Skip to main content
NCBI home page
BMC Oral Health logoLink to BMC Oral Health
. 2025 Nov 22;25:1822. doi: 10.1186/s12903-025-07145-1

Effects of laser regulation on anti-inflammatory and osteogenic differentiation of periodontal ligament stem cells though NF-κB signaling pathway

Rui Zhang 1,2, Xiangtao Ma 1,2, Jianing Song 1,2, Xiaoman Guo 1,2, Zeyu Chen 1,2, Taohong Liu 1,2, Mingxuan Wu 1,2,✉
PMCID: PMC12640569  PMID: 41275224

Abstract

Background

In periodontitis, the classical inflammatory NF-κB signaling pathway is activated, which promotes alveolar bone resorption and inhibits osteogenic differentiation of periodontal ligament stem cells. Low-energy laser therapy can reduce inflammation and promote healing. This in vitro study aimed to investigate the effects of different low-energy lasers on inflammation and osteogenic differentiation of human periodontal ligament stem cells (hPDLSCs) under inflammatory conditions, and to determine whether these effects are associated with the NF-κB signaling pathway at both the protein and gene levels.

Methods

Healthy premolars or third molars were collected during oral and maxillofacial surgery, and periodontal ligament tissues were obtained. hPDLSCs were cultured using the tissue block method and identified by osteogenic differentiation potential and flow cytometry. Based on treatment conditions, the cells were divided into five groups (using abbreviations from key elements of the grouping): control group (C, control), lipopolysaccharide group (L, LPS), LPS + Nd:YAG laser group (N, Nd:YAG), LPS + Er:YAG laser group (E, Er:YAG), and LPS + semiconductor laser group (D, semiconductor). Enzyme-linked immunosorbent assay (ELISA), quantitative real-time polymerase chain reaction (qRT-PCR), alizarin red staining, and immunofluorescence (IF) were performed to detect inflammatory factors, osteogenic ability, and NF-κB signaling pathway activity. Fluorescence intensity of P65 was quantified using ImageJ software. Statistical analysis was conducted using SPSS 21.0.

Results

The cultured cells were confirmed as periodontal stem cells. Statistical significance was set at P < 0.05. The CCK-8 assay showed that on day 7, the optical density (OD) values of all three laser groups were higher than those of group L (P < 0.05). Compared with group C, IL-6 and TNF-α levels in the supernatant were increased in group L (P < 0.05). After laser treatment, IL-6 and TNF-α levels in groups N, E, and D were lower than in group L (P < 0.05), with the lowest levels observed in group N. Expression of Runx-2 and OSX mRNA was higher in groups N, E, and D than in group L, with group N showing the highest expression of osteogenic genes. The fluorescence intensity of P65 in group L was significantly higher than in group C (P < 0.05), indicating increased nuclear translocation of P65. Among the laser-treated groups, group N showed the lowest nuclear P65 fluorescence intensity (P < 0.05).

Conclusions

Low-energy lasers promote anti-inflammatory activity and osteogenic differentiation of hPDLSCs in LPS-induced inflammatory environments by regulating the NF-κB signaling pathway, with Nd:YAG lasers showing the strongest effect.

Keywords: Low-energy laser therapy, NF-κB signaling pathway, Periodontal stem cells, Lipopolysaccharide, Osteogenic differentiation

Introduction

Periodontitis is a common inflammatory disease that causes progressive destruction of periodontal connective tissue and bone [1]. Approximately 11% of the global population, or about 743 million people, may be affected by severe periodontitis [2, 3]. Loss of periodontal supporting tissues leads to marked impairment of masticatory function, which greatly reduces patients’ quality of life [4]. The ultimate goal of periodontitis treatment is to regenerate lost periodontal and resorbed bone tissues while controlling inflammation. Human periodontal stem cells are seed cells of periodontal tissues with multidirectional differentiation potential [5], and they hold great promise for periodontal therapy.

NF-κB is a transcription factor widely present in mammalian cells, and the NF-κB signaling pathway is a classical inflammatory pathway. In periodontitis, cytokines and inflammatory mediators secreted by the host in response to plaque microorganisms activate the NF-κB pathway, thereby promoting alveolar bone resorption and inhibiting osteogenic differentiation of periodontal stem cells [6]. In the 1960 s, laser therapy was found to have the ability to reduce inflammation, promote healing, and reduce pain [7]. Low-level laser therapy (LLLT) acts by stimulating cells to release cytokines, chemokines, and other biological response modifiers. Low-energy lasers have been shown to suppress the inflammatory progression of periodontitis and promote regeneration of periodontal supporting tissues to some extent [8, 9]. Nd:YAG, Er:YAG, and semiconductor lasers are three types commonly used in clinical practice. Studies have demonstrated that Nd:YAG laser irradiation in an inflammatory environment enhances the osteogenic differentiation ability of bone marrow mesenchymal stem cells [7]. The low-energy mode of Er:YAG laser also promotes wound healing and activates bone metabolic factors [10]. Semiconductor laser also has the ability to promote osteogenesis and tissue healing [11, 12]. In summary, although low-intensity laser therapy shows promise in anti-inflammatory treatment, the regulation of the NF-κB pathway and its relationship with treatment efficacy have not been systematically studied in periodontal research.

We hypothesized that low-intensity laser irradiation could effectively inhibit NF-κB pathway activity in human periodontal ligament stem cells under inflammatory conditions, thereby enhancing their anti-inflammatory response, reducing secretion of pro-inflammatory factors such as TNF-α and IL-6, and simultaneously promoting osteogenic differentiation, mineralization, and expression of osteogenic genes including Runx-2 and OSX. In this study, human periodontal ligament stem cells were treated with three types of low-energy laser to evaluate their effects on inflammation and osteogenic differentiation, and to explore whether these effects are related to NF-κB pathway regulation, providing a theoretical basis for periodontal treatment using laser therapy to suppress inflammation and promote osteogenesis.

Materials and methods

Inclusion and exclusion criteria

Periodontal ligament tissues used in this study were obtained from healthy premolars or third molars extracted for orthodontic purposes or due to impaction. To ensure the health status of tissue sources and experimental reliability, strict inclusion and exclusion criteria were applied.

Inclusion criteria:

  1. Tooth type: extracted premolars or third molars.

  2. Reason for extraction: orthodontic treatment needs or asymptomatic impaction.

  3. Clinical examination: no gingivitis (GI ≤ 1) or periodontitis (PD ≤ 3 mm, CAL = 0 mm, no bleeding on probing (BOP)).

  4. Dental condition: no caries, no fillings, no cracks, and no periapical lesions (X-ray confirmed normal periapical tissue).

  5. No periodontal treatment within 6 months before extraction.

  6. Age: 13–20 years.

  7. Informed consent: all patients signed informed consent.

Exclusion criteria:

  1. Systemic diseases affecting periodontal tissue (e.g., uncontrolled diabetes, autoimmune disease, immunodeficiency, osteoporosis, active infectious disease).

  2. Active gingivitis or periodontitis (GI > 1, PD > 3 mm, CAL ≥ 3 mm, BOP).

  3. Caries, extensive fillings, pulp lesions, or periapical lesions (radiographic evidence of pathology).

  4. History of dental trauma.

  5. History of oral cancer or oral mucosal lesions.

  6. Current smokers or quit smoking less than 1 year.

  7. Long-term (> 2 weeks) use of drugs affecting periodontal tissue or immune response (e.g., NSAIDs, antibiotics, immunosuppressants, bisphosphonates, corticosteroids) within 3 months before extraction.

  8. Chemotherapy or head and neck radiotherapy within 6 months before extraction.

  9. Pregnant or lactating women.

  10.  Failed to provide informed consent

Cell culture and identification

From January 2024 to March 2024, healthy teeth were collected from five adolescent patients (13–20 years) in the Department of Oral and Maxillofacial Surgery, and their periodontal membranes were obtained. The tissues were cut into small pieces of about 1 mm3 with sterile surgical scissors, evenly spread on the bottom of 25 T culture flasks using a pipette, and 2 ml of complete medium containing 20% fetal bovine serum (FBS) was added. The flasks were placed vertically in a cell culture incubator and turned over after 4 h. The medium was changed every 2–3 days until the cell density reached approximately 80%, at which point passaging was performed. Cells from the 3rd–5th passages were reserved for subsequent experiments (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Culture and identification of hPDLSCs

Osteogenic induction and alizarin red staining

Second-generation cells were selected for osteogenic induction. Cells with good growth status were seeded into six-well plates at a density of 2 × 104/ml. When the density reached about 80%, osteogenic induction medium was added, and the cells were cultured in a constant-temperature incubator. The medium was replaced every three days.

ALP staining: After 7 days of osteogenesis, the old medium was discarded, and the wells were rinsed 2–3 times with PBS. Cells were fixed for 30 min with 4% paraformaldehyde solution and washed three times with PBS, each wash lasting 5 min. BCIP/NBT staining solution was prepared at the recommended ratio, added to the wells, and incubated at room temperature for 20 min. Cells were then rinsed several times with PBS until excess dye was removed, observed under a microscope, and photographed.

Alizarin Red staining: After 21 days of osteogenesis, the old medium was discarded, and the wells were rinsed 2–3 times with PBS. Cells were fixed for 30 min with 4% paraformaldehyde solution, then washed three times with PBS, each wash lasting 5 min. Two milliliters of 1% alizarin red solution was added to each well and incubated at room temperature for 10 min. Cells were gently rinsed several times with PBS until excess dye was removed, observed under a microscope, and photographed.

Flow cytometry

Third-generation hPDLSCs with good growth status were digested with trypsin, centrifuged at 1100 r/min for 5 min, rinsed twice with PBS, resuspended, and counted. A total of 1.0 × 10⁶ cells were prepared as a suspension with a density of 1 × 10⁶/100 μl in PBS. To each tube, 5 μl of CD29-FITC, CD90-FITC, CD45-PE, and CD34-APC antibodies was added under light-protected conditions. Antibody-free controls were prepared in parallel. Samples were mixed, incubated for 40 min, and analyzed by flow cytometry.

Experimental design

  • Group C: Control group, cultured with complete medium and routine medium change.

  • Group L: LPS group, cultured with medium containing 1 μg/ml LPS and fluid change.

  • Group N: LPS + Nd:YAG laser group, cultured with medium containing 1 μg/ml LPS for 24 h and then irradiated with Nd:YAG laser at 26.45 J/cm2.

  • Group E: LPS + Er:YAG laser group, cultured with medium containing 1 μg/ml LPS for 24 h and then irradiated with Er:YAG laser at 26.45 J/cm2.

  • Group D: LPS + semiconductor laser group, cultured with medium containing 1 μg/ml LPS for 24 h and then irradiated with 810 nm semiconductor laser at powers of 26.45 J/cm2.

The primary outcome indicators were the expression of inflammatory factors, osteogenic gene expression, and NF-κB p65 immunofluorescence. CCK-8 and Alizarin Red staining were identified as secondary outcome indicators.

Cell proliferation assay

hPDLSCs were seeded into 96-well plates at 5000 cells/well, with 100 μl of cell suspension per well. Tree replicate wells were set for each group. Cells were incubated at 37 °C, and OD values were measured with a microplate reader. On days 1, 2, 3, 5, and 7, 10 μl of CCK-8 solution was added to each well, and the plates were gently tapped to mix. Absorbance at 450 nm was measured after 1 h of incubation.

Enzyme linked immunosorbent assay (Elisa)

ELISA kits for human interleukin-6 (IL-6) and human tumor necrosis factor-α (TNF-α) were used. Cells from each group were seeded into six-well plates and cultured for 24 h. The culture supernatant was collected, centrifuged at 2000 r/min for 20 min at low temperature, and stored in EP tubes at –80 °C. Three replicate wells were set for each group.

qRT-PCR

After laser irradiation, the culture medium of each group was replaced with osteogenic induction medium. After 14 days, the expression levels of osteogenic genes Runx-2 and OSX were measured by qRT-PCR. Three replicate wells were prepared for each group.

Total RNA was extracted using the Animal RNA Extraction Kit (Biyuntian). Reverse transcription to cDNA was performed using the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time), following the manufacturer’s instructions. GAPDH served as the internal control. Primers were synthesized by Shanghai Sangong Biotechnology Co., Ltd, with the following sequences:

Primer Forward Reverse
GAPDH CAGGAGGCATTGCTGATGAT GAAGGCTGGGGCTCATTT
Runx-2 AGGCAGTTCCCAAGCATTTCATC AGTGAGTGGTGGCGGACATAC
OSX CGGCAAGAGGTTCACTCGTTCG TGGAGCAGAGCAGGCCGGTG
Open in a new tab

The results of real-time fluorescence quantitative PCR were averaged, and the expression levels of target genes were analyzed relatively and quantitatively using the 2-ΔΔCt method.

Immunofluorescence(IF)

NF-κB P65 was detected by immunofluorescence. Cells were grouped, and 2000 cells/well were seeded into 24-well plates containing cell climbing sheets. Each group was prepared in triplicate and used after 24 h. Cells were permeabilized with 0.2% Triton X-100, followed by blocking with goat serum for 40 min. The primary antibody was incubated overnight, and the secondary antibody was incubated for 60 min. After discarding the secondary antibody, cells were rinsed three times with PBS for 5 min each. The climbing sheets were removed with tweezers, sealed with DAPI-containing mounting medium, and observed under a confocal microscope. Images were captured, and fluorescence intensity was quantified using ImageJ software.

Statistical analysis

Quantitative data were expressed as mean ± standard deviation (SD). SPSS 21.0 software was used for statistical analysis. Normality was assessed using the Shapiro–Wilk test. Data met the assumption of normal distribution (P > 0.05). One-way ANOVA was used to compare groups, and pairwise comparisons were performed using the SNK method when differences were significant. Graphs were generated using GraphPad Prism software. P < 0.05 was considered statistically significant.

Results

Isolation and identification of human periodontal ligament stem cells

After 7–10 days of explant culture, cells migrated out from the periodontal membrane tissues. These cells displayed long spindle-shaped or triangular morphology, uniform cytoplasm, and radial or swirling arrangements (Fig. 2). They exhibited homogeneous morphology and good growth, consistent with the fibroblast-like features of hPDLSCs.

Fig. 2.

Fig. 2

Open in a new tab

The primary culture cells of hPDLSCs. (Inverted Microscope,4 × 10)

Alkaline phosphatase staining showed blue–purple activity regions with red nuclei (Fig. 3). Alizarin red staining revealed numerous orange–red mineralized nodules of various sizes (Fig. 4).

Fig. 3.

Fig. 3

Open in a new tab

Alkaline phosphatase staining was positive. (Inverted Microscope,10 × 10)

Fig. 4.

Fig. 4

Open in a new tab

Alizarin red staining was positive. (Inverted Microscope, 4 × 10)

Flow cytometry analysis showed 99.05% and 99.91% positivity for stem cell surface markers CD29 and CD90, and 99.98% and 99.87% negativity for hematopoietic lineage markers CD45 and CD34 (Fig. 5). These findings confirmed that the cells expressed mesenchymal stem cell markers, were of high purity, and free of epithelial contamination.

Fig. 5.

Fig. 5

Open in a new tab

Flow cytometry detection results of hPDLSCs

CCK-8

On day 3, the OD values of group C (control, cultured with complete medium) were higher than those of group L (LPS-treated, P < 0.05), with no significant difference between laser-treated groups and group L (P > 0.05). On day 5, OD values in groups N (LPS + Nd:YAG) and D (LPS + semiconductor) were higher than in group L (P < 0.05). On day 7, OD values in all three laser-treated groups were significantly higher than in group L (P < 0.05, Fig. 6). These results indicate that laser treatment enhanced the proliferation of hPDLSCs under inflammatory conditions, suggesting that the applied laser parameters were non-toxic and provided a stronger cellular basis for subsequent osteogenic differentiation.

Fig. 6.

Fig. 6

Open in a new tab

The cell growth curve of hPDLSCs. *represents P < 0.05, ** represents P < 0.01, *** represents P < 0.001, **** represents P < 0.0001

Elisa

Compared with group C (Fig. 7), IL-6 levels in the supernatant of group L were increased (P < 0.05). IL-6 levels in all laser-treated groups were lower than in group L (P < 0.05), with group E (LPS + Er:YAG) showing higher IL-6 levels than groups N and D (P < 0.05). Similarly, TNF-α levels in group L were higher than in group C (Fig. 8, P < 0.05). TNF-α levels in all laser-treated groups were reduced compared with group L (P < 0.05), with the lowest levels observed in group N, followed by groups D and E (P < 0.05). These results demonstrated that laser treatment significantly suppressed IL-6 and TNF-α secretion, confirming the anti-inflammatory effect of low-energy lasers.

Fig. 7.

Fig. 7

Open in a new tab

ELISA for IL-6 ns represents P < 0.05, ** represents P < 0.01, *** represents P < 0.001, **** represents P < 0.0001

Fig. 8.

Fig. 8

Open in a new tab

ELISA for TNF-α ns represents P < 0.05, ** represents P < 0.01, *** represents P < 0.001, **** represents P < 0.0001

Alizarin red staining

Alizarin red staining (Fig. 9) showed the presence of mineralized nodules in all groups. Group L had fewer nodules compared with group C. All three laser-treated groups exhibited more mineralized nodules than group L, with group N showing the greatest increase compared with groups E and D. These findings suggest that laser treatment not only alleviated the inhibitory effect of inflammation on osteogenic differentiation, but also significantly enhanced the mineralization capacity of hPDLSCs in vitro.

Fig. 9.

Fig. 9

Open in a new tab

Alizarin red staining (inverted phase contrast microscope, 4 × 10)

RT-PCR

RT-PCR was performed to determine the relative expression of Runx-2 and OSX genes in each group. The results (Fig. 10) showed that Runx-2 and OSX mRNA expression in group L was lower than in group C (P < 0.05). The expression levels of Runx-2 mRNA in groups N, E, and D were higher than in group L (P < 0.05). These findings indicated that low-energy laser pretreatment significantly upregulated the mRNA expression of Runx-2 and OSX, key genes in osteogenic differentiation, under inflammatory conditions (P < 0.05), which was consistent with the observed increase in mineralized nodules.

Fig. 10.

Fig. 10

Open in a new tab

Expression of mRNA. ns represents P > 0.05,*represents P < 0.05, ** represents P < 0.01, *** represents P < 0.001, **** represents P < 0.0001

Immunofluorescence

The fluorescence intensity of cytosolic P65 in group L (Fig. 11) was significantly higher than in group C (P < 0.05). The fluorescence intensity of cytosolic P65 in all three laser-treated groups was significantly lower than in group L (P < 0.05). As shown in Fig. 12, the immunofluorescence images confirmed this trend: green fluorescence signals representing NF-κB P65 were enriched in the nuclei of group E, whereas the nuclear signal was weak in group N.

Fig. 11.

Fig. 11

Open in a new tab

Cytosolic NF-κB p65 Fluorescence intensity ns represents P > 0.05, ** represents P < 0.01, *** represents P < 0.001, **** represents P < 0.0001

Fig. 12.

Fig. 12

Open in a new tab

Immunofluorescence(20 ×)

Discussion

Periodontitis is one of the most prevalent diseases worldwide and the leading cause of tooth loss in adults [13]. Excessive activation of the host immune response contributes to its development. Periodontal cells express NF-κB receptor activator ligand (RANKL) in response to pro-inflammatory mediators such as IL-6 and TNF-α, which activate the NF-κB pathway. RANKL-mediated osteoclastogenesis plays a central role in inflammatory bone resorption [14]. NF-κB is a transcription factor whose most common form of activation in inflammatory responses is the heterodimer of p50 and p65 [15]. Multiple bioactive molecules can activate cellular inflammatory responses, leading to transcriptional regulation of target genes and the initiation of various inflammatory cascades, most of which converge on the NF-κB pathway. Moreover, the NF-κB pathway regulates the differentiation, activation, and recruitment of immune cells to infection sites, thereby influencing both innate and adaptive immune responses in periodontal tissues [16–18].

Periodontal pathogens such as Porphyromonas gingivalis exert their pathogenic effects mainly through lipopolysaccharide (LPS). In vitro studies have shown that P. gingivalis and other periodontal pathogens activate the NF-κB pathway in periodontal tissues. Low-energy laser therapy can regulate proliferation, osteogenesis, inflammatory responses, and oxidative stress in human periodontal stem cells under inflammatory conditions [19], but few studies have explored the specific mechanisms by which it reduces inflammation and promotes osteogenic differentiation.

Nd:YAG laser irradiation influences the expression of genes and proteins involved in osteogenic differentiation and bone remodeling. At energy densities of 5–9.2 J/cm2, Nd:YAG laser irradiation significantly promoted proliferation of human adipose tissue stem cells, which was attributed to increased mitochondrial activity [20]. Among different lasers, Er:YAG has great potential in periodontal therapy due to its effectiveness in calculus removal and sterilization. In low-energy modes, Er:YAG irradiation promotes proliferation and adhesion of human gingival and periodontal fibroblasts [21–25]. According to Ohshio et al., low-level laser therapy (LLLT) functions during high-intensity laser treatment by allowing weak-energy lasers to penetrate and stimulate surrounding tissues and cells, promote wound healing, and activate bone metabolism factors [26]. LLLT also enhances osteoblast proliferation [27]. Aleksic et al. reported that energy densities around 4 J/cm2 improved periodontal tissue repair, including fibrous connections to tooth and alveolar bone regeneration [28]. Another study demonstrated that Er:YAG laser enhanced matrix metalloproteinase-2 expression, which may activate latent transforming growth factor-β1 and promote differentiation of adult dentin cells from pulp cells [29]. In contrast to photothermal effects, semiconductor lasers promote cell proliferation, activity, and tissue repair. These properties make low-intensity semiconductor lasers useful for disrupting pathogen biofilms, reducing inflammation, and promoting periodontal healing [11]. Low-energy semiconductor laser irradiation of human bone marrow MSCs increased neuregulin content, upregulated osteogenic markers, enhanced mineralized nodule deposition, induced stress fiber formation, and increased Ki67 expression [12]. In summary, we chose the low-energy modes of these three lasers for experiments.

In the CCK-8 assay, rapid cell growth occurred on days 1–3, followed by slower proliferation on days 5–7 due to space limitation. Growth curves of all groups showed an initial increase followed by stabilization, consistent with the growth characteristics of hPDLSCs. The OD values of group L were significantly lower than those of the other groups, indicating that LPS inhibited hPDLSC proliferation. In contrast, the selected laser parameters did not reduce proliferation or induce significant cell death, confirming biosafety. On day 7, OD values followed the order N > D > E > L, suggesting that low-energy laser therapy promoted proliferation under inflammatory conditions, with the Nd:YAG laser showing the strongest effect and the Er:YAG laser the weakest.

TNF-α and IL-6 are key cytokines regulating inflammation and bone metabolism, and their levels rise during inflammation. Laser therapy has been shown to be more effective than scaling and root planing (SRP) alone in reducing inflammatory mediators such as TNF-α and IL-6 [30]. Jin Xiaolan et al. reported that low-energy laser irradiation of LPS-induced human periodontal fibroblasts reduced TNF-α, IL-8, and IL-6 levels as detected by ELISA [31]. Furthermore, low-energy Er:YAG irradiation has been shown to downregulate proteins related to inflammation and reduce lesion site activity [32]. In this study, TNF-α and IL-6 levels were significantly higher in group L than in group C (P < 0.05). Compared with group L, groups N, E, and D showed reduced TNF-α and IL-6 expression (P < 0.05), with group N showing the most marked decrease (P < 0.0001). These findings confirmed that Nd:YAG, Er:YAG, and semiconductor lasers inhibited LPS-induced expression of inflammatory factors in hPDLSCs. Compared with previous studies, our results further demonstrated that low-energy lasers suppress LPS-induced inflammatory responses.

hPDLSCs can form osteoid and periodontal ligament-like tissues both in vitro and in vivo, and their osteogenic differentiation ability has been shown to support the repair of bone defects in periodontitis [33, 34]. Osteogenic differentiation-related genes include Runx-2 and OSX. Runx-2, an osteogenic regulator highly expressed in MSCs, is widely involved in periodontal tissue remodeling and is required for MSC proliferation and osteogenic differentiation [35]. Genetic studies have shown that OSX is a downstream target of Runx-2 and an essential regulator of bone formation [36]. In this study, the number of mineralized nodules and the expression of Runx-2 and OSX mRNA were significantly lower in group L than in group C, indicating that LPS effectively inhibited the osteogenic differentiation ability of hPDLSCs. After laser treatment, mineralized nodule formation increased in all three groups compared with group L, suggesting that low-energy laser irradiation promoted osteogenesis in LPS-induced hPDLSCs. Runx-2 and OSX mRNA expression was significantly higher in groups N and D than in group L (P < 0.05), but no significant difference was observed in OSX expression between group E and group L (P > 0.05). These findings indicated that Nd:YAG and semiconductor lasers in low-energy modes significantly enhanced mineralized nodule formation and osteogenesis-related gene expression in LPS-induced hPDLSCs. However, qRT-PCR results suggested that Er:YAG laser irradiation had no significant effect on osteogenesis in the inflammatory environment. Previous studies have shown that under inflammatory conditions, Nd:YAG laser irradiation at appropriate energy densities enhanced ALP activity, increased mineralized nodules, and elevated Runx-2 and osteocalcin expression in bone marrow MSCs, MC3T3-E1 cells, and Saos-2 cells [37–39]. In this experiment, only hPDLSCs were studied, which may limit the generalizability of the results.

NF-κB is a classical pro-inflammatory signaling pathway widely present in mammals. Pro-inflammatory cytokines such as IL-1 and TNF-α activate NF-κB, which plays a central role in regulating the expression of other pro-inflammatory genes, including cytokines, chemokines, and adhesion molecules. Downregulation of the TRIM52 gene through the TLR4/NF-κB pathway was shown to attenuate LPS-induced inflammatory injury in hPDLSCs [40]. Yu and colleagues also reported that NF-κB signaling regulates osteogenic differentiation of PDLSCs in inflammatory environments by decreasing ALP activity and the expression of osteogenic markers such as osteocalcin, Runx-2, and collagen I, in association with the TLR4 pathway [41]. Several studies have demonstrated that low-energy lasers can modulate NF-κB activity in different cell types under inflammatory conditions [42–44], but studies specifically addressing hPDLSCs remain limited. In this study, LPS-induced hPDLSCs were irradiated with low-energy modes of three different lasers to evaluate their effects on inflammation and osteogenic differentiation, and to determine whether these effects were associated with the NF-κB pathway. NF-κB p65 is the core component of the NF-κB dimer complex. In resting cells, NF-κB p65 resides in the cytoplasm, and upon stimulation, it translocates to the nucleus where it regulates transcription. NF-κB p65 nuclear translocation is widely used as an indicator of NF-κB pathway activation. In this study, NF-κB p65 was significantly upregulated in the nuclei of LPS-treated hPDLSCs, indicating pathway activation. Low-energy laser treatment reduced NF-κB p65 nuclear translocation, decreased TNF-α and IL-6 expression, and upregulated Runx-2 and OSX mRNA expression. These results suggest that inhibition of NF-κB signaling may be one mechanism by which low-energy lasers suppress inflammation and promote osteogenic differentiation. Semiconductor laser irradiation has been reported to activate mitochondrial ROS, which increases phosphorylation of JNK and IκB in bone marrow MSCs, thereby activating NF-κB and enhancing nuclear translocation of p65. This suggests that low-energy semiconductor lasers may promote cell migration through the ROS/JNK/NF-κB pathway [45]. However, in our study, the semiconductor laser inhibited NF-κB activation, which may be related to the laser parameters used or differences in cell type.

In this experiment, the inhibition of inflammatory factor release and the promotion of osteogenic differentiation of hPDLSCs by low-energy lasers under inflammatory conditions were associated with the NF-κB signaling pathway. NF-κB interacts with multiple pathways and transcription factors in inflammation, and our results provided preliminary evidence of a relationship between low-energy lasers and NF-κB signaling. However, to confirm the role of the NF-κB pathway, specific blocking experiments targeting pathway components are required. The precise causal role and mechanism must therefore be further verified in future studies. There are limitations to this study. It was restricted to in vitro experiments, laser parameters may vary, and the observation period was too short to assess long-term effects. Future research should address these limitations.

Conclusions

Low-energy Nd:YAG, Er:YAG, and semiconductor lasers suppressed inflammatory responses in LPS-induced hPDLSCs and promoted their osteogenic differentiation, with Nd:YAG showing the strongest effects. The anti-inflammatory and osteogenic effects of low-energy lasers on hPDLSCs may be mediated through inhibition of the NF-κB signaling pathway.

Acknowledgements

We would like to acknowledge the hard and dedicated work of all the staff that implemented the intervention and evaluation components of the study.

Abbreviations

NF-κB

Nuclear factor kappa-B

NF-κB p65

Nuclear factor kappa-B P65

LLLT

Low level laser therapy

LPS

Lipopolysaccharide

FBS

Fetal bovine serum

DMEM

Dulbecco’s Modified Eagle Medium

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

RT-PCR

Reverse transcription polymerase chain reaction

ELISA

Enzyme linked immunosorbent assay

DAPI

4′,6-Diamidino-2-phenylindole

hPDLSCs

Human periodontal ligament stem cells

Nd:YAG

Neodymium laser

Er:YAG

Erbium laser

IL-6

Interleukin-6

TNF-α

Tumor Necrosis Factor-α

ALP

Alkaline phosphatase

Runx2

Runt-related transcription factor 2

OSX

Osterix

IF

Immunofluorescenc

Authors’ contributions

ZR conceived the idea and conceptualised the study. SJN,MXT,GXM and CZY collected the data and analysed the data,LTH and WMX drafted the manuscript, then ZR reviewed the manuscript. All authors read and approved the final draft.

Funding

This study was supported by the Department of Education of Hebei Province (ZD20220007), and the Department of Finance of Hebei Province (ZF2023013). The funding body had no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Data availability

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

I confrm that I have read the Editorial Policy pages. The study was approved by the Institutional Review Board of the Hospital of Stomatology, Hebei Medical University (approval no. (2024) 001). This study was conducted in accordance with the declaration of Helsinki. Written informed consent was obtained from all participants.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.J S. Periodontitis: Facts, Fallacies and the Future. Periodontology 2000 (Periodontol 2000). 2017; 75:7–23. 10.1111/prd.12221. [DOI] [PubMed]
  • 2.Richards D. Review finds that severe periodontitis affects 11% of the world population. Evidence-Based Dentistry. 2014;15:70–1. 10.1038/sj.ebd.6401037. [DOI] [PubMed] [Google Scholar]
  • 3.Frencken JE, Sharma P, Stenhouse L, Green D, Laverty D, Dietrich T. Global epidemiology of dental caries and severe periodontitis - a comprehensive review. J Clin Periodontol. 2017;44(Suppl 18):S94-105. 10.1111/jcpe.12677. [DOI] [PubMed] [Google Scholar]
  • 4.Borges TF, Regalo SC, Taba MJ, Siessere S, Mestriner WJ, Semprini M. Changes in masticatory performance and quality of life in individuals with chronic periodontitis. J Periodontol. 2013;84:325–31. 10.1902/jop.2012.120069. [DOI] [PubMed] [Google Scholar]
  • 5.J L, B C, J B, Y Z, L L, F Y. Macrophage Polarization in Periodontal Ligament Stem Cells Enhanced Periodontal Regeneration. Stem cell research & therapy (Stem Cell Res Ther). 2019; 10:320. 10.1186/s13287-019-1409-4. [DOI] [PMC free article] [PubMed]
  • 6.T L. The Nuclear Factor Nf-Kappab Pathway in Inflammation. Cold Spring Harbor perspectives in biology (Cold Spring Harb Perspect Biol). 2009; 1:a1651. 10.1101/cshperspect.a001651. [DOI] [PMC free article] [PubMed]
  • 7.H C, T D, SK S, YY H, JD C, MR H. The Nuts and Bolts of Low-Level Laser (Light) Therapy. Annals of biomedical engineering (Ann Biomed Eng). 2012; 40:516–533. 10.1007/s10439-011-0454-7. [DOI] [PMC free article] [PubMed]
  • 8.M C, X L, L Z, X H. Effects of Nuclear Factor-Κb Signaling Pathway On Periodontal Ligament Stem Cells Under Lipopolysaccharide-Induced Inflammation. Bioengineered (Bioengineered). 2022; 13:7951–7961. 10.1080/21655979.2022.2051690. [DOI] [PMC free article] [PubMed]
  • 9.JH L, MH C, PH C, ML H, HE L, YH W. Anti-Inflammatory Effects of Low-Level Laser Therapy On Human Periodontal Ligament Cells: In Vitro Study. Lasers in medical science (Lasers Med Sci). 2018; 33:469–477. 10.1007/s10103-017-2376-6. [DOI] [PMC free article] [PubMed]
  • 10.Y T, R K, H G, et al. Effect of Er: Yag Laser Irradiation On Bone Metabolism-Related Factors Using Cultured Human Osteoblasts. Journal of lasers in medical sciences (J Lasers Med Sci). 2023; 14:e9. 10.34172/jlms.2023.09. [DOI] [PMC free article] [PubMed]
  • 11.C D, L M, J M, et al. Photobiomodulation-Underlying Mechanism and Clinical Applications. Journal of clinical medicine (J Clin Med). 2020; 9. 10.3390/jcm9061724. [DOI] [PMC free article] [PubMed]
  • 12.M G, F C, C S, et al. Photoactivation of Bone Marrow Mesenchymal Stromal Cells with Diode Laser: Effects and Mechanisms of Action. Journal of cellular physiology (J Cell Physiol). 2013; 228:172–181. 10.1002/jcp.24119. [DOI] [PubMed]
  • 13.Balta MG, Papathanasiou E, Blix IJ, Van Dyke TE. Host modulation and treatment of periodontal disease. J Dent Res. 2021;100:798–809. 10.1177/0022034521995157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.K S, T M, H T, T H, H D, T I, Y T, T M, K T. Osteoimmunology in Periodontitis: Local Proteins and Compounds to Alleviate Periodontitis. International journal of molecular sciences (Int J Mol Sci). 2022; 23. 10.3390/ijms23105540. [DOI] [PMC free article] [PubMed]
  • 15.Hoesel B, Schmid JA. The complexity of Nf-kappab signaling in inflammation and cancer. Mol Cancer. 2013;12:86. 10.1186/1476-4598-12-86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ke C, Se S. Microbial Nucleic Acid Sensing in Oral and Systemic Diseases. Journal of dental research (J Dent Res). 2016;95:17–25. 10.1177/0022034515609062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.S S, B B, E P, E P, L S. An Overview of Nrf2 Signaling Pathway and its Role in Inflammation. Molecules (Basel, Switzerland) (Molecules). 2020; 25. 10.3390/molecules25225474. [DOI] [PMC free article] [PubMed]
  • 18.A A, A H. Signaling Crosstalk Mechanisms that May Fine-Tune Pathogen-Responsive Nfκb. Frontiers in immunology (Front Immunol). 2019; 10:433. 10.3389/fimmu.2019.00433. [DOI] [PMC free article] [PubMed]
  • 19.L W, C L, Y S, F W. The Effect of Low-Level Laser Irradiation On the Proliferation, Osteogenesis, Inflammatory Reaction, and Oxidative Stress of Human Periodontal Ligament Stem Cells Under Inflammatory Conditions. Lasers in medical science (Lasers Med Sci). 2022; 37:3591–3599. 10.1007/s10103-022-03638-5. [DOI] [PubMed]
  • 20.Y O, H N, T S, M H, S K, A A, T I. In Vitro Cytological Responses Against Laser Photobiomodulation for Periodontal Regeneration. International journal of molecular sciences (Int J Mol Sci). 2020; 21. 10.3390/ijms21239002. [DOI] [PMC free article] [PubMed]
  • 21.SS H, P K, G B, N D, M S, B B, N P. Comparison of Er, Cr: Ysgg Laser and Hand Instrumentation On the Attachment of Periodontal Ligament Fibroblasts to Periodontally Diseased Root Surfaces: An in Vitro Study. In. 2010;81:1216–25. 10.1902/jop.2010.090715. [DOI] [PubMed]
  • 22.IS F, De Micheli G, SR C, CP E, S M, MM M. Adhesion and Growth of Cultured Human Gingival Fibroblasts On Periodontally Involved Root Surfaces Treated by Er: Yag Laser. In. 2003;74:1368–75. 10.1902/jop.2003.74.9.1368. [DOI] [PubMed]
  • 23.A P, H W, SM R, A A, I I. Effect of Low-Level Er:Yag Laser Irradiation On Cultured Human Gingival Fibroblasts. Journal of periodontology (J Periodontol). 2005; 76:187–193. 10.1902/jop.2005.76.2.187. [DOI] [PubMed]
  • 24.S K, A A, K I, et al. Biological Effects of Er:Yag Laser Irradiation On the Proliferation of Primary Human Gingival Fibroblasts. Journal of biophotonics (J Biophotonics). 2018; 11. 10.1002/jbio.201700157. [DOI] [PubMed]
  • 25.F S, A A, A S, T G, W S, J B. In Vivo Effects of an Er:Yag Laser, an Ultrasonic System and Scaling and Root Planing On the Biocompatibility of Periodontally Diseased Root Surfaces in Cultures of Human Pdl Fibroblasts. In., vol. 33; 2003: 140–147. [DOI] [PubMed]
  • 26.T O, RG C. Development of Low Reactive-Level Laser Therapy and its Present Status. In., vol. 9; 1991: 267–275. [DOI] [PubMed]
  • 27.Aleksic V, Aoki A, Iwasaki K, Takasaki AA, Wang CY, Abiko Y, et al. Low-level Er:Yag laser irradiation enhances osteoblast proliferation through activation of Mapk/Erk. Lasers Med Sci. 2010;25:559–69. 10.1007/s10103-010-0761-5. [DOI] [PubMed] [Google Scholar]
  • 28.T L, CC Y, CM L, PL H, YW L, CH Y, CJ C. Er:Yag Laser Promotes Proliferation and Wound Healing Capacity of Human Periodontal Ligament Fibroblasts through Galectin-7 Induction. Journal of the Formosan Medical Association = Taiwan yi zhi (J Formos Med Assoc). 2021;120:388–394. 10.1016/j.jfma.2020.06.005. [DOI] [PubMed]
  • 29.S Y, T N, T K, K K, R Y, R C, Y Y, N H. Effects of Er:Yag and Diode Laser Irradiation On Dental Pulp Cells and Tissues. International journal of molecular sciences (Int J Mol Sci). 2018;19. 10.3390/ijms19082429. [DOI] [PMC free article] [PubMed]
  • 30.CM C. Lasers and the Treatment of Periodontitis: The Essence and the Noise. Periodontology 2000 (Periodontol 2000). 2017; 75:205–295. 10.1111/prd.12137. [DOI] [PubMed]
  • 31.靳晓兰, 孙成蕊, 张亚男, 邹朝晖. 低能量激光照射对脂多糖介导人牙周膜成纤维细胞炎性损伤的保护作用. 中国激光医学杂志. 2021;30:17.
  • 32.Ogita M, Tsuchida S, Aoki A, et al. Increased cell proliferation and differential protein expression induced by low-level Er:Yag laser irradiation in human gingival fibroblasts: proteomic analysis. Lasers Med Sci. 2015;30:1855–66. 10.1007/s10103-014-1691-4. [DOI] [PubMed] [Google Scholar]
  • 33.G D, W W, Y L, Y A, C Z, S S, S W. Effect of Cryopreservation On Biological and Immunological Properties of Stem Cells From Apical Papilla. Journal of cellular physiology (J Cell Physiol). 2010;223:415–422. 10.1002/jcp.22050. [DOI] [PubMed]
  • 34.T I, M Y, K W, et al. Periodontal Regeneration with Autologous Periodontal Ligament-Derived Cell Sheets - A Safety and Efficacy Study in Ten Patients. Regenerative therapy (Regen Ther). 2018;9:38–44. 10.1016/j.reth.2018.07.002. [DOI] [PMC free article] [PubMed]
  • 35.X F, Y L, T H, et al. Runx2/Osterix and Zinc Uptake Synergize to Orchestrate Osteogenic Differentiation and Citrate Containing Bone Apatite Formation. Advanced science (Weinheim, Baden-Wurttemberg, Germany) (Adv Sci (Weinh)). 2018; 5:1700755. 10.1002/advs.201700755. [DOI] [PMC free article] [PubMed]
  • 36.Zhang C. Molecular mechanisms of osteoblast-specific transcription factor Osterix effect on bone formation. Beijing Da Xue Xue Bao Yi Xue Ban. 2012;44:659–65. [PubMed] [Google Scholar]
  • 37.L W, F W, C L, Y S, J G, Y Y, Y Q. Low-Level Laser Irradiation Modulates the Proliferation and the Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells Under Healthy and Inflammatory Condition. Lasers in medical science (Lasers Med Sci). 2019;34:169–178. 10.1007/s10103-018-2673-8. [DOI] [PubMed]
  • 38.IS K, TH C, K K, FE W, SJ H. High Power-Pulsed Nd:Yag Laser as a New Stimulus to Induce Bmp-2 Expression in Mc3T3-E1 Osteoblasts. Lasers in surgery and medicine (Lasers Surg Med). 2010;42:510–518. 10.1002/lsm.20870. [DOI] [PubMed]
  • 39.F C, C S, D N, C D, P T, S Z, L F, M G. Low Pulse Energy Nd:Yag Laser Irradiation Exerts a Biostimulative Effect On Different Cells of the Oral Microenvironment: "an in Vitro Study". Lasers in surgery and medicine (Lasers Surg Med). 2010; 42:527–539. 10.1002/lsm.20861. [DOI] [PubMed]
  • 40.P L, L C, L S. Knockdown of Trim52 Alleviates Lps-Induced Inflammatory Injury in Human Periodontal Ligament Cells through the Tlr4/Nf-Κb Pathway. Bioscience reports (Biosci Rep). 2020;40. 10.1042/BSR20201223. [DOI] [PMC free article] [PubMed]
  • 41.B Y, Q L, M Z. Lps‑Induced Upregulation of the Tlr4 Signaling Pathway Inhibits Osteogenic Differentiation of Human Periodontal Ligament Stem Cells Under Inflammatory Conditions. International journal of molecular medicine (Int J Mol Med). 2019;43:2341–2351. 10.3892/ijmm.2019.4165. [DOI] [PMC free article] [PubMed]
  • 42.AE M, AM M, WR M, T M. Femtosecond Laser Attenuates Oxidative Stress, Inflammation, and Liver Fibrosis in Rats: Possible Role of Pparγ and Nrf2/Ho-1 Signaling. Life sciences (Life Sci). 2022; 307:120877. 10.1016/j.lfs.2022.120877. [DOI] [PubMed]
  • 43.D Z, Q S, X W, D X. Photobiomodulation Therapy Ameliorates Glutamatergic Dysfunction in Mice with Chronic Unpredictable Mild Stress-Induced Depression. Oxidative medicine and cellular longevity (Oxid Med Cell Longev). 2021; 2021:6678276. 10.1155/2021/6678276. [DOI] [PMC free article] [PubMed]
  • 44.N H, MM D, H M, J Z, S F, R F, N M. Recovery of Inferior Alveolar Nerve by Photobiomodulation Therapy Using Two Laser Wavelengths: A Behavioral and Immunological Study in Rat. Journal of photochemistry and photobiology. B, Biology (J Photochem Photobiol B). 2020;204:111785. 10.1016/j.jphotobiol.2020.111785. [DOI] [PubMed]
  • 45.J F, X L, S Z, Y X, Du J, H G, Y B, Y L, L G. Photobiomodulation with 808-Nm Diode Laser Enhances Gingival Wound Healing by Promoting Migration of Human Gingival Mesenchymal Stem Cells Via Ros/Jnk/Nf-Κb/Mmp-1 Pathway. Lasers in medical science (Lasers Med Sci). 2020;35:1831–1839. 10.1007/s10103-020-03040-z. [DOI] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Articles from BMC Oral Health are provided here courtesy of BMC

RESOURCES