 gene from various FBoV strains were analysed to identify conserved regions. A 500 bp region spanning the primer and probe binding sites was selected and trimmed from downstream analysis. Sequences that best represented the majority of circulating FBoV strains – particularly those isolated in Bangkok – were selected for plasmid construction.

These plasmids served as positive controls and quantification standards in the qPCR assays. Ten-fold serial dilutions of each plasmid, in the range of 1.6 × 10¹⁰ to 1.6 × 10^–2 copies/µl, were prepared to generate standard curves for quantifying viral load across all singleplex qPCR assays.

Singleplex qPCR assays

To evaluate the viral load of specimens collected during the longitudinal study, three singleplex qPCR assays were developed, each targeting one of the three FBoV genotypes: FBoV-1, FBoV-2 and FBoV-3. Specific primers and hydrolysis probes were designed based on conserved regions within the NS1 gene of FBoV, which shows minimal sequence variability across available genomes and is therefore suitable for reliable probe construction and genotype-specific detection. All primers and probes used in this study are listed in Table 1.

Table 1.

Primers and probes for each singleplex quantitative PCR assays detecting feline bocavirus (FBoV) 1, 2 and 3

Virus	Name	Sequence 5′–3′	Length (bp)	Melting temperature (°C)	Target (bp)
FBoV-1	FBoV1_1127F	AAAGATTGTTCCGTATCACG	20	50.4	149
	FBoV1_1276R	CCCATAGTACCAGTTAATTTCC	22	50.6
	Probe	FAM-AAGATCTCCAAACACGTCTCCCTT-BHQ1	24	58
FBoV-2	FBoV2_864F	GCACTCTCGTTAATAAACAAC	21	49.5	110
	FBoV2_974R	GTAAAGTCCACCTCCTCTA	19	50.2
	Probe	HEX-CTAAACGACACTGCCAACCTGG-BHQ1	22	58.2
FBoV-3	FBoV3_1194F	GAAGAACCTATATTCAAAGGAGAC	24	50.9	126
	FBoV3_1320R	TTTTGCTCATTCTAGCGTTTAC	22	51.4
	Probe	CY5-TGAGCACCACCGAGACCCAT-BHQ2	20	61.1

BHQ1 = Black Hole Quencher 1; BHQ2 = Black Hole Quencher 2; bp = base pair; CY5 = Cyanine5; F = forward primer; FAM = fluorescein amidite; HEX = hexachlorofluorescein; R = reverse primer

Each singleplex assay was performed in a 20 µl reaction volume, consisting of 10 μl of qPCRBIO Probe Mix Lo-ROX (PCR Biosystems), 0.4 µM of each primer, 0.2 µM of TaqMan probe, 2 μl of template DNA and sterile PCR-grade water, as recommended by the manufacturer. The optimised thermocycling conditions were as follows: initial denaturation at 95°C for 3 mins followed by 40 cycles of denaturation at 95°C for 10 s, annealing and extension at 60°C for 20 s. The thermocycling was performed using a Rotor-Gene Q real-time PCR system (Qiagen). Positive controls comprised plasmid standards containing a 500 bp partial NS1 gene sequence from FBoV-1, FBoV-2 and FBoV-3. A 10-fold serial dilution of these plasmid standards, in the range of 1.6 × 10¹⁰ to 1.6 × 10^–2 copies, was used to generate standard curves for viral quantification of each FBoV genotype.

FBoV load determination

FBoV-positive samples identified by conventional PCR and the following longitudinal samples from multiple time points were subjected to FBoV load quantification using the singleplex qPCR assays established in this study. The thermocycling condition was as described above. Fluorescence signals were detected and quantified at the end of each amplification cycle. The viral load of each sample was determined by comparing the fluorescence signal to a standard plasmid control with a known concentration. Viral loads (copies/µl) were then converted to a log scale (log₁₀ copies/µl [LC/µl]) for further statistical analysis.

Statistical analysis

Statistical analyses were performed using SAS version 9.4 (SAS Institute). Descriptive statistics were generated using the MEANS procedure. Because of limitations in sample size and the grouping of animals, only intra-animal analyses were conducted. Specifically, viral loads (LC/µl) within each animal were compared across different time points using paired t-tests. A P value <0.05 was considered statistically significant. Viral load data were visualised using dot plots, with each dot representing the viral load of an individual sample. To assess temporal trends, viral loads were plotted against the number of days since the initial sample collection using MedCalc version 23.1.7 (MedCalc Software). In addition, heatmaps were generated to illustrate viral load dynamics over time, with vertical reference lines indicating time points at which statistically significant differences (P <0.05) of the viral load were observed, as determined by the SAS analysis.

Results

FBoV detection and coinfection patterns

PanFBoV conventional PCR confirmed FBoV infection in tissue samples from the necropsied kitten from house A, with sequencing results indicating coinfection with FBoV-1 and FBoV-2. Subsequent screening of clinical samples revealed that queen 1 and her three surviving kittens (kittens 1–3) tested positive for both FBoV-1 and FBoV-2 in OS and RS samples. In addition, queen 1 tested positive in the VS specimen. Despite the presence of FBoV in these samples, clinical signs – characterised by yellowish watery diarrhoea and abdominal discomfort – were observed only in the kittens, while queen 1 remained asymptomatic.

After the introduction of kitten 4, FBoV-1 was detected in RS samples, while FBoV-2 was absent. At this point, kittens 1 and 2 continued to test positive for both FBoV-1 and FBoV-2 in OS and RS samples. Screening of adult cats in house A revealed FBoV-1 positivity in queens 1 and 2; all other adult cats tested negative. Environmental swabs collected from both the hospital and the household floors were positive for both FBoV-1 and FBoV-2.

In contrast, only FBoV-1 was detected in houses B and C. Kitten 5 (house B) exhibited intermittent FBoV-1 positivity in both OS and RS samples, while kitten 6 (house C) showed persistent FBoV-1 positivity primarily in RS samples over an extended period. Codetection of FCoV was common across all households and identified in queens 1–4 and kittens 1–6. In addition, FHV-1 was detected in queen 4, tom 1 and some environmental samples, while FCoV was not detected in those particular samples.

No intestinal parasites were detected in any faecal samples apart from the viruses identified. The clinical signs of all cats included in the longitudinal study are detailed in Table S2 in the supplementary material. Selective viral screening results of the cats are shown in Figure 4.

Figure 4.

Selective viral screening results of cats in the study categorised by house A, B and C. Sample collections are conducted longitudinally unless stated otherwise. The results from selective viral screening are summarised in the accompanying table. / = positive result; FBoV = feline bocavirus; FCoV = feline coronavirus; FHV = feline herpesvirus

Longitudinal quantitative analysis of FBoV load in clinical samples

From the initial FBoV screening via conventional PCR, a total of seven cats from three households were included in this longitudinal study. FBoV-1 and FBoV-2 were codetected in queen 1 and kittens 1–4 from house A, while only FBoV-1 was identified in queen 2 (house A), kitten 5 (house B) and kitten 6 (house C). Viral loads were reported in LC/µl.

Quantitative analysis using TaqMan-based qPCR demonstrated dynamic changes in FBoV viral load over time. In house A, queen 1 exhibited persistent shedding of both FBoV-1 and FBoV-2 in OS and RS samples until day 26, with viral loads in the range of 1.92–2.5 LC/µl. Her kittens (kittens 1–3) tested positive for FBoV-1 and FBoV-2 for 17–23 days, during which viral loads gradually declined in parallel with clinical improvement. In contrast, kitten 4, introduced at a later stage, showed limited FBoV-1 detection, restricted to the early days of sampling.

In house B, kitten 5 displayed intermittent FBoV-1 shedding, with viral loads fluctuating in the range of 2.11–4.28 LC/µl. After initial recovery, a resurgence in viral load was noted after the introduction of a new household cat, suggesting possible re-exposure or stress-induced reactivation.

In house C, kitten 6 exhibited prolonged FBoV-1 shedding in RS samples, with the longest shedding period observed (up to 65 days) and a peak viral load of 5.73 LC/µl, despite clinical recovery by day 12. Details regarding viral load, sample collection days and duration of clinical signs are provided in Table S3 in the supplementary material.

Statistical analysis

Intra-animal paired comparisons of viral load across time points revealed statistically significant differences during several sampling intervals. For FBoV-1 in OS samples, significant changes in viral load were observed between days 11–19 (P = 0.018) and days 11–23 (P = 0.045). In RS samples, significant differences were noted between days 1–3 (P = 0.039), days 1–6 (P = 0.0251), days 11–18 (P = 0.042), days 11–21 (P = 0.049), days 11–23 (P = 0.049) and days 11–26 (P = 0.049).

For FBoV-2, significant reductions in viral load were detected between days 1–11 (P = 0.026) in OS samples and between days 1–3 (P = 0.027) in RS samples. Details of viral load trends and statistical results are illustrated in Figure 5 and summarised in Table S3 in the supplementary material.

Figure 5.

Viral load (log₁₀ copies/µl [LC/µl]) against days of sample collection. Scatter plots represent the quantitative data of feline bocavirus (FBoV) load in infected cats. Illustrations are generated based on FBoV strains and sampling routes, including (a) FBoV-1 oral swab (OS), (b) FBoV-1 rectal swab (RS), (c) FBoV-2 OS and (d) FBoV-2 RS. Heat map of each dot represents the viral load of a positive sample, while the black dash vertical line (----) and black arrows (⬌) mark the time points where the viral load is significantly different (P <0.05)

Discussion

FBoV is an emerging enteric virus in cats, yet its clinical relevance remains unclear. Although several studies have documented the presence of FBoV in both healthy and diseased cats worldwide,^{1,7 –12,21,22} insights into its viral load dynamics and shedding behaviour have been lacking. In this study, we addressed this gap by conducting the first longitudinal analysis of FBoV shedding patterns and viral load fluctuations in naturally infected cats using newly developed singleplex qPCR assays for FBoV-1, FBoV-2 and FBoV-3.

Our findings revealed prolonged viral shedding, with FBoV DNA remaining detectable even after clinical recovery. In particular, viral DNA persisted for 10–14 days after recovery in most kittens, and up to 65 days in one hospital-resident cat (kitten 6), suggesting a potential for prolonged shedding. These observations aligned with a previous report suggesting that bocaviruses, as non-enveloped viruses, exhibit considerable environmental stability and potential for indirect transmission, ²³ which can persist on contaminated surfaces and resist disinfection. However, it is important to note that our detection of viral DNA using qPCR does not distinguish between infectious virus and residual genomic material. Therefore, the presence of FBoV DNA in clinical samples and environmental swabs cannot be interpreted as definitive evidence of active viral replication or transmissibility.

Consistent with previous studies, ²⁴ codetection of FBoV with other enteric viruses, particularly FCoV, was common among affected cats. This complicates efforts to attribute clinical signs solely to FBoV infection. Nonetheless, the observation that one kitten (kitten 1) developed diarrhoea during the initial outbreak with only FBoV detected suggests a possible independent role of FBoV in gastrointestinal disease. Although suggestive, this finding requires cautious interpretation given the limited sample size and lack of virus isolation data.

This is the first study to evaluate FBoV viral load quantitatively over time and across sample types in naturally infected cats. The dynamic patterns of viral load over time revealed statistically significant changes across different sampling points, highlighting fluctuations in viral shedding. Notably, viral loads tended to be higher in rectal swabs compared with oropharyngeal swabs, consistent with the enteric tropism of FBoV-1 as previously described. ⁹ These findings support the utility of rectal swabs for monitoring infection dynamics in future epidemiological studies.

In addition, when compared with a previous report on FPLV viral load in kittens, ²⁵ the FBoV viral loads quantified in this study were substantially lower. This difference may be a result of variations in viral replication potency between FPLV and FBoV. Although data on FBoV pathogenesis remain limited, parallels can be drawn from human parvovirus B19 (B19V) and human bocavirus (HBoV). Several studies in young children have shown that HBoV can persist in the respiratory mucosa, regional lymph nodes and respiratory secretions, consistent with persistent, non-cytolytic infection.^26,27 In contrast, B19V exhibits high cytolytic activity, particularly in erythroid progenitor cells, leading to cell lysis and the release of large quantities of viral particles. ²⁸ These mechanistic differences may help to explain the variation in viral load dynamics between bocaviruses and parvoviruses. Further studies are needed to better clarify and quantify this matter.

In several cases, viral load dynamics provided insights into host–pathogen interactions. Most affected kittens exhibited a marked decline in viral load by day 16 post infection. However, kitten 6, which remained in a veterinary hospital, continued prolonged viral DNA shedding beyond 2 months. This unusually prolonged shedding of viral genomic material may reflect a reinfection event rather than continuous primary shedding, as evidenced by the intermittent detection pattern during part of the study period. Similarly, kitten 5, which had initially recovered, experienced a recurrence of clinical signs and viral shedding, coinciding with the introduction of new cats into the household. These findings raise the possibility of reactivation of FBoV infection triggered by stress or immune modulation, a phenomenon reported in other parvoviruses. ²⁹

Importantly, this study also documented the detection of FBoV DNA in environmental samples, underscoring the potential role of contaminated surfaces to act as viral reservoirs, particularly in multi-cat settings such as catteries or veterinary clinics. However, as stated, the detection of viral nucleic acids alone does not confirm the presence of viable, infectious virus capable of causing new infections. Further studies employing virus isolation or infectivity assays are necessary to address this limitation.

Although our study provides novel insights, several limitations should be acknowledged. First, the small number of cases limits the generalisability of our findings. Second, the inability to culture infectious virus means that conclusions about transmission risk must remain speculative. Third, coinfections with FCoV were widespread, preventing definitive attribution of clinical signs to FBoV infection alone. Finally, the lack of comprehensive immune profiling (eg, serology or immune suppression markers) in affected cats may have influenced clinical outcomes.

Conclusions

Our study highlights that FBoV DNA can persist for extended periods in naturally infected cats, with dynamic changes in viral load over time. These findings emphasise the need for further investigations into FBoV’s pathogenic potential, transmission dynamics and persistence, particularly in high-density environments such as catteries and shelters. Future studies should focus on virus isolation, infectivity assessment and larger-scale epidemiological monitoring to fully elucidate the role of FBoV in feline health.