Skip to main content
NCBI home page
Springer logoLink to Springer
. 2025 Nov 25;26(1):33. doi: 10.1007/s10238-025-01910-w

Corin: a dual inhibitor for KDM1A/HDAC1, suppresses hepatocellular carcinoma by triggering cuproptosis

Min Liu 1,#, Xiaoling Ren 2,#, Zhicheng Gong 3,✉
PMCID: PMC12644136  PMID: 41286164

Abstract

Hepatocellular carcinoma (HCC) accounts for more than 90% of all liver cases and often responds poorly to conventional treatment modalities, including multi-kinase inhibitors and immune checkpoint inhibitors. Therefore, it is urgent to develop novel therapeutic options for HCC. In this study, we conducted high-throughput screening of histone demethylase inhibitors for HCC treatment. Among the inhibitors examined, Corin significantly suppressed the growth and proliferation of two HCC cell lines, HepG2 and Hep3B cells without affecting non-cancerous cells. Based on the targets of Corin, we identified HDAC1/KDM1A dual-positive HCC as a novel subtype of HCC. Transcriptome profiling indicated that this novel subtype possessed rapid proliferation and high DNA damage repair capacity. Additionally, Corin treatment upregulated FDX1 expression to trigger Cuproptosis, which suppressed HCC proliferation. Conclusively, Corin possesses potential application as a novel and effective therapeutic option for HCC that simultaneously inhibits KDM1A and HDAC1 expression.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10238-025-01910-w.

Keywords: Hepatocellular carcinoma, Corin, KDM1A, HDAC1, Cuproptosis

Introduction

Hepatocellular carcinoma (HCC) accounts for over 90% of liver cancer cases, making it the third most significant contributor to cancer-related mortality and the sixth most prevalent type of cancer globally [1, 2]. Despite notable research progress, advanced HCC frequently exhibits poor responsiveness to conventional treatment modalities, including multi-kinase and immune checkpoint inhibitors [3–6].Therefore, it is imperative to develop innovative and efficacious therapies for HCC.

Copper, as an essential metallic element in the human body, plays a crucial role by acting as a cofactor for enzymes involved in critical physiological functions, including mitochondrial respiration, oxidation–reduction reactions, and biomolecule synthesis [7, 8]. While earlier studies have demonstrated that copper can induce cell death, the precise mechanisms underlying copper-triggered cellular demise remain controversial [9]. In 2022, Tsvetkov and colleagues characterized this process and coined the term “Cuproptosis” [10]. Cuproptosis is driven by the excessive accumulation of copper ions, which is typically achieved through the exogenous addition of copper carriers [11]. Notably, copper concentrations are elevated in the tumor tissues and serum of both animal models and cancer patients [12]. Specifically, copper levels are associated with liver cirrhosis, acute hepatitis, and liver cancer and serum copper may therefore serve as a potential marker for liver cancer detection [13]. More importantly, in patients with HCC, excessive copper concentrations have been linked to enhanced tumor progression, increased chemoresistance, and worse prognosis [14]. This observation suggests that identifying the key factors that maintain copper homeostasis could provide a novel therapeutic target for liver cancer. However, the targetable vulnerabilities in the Cuproptosis defense mechanisms of HCC cells remain largely unknown.

Epigenetic dysregulation is one of the hallmarks of human cancer [15]. Histone demethylase, an essential epigenetic component, has been identified as an oncogene in most tumor types [16–18]. Accordingly, several inhibitors have been developed to block histone demethylases to improve cancer treatment [19].Research evidence indicates that the selective targeting of histone demethylases not only directly eradicates tumor cells but also enhances the efficacy of anticancer agents against human cancers, including HCC [20–24]. However, it remains to be determined whether emerging histone demethylase inhibitors can be developed into novel therapeutic agents for HCC.

In this study, we evaluated the efficacies of histone demethylase inhibitors using a high-throughput screening approach. Corin, a dual inhibitor of HDAC1 and KDM1A, showed potent anti-HCC efficacy. Additionally, we investigated the potential mechanism of Corin against HDAC1/KDM1A dual-positive HCC, a previously uncharacterized malignant subtype. Mechanistically, Corin treatment suppresses HCC growth by triggering Cuproptosis via FDX1 upregulation.

Materials and methods

Cell culture

HepG2 and Hep3B cells were obtained from the American Type Culture Collection (ATCC) and grown in DMEM supplemented with 10% fetal bovine serum (FBS). THLE-2 (Cat NO.: CL-0833) was purchased from Procell (Wuhan, China) and culture in the specific medium from Procell (CM-0833). The cells were incubated at 37 °C in a 95% air and 5% CO2 atmosphere.

Drug screening

Epigenetic agents were acquired from MedChemExpress (Shanghai, China), dissolved in DMSO, and stored at − 80 °C as specified in the product data sheets. HepG2 cells were seeded in a 96-well plate at a density of 3000 cells per well, incubated for 24 h, and treated with epigenetic agents (10 μM). Thereafter, cell viability was assessed using CCK-8 assay.

Lentivirus-mediated gene silencing

Construct was prepared as our previous work [25]. HEK-293 T cells were co-transfected with the shRNAs for HDAC1 (target sequence: 5’CGTTCTTAACTTTGAACCATA 3’) or KDM1A (target sequence: 5’ GCAGTTGTGGTTGGATAATCC 3’) in order to produce the lentivirus. Following a 48-h transfection period, the viral supernatant was collected, filtered through a 0.45-µm filter, and subsequently used to infect target cells that had reached 80% confluence, with protamine sulfate (8 µg/mL) present.

Half-maximal inhibitory concentration (IC50) determination

HepG2 and Hep3B cells were seeded in 96-well plates at a density of 3000 cells per well. After culturing for 24 h, the existing media was replaced with fresh media containing gradient dilutions of Corin (10, 5, 2.5, 1.25, 0.625, 0.3125 and 0.15625 μM), followed by incubation for an additional 96 h. Cell viability was assessed using CCK-8 assay.

Clonogenic assay

HepG2 and Hep3B cells were plated in 6-well plates at a density of 10,000 cells per well. After incubating for 24 h, the cells were treated with Corin (0.3 or 0.6 μM) for one week. Notably, 1 mL of fresh media containing the specified drugs was added every 2 days. At the end of the week, the cells were fixed with methanol and stained with Crystal Violet.

Bioinformatic analyses

TCGA-based survival and expression (Fig. 3B and E) were conducted using GSCA, an online web tool (https://guolab.wchscu.cn/GSCA/#/). Related analyses in Fig. 3A, C, H, I were conducted by using ACLBI (https://www.aclbi.com/static/index.html#/). Protein levels of HDAC1, KDM1A and FDX1 in HCC samples were aquired from CPTAC (Clinical Proteomic Tumor Analysis Consortium), and correlation analysis were achieved using an online bioinformatic tool (https://www.bioinformatics.com.cn). Protein-level comparisons of HDAC1 and KDM1A in CPTAC HCC samples were conducted using UALCAN (https://ualcan.path.uab.edu).

Fig. 3.

Fig. 3

Open in a new tab

Dual positivity of KDM1A and HDAC1 as a prognostic marker in HCC. A Expression levels of KDM family members in tumor (red) and normal (blue) tissues. Box plots represent log-transformed expression data. KDM1A, KDM1B, KDM2A, KDM2B, KDM3A, KDM4B, KDM5A, KDM5B, KDM5C, KDM6A, and others show significant differences between tumor and normal tissues (****P < 0.0001, *** P < 0.001, **P < 0.01, *P < 0.05), while KDM4C shows no significant difference (n.s.). B Correlation analysis between HCC clinical outcomes and KDM members expression (DFI, disease-free interval; DSS, disease-stable survival; OS, overall survival; PFS, progress-free survival). KDM5C expression is associated with significantly poorer OS and PFS in HCC dataset. KDM1A is associated with significantly poorer DSS and OS. KDM6A is associated with significantly better DFI, DSS and PFS. KDM8 is associated with significantly better OS and PFS. KDM5D and KDM4B are associated with significantly better DSS and OS. Color scale bar indicates the HR value, with red color indicating poor clinic outcomes. Dot size corresponds to the false discovery rate (FDR), with larger dots indicating higher significance. Bold circles indicate the P-value is less than 0.05. C Scatter plot showing a strong positive correlation between KDM1A and HDAC1 expression across tumor samples (R = 0.814, P < 0.0001), indicating a potential co-regulatory relationship between the two genes. D Violin plot comparing HDAC1 expression between tumor and normal tissues. Tumor tissues show significantly higher HDAC1 expression than normal tissues (****P < 0.0001). Statistics were determined by the Wilcoxon test. E–F Box plot comparing KDM1A (E) and HDAC1 (F) protein levels between tumor and normal tissues based on CPTAC samples. Tumor tissues show significantly higher KDM1A and HDAC1 expression than normal tissues. Statistics were determined by the Wilcoxon test. G Scatter plot showing a strong positive correlation between KDM1A and HDAC1 protein levels across CPTAC HCC samples (R = 0.67, P < 0.0001). H, I Kaplan–Meier survival curves for overall survival (OS, H) and disease-specific survival (DSS, I) based on HDAC1 expression. Patients with high HDAC1 expression (red) have significantly worse OS and DSS compared to those with low HDAC1 expression (blue) (log-rank P = 0.0011 for OS, P = 0.0009 for DSS). J, K Kaplan–Meier survival curves stratified by both KDM1A and HDAC1 expression levels using TCGA LIHC dataset (J, P < 0.0001) and GSE14520 dataset (K, P = 0.0189). Both of these survival analyses reveal that the clinical outcomes in LIHC patients with aberrant high HDAC1 and KDM1A were significantly poorer than others

As previous described [26, 27], to identify differentially expressed genes, we obtained STAR-counts data along with relevant clinical details for LIHC tumors from the TCGA database (https://portal.gdc.cancer.gov) and GSE14520. Next, we extracted the data in FPKM format, applying normalization via the log2(FPKM + 1) transformation (genes with FPKM values less than 0.5 were excluded). The Limma package (version: 3.40.2) in R software was utilized to investigate the differential expression of mRNA. Within the datasets from TCGA and GSE14520, we analyzed the adjusted P-values to account for false positives. Our criteria for screening differential mRNA expression were defined as “adjusted P < 0.05 and fold change > 1.5.” Gene Set Enrichment Analysis (GSEA) was performed using the Java GSEA Desktop Application with default settings and HALLMARK gene sets that were downloaded from MSigDB (https://www.gsea-msigdb.org/gsea/msigdb/index.jsp).

7-Amino-actinomycin D (7-AAD) staining

HCC cells (2 × 105 cells/well) were plated in 6-well plates and treated with either DMSO or Corin at a concentration of 0.6 μM. Thereafter, the cells were harvested, rinsed with PBS, and centrifuged at 1000 rpm for 5 min. After centrifugation, the resultant cell pellets were resuspended and incubated in 50 μL of 1 × assay buffer containing 5 μL of 7-AAD solution at room temperature for 15 min. Finally, the mixture was combined with 450 μL of the 1 × assay buffer working solution and the percentage of dead cells (7-AAD positive) was measured using a NovoCyte flow cytometer.

CCK-8 assay

After the specified treatments, cells were seeded in 96-well plates and incubated at 37 °C with medium supplemented with 10% Cell Counting Kit-8 reagent (ApexBio, #K1018) for 2 h. Thereafter, the optical density at 450 nm was measured using a microplate reader.

Western blot

Briefly, DMSO- and Corin-treated cells were lysed using RIPA lysis buffer (Invitrogen, #89,900). The protein concentrations of all samples were determined using a bicinchoninic acid (BCA) kit (Yeasen, #20201ES86) according to the manufacturer’s guidelines. Thereafter, equal quantities of protein extracts were separated using Tris–glycine gel electrophoresis (Yeasen, #36252ES10) and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, #IPVH00010). The membranes were incubated with primary antibodies (KDM1A, #4218, CST, 1: 1000; FDX1, A20895, Abclonal, 1:1000; β-actin, AC038, Abclonal, 1:20,000; HDAC1, A0238, Abclonal, 1:1000; GAPDH, A19056, Abclonal,1:10,000) at 4 °C for overnight, followed by treatment with horseradish peroxidase (HRP)-conjugated secondary antibodies. Protein bands were examined and quantified using the Image Lab software.

Statistical analyses

Data are presented as mean ± SD, as indicated, of at least three independent experiments or biological replicates. The examination of statistical significance was conducted through a two-tailed Student's t test. Statistical analyses were performed using GraphPad Prism software, version 8.0 (GraphPad Software, Inc., San Diego, California).

Results

Histone demethylase inhibitor library screening reveals Corin as a novel therapeutic option for liver cancer

Epigenetic dysregulation is one of the hallmarks of cancer development [15]. Notably, targeting histone demethylases is a promising strategy for cancer therapy [16–24, 28, 29]. Therefore, we performed a high-throughput screening of histone demethylase inhibitors to explore novel therapeutic options for hepatocellular carcinoma (HCC) (Fig. 1A). Among the inhibitors screened, Corin, a dual inhibitor of KDM1A and HDAC1, exhibited the strongest anti-HCC activity (inhibition rate > 95%) (Fig. 1B and Supplementary Table 1). Collectively, these results suggest that Corin has a potential application in HCC treatment.

Fig. 1.

Fig. 1

Open in a new tab

High-throughput drug screening uncovers the novel role of Corin in HCC. A Diagram showing the work flow for drug screening. B Drug screening reveals histone demethylases are targetable vulnerabilities for HCC cells, especially co-targeting HDAC1 and KDM1A.Numbers from 1 to 36 indicates the independent drug in epigenic inhibitor library. Compared to DMSO, ***, P < 0.001, **, P < 0.01. No significance was found in Others without label

Corin suppresses HCC growth

Although Corin has been suggested as a novel therapeutic option for glioblastoma and melanomas [30–32], its role in HCC remains unknown. Therefore, we assessed the IC50 of Corin against HepG2 and Hep3B cells. Notably, the IC50 values of Corin against HepG2 and Hep3B cells were only 550 and 394 nM, respectively, suggesting that Corin possesses a strong anti-HCC activity (Fig. 2A, B). Additionally, long-term clonogenic assay revealed that Corin suppressed HCC cells growth in a dose dependent manner (Fig. 2C). To further investigate the mechanism, we depleted HDAC1 and KDM1A alone or in combination (Fig. 2D). Strikingly, compound depletion of HDAC1 and KDM1A phenocopied Corin treatment in clonogenic assay and showed more proliferation suppression capacity than KDM1A or HDAC1 silencing alone (Fig. 2E).To further exclude the potential off-target mechanism, we further treated HDAC1/KDM1A-depleted cells with Corin and found that Corin failed to elicit an antiproliferative effect in cells with compound depletion of HDAC1/KDM1A (Fig. 2F), indicating Corin exerts its antiproliferative effect by targeting HDAC1 and KDM1A. Moreover, Corin failed to affect the long-term growth capacity of THLE-2 cells, a non-cancerous cell line, under the same treatment conditions (Fig. 2G). Collectively, these data suggest that Corin may serve as a novel selective therapeutic option for HCC.

Fig. 2.

Fig. 2

Open in a new tab

Corin treatment suppresses proliferation in HCC cells. A, B Corin treatment suppresses HepG2 (A) and Hep3B (B) cell viability in a dose-dependent manner. Compared to the DMSO, * P < 0.05, ** P < 0.01, *** P < 0.001. n.s, no significance. C Clonogenic assay reveals Corin treatment inhibits HepG2 and Hep3B proliferation in a dose-dependent manner. D IB analysis confirms the successful establishment of KDM1A-, HDAC1- and KDM1A/HDAC1-depleted HepG2 and Hep3B cells. Quantification of indicated proteins were performed based on GAPDH. * represents the specific band of HDAC1. SE, short exposure and LE, long exposure. E Silencing of either HDAC1 or KDM1A exhibits a limited inhibitory effect on the proliferative potential of HCC cells, with the observed effect being significantly less pronounced than that observed following compound depletion. F Corin failed to elicit an antiproliferative effect in cells with compound depletion of HDAC1/KDM1A. HDAC1/KDM1A-depleted cells were treated with 0.6 µM Corin and then subjected to clonogenic assay as indicated. G Corin might be a selective therapeutic option for HCC, as evidenced by that Corin treatment under a certain dosage failed to affect the growth capacities of non-cancerous cells

Data in (A and B) are displayed as mean ± SD. Dosages of Corin used in (C and F): Corin_Low, 0.3 µM; Corin_High, 0.6 µM. IB, immunoblotting.

Dual positivity of KDM1A and HDAC1 as a prognostic marker in HCC

To further elucidate the clinical implications of KDM1A and HDAC1, we firstly assessed expression levels across KDM members in HCC using TCGA dataset. 14 of 19 histone demethylases showed significant upregulation in HCC tissues including KDM1A (Fig. 3A). More importantly, we examined the correlation between the expression levels of the histone demethylases and the clinical outcomes of patients with liver cancer. Only KDM1A and KDM5C expression levels were associated with significantly poorer clinical outcomes (Fig. 3B and Supplementary Table 2), indicating KDM1A and KDM5C as the most potential therapeutic targets among the KDM members. Considering that Corin is a dual inhibitor of KDM1A and HDAC1, we assessed the correlation between KDM1A and HDAC1 expression using TCGA. Expectedly, HDAC1 and KDM1A expression levels were positively correlated (Fig. 3C, R = 0.814, P < 0.0001). Similarly, HDAC1 transcripts were aberrantly upregulated in patients with liver cancer (Fig. 3D). Considering that the KDM1A and HDAC1 function via their enzyme abilities, we analyzed the protein level of KDM1A and HDAC in HCC samples using the Clinical Proteomic Tumor Analysis Consortium (CTPAC) proteomic database. This analysis revealed a significant upregulation of both KDM1A and HDAC1 protein levels in HCC samples (Fig. 3E, F). Moreover, a significant positive correlation between KDM1A and HDAC1 protein levels was also observed in CPTAC HCC samples (Fig. 3G, R = 0.67, P < 0.0001). Additionally, consistent with KDM1A, HDAC1 expression levels were negatively correlated with clinical outcomes in patients with liver cancer (Fig. 3H, I). More importantly, we found that HDACHigh and KDM1AHigh subgroup was associated with the poorest clinical outcomes by using two independent datasets (Fig. 3J, K). Collectively, these findings indicate dual positivity of KDM1A and HDAC1 as a prognostic marker in HCC, and further support the potential clinical utility of Corin in HCC treatment.

KDM1A and HDAC1 dual-positive HCC represents an uncharacterized malignant subtype

Considering that HDAC1/KDM1A dual-positive HCC has the poorest prognosis, we proceeded to analyze the transcriptional profiles of this subtype to elucidate the potential malignant mechanisms. Specifically, we compared the transcriptome of the top 25% of patients with KDM1A/HDAC1-overexpressing HCC (dual, n = 63) with those of other patients (n = 302). As shown in Fig. 4A, the transcriptome of patients with HDAC1/KDM1A dual-positive HCC was notably different from that of others patients. Similar observations were made in the GSE14520 dataset using the same approach (Fig. S1A). Additionally, we performed gene set enrichment analysis (GSEA) of differentially expressed genes in the HDAC1/KDM1A dual-positive HCC group to elucidate the molecular mechanisms underlying the malignancy. Patients with HDAC1/KDM1A dual-positive HCC may have a high DNA repair capacity, as evidenced by the enrichment of DNA repair signaling, suggesting that this subtype may be resistant to genotoxic therapies (Fig. 4B and S4B). Myc targets were highly expressed in the cells, suggesting aberrant activation of Myc in the KDM1A/HDAC1 dual-positive subtype (Fig. 4C and S4C). Additionally, targets of the E2F and PI3K-AKT pathways, two well-known pro-proliferation signaling pathways, were highly expressed in the HDAC1/KDM1A dual-positive HCC group, indicating the rapid proliferative capacity of this subtype (Fig. 4D-E and S4D-E). Moreover, genes associated with the G2/M checkpoint were aberrantly overexpressed in the HDAC1/KDM1A dual-positive HCC group, confirming rapid cell cycle transition in this subtype (Fig. 4F and S4F). Importantly, these molecular signatures provide a potential explanation for poor clinical outcomes in patients with HDAC1/KDM1A dual-positive HCC. Collectively, these findings support the idea that HDAC1/KDM1A-high HCC represent a new subtype of HCC.

Fig. 4.

Fig. 4

Open in a new tab

KDM1A and HDAC1 dual-positive HCCrepresents an uncharacterized malignant subtype. A Heatmap showing differential gene expression between the Dual (red, n = 63) and Others (blue, n = 302) in TCGA dataset. Genes are arranged by their expression levels across samples. The red color represents upregulated genes, while blue indicates downregulated genes in the dual-positive group relative to others. FPKM > 0.5. Fold change > 1.5. P < 0.05. B–F GSEA plots and corresponding heatmaps for top enriched pathways or gene sets in the dual-positive group compared to others. The left side of each panel shows the heatmap, where red indicates upregulation and blue indicates downregulation, while the right side shows the enrichment score curve. GSEA in for DNA repair signaling B (NES = 2.00, P-value < 0.001, q-value = 0.0), Myc target genes (V1) C (NES = 1.96, P-value < 0.001, q-value = 0.02), E2F target genes D (NES = 2.02, P-value < 0.001, q-value = 0.04), PI3K-AKT-mTOR signaling pathway E (NES = 1.59, P-value = 0.01, q-value = 0.13) and G2M checkpoint-related genes F (NES = 2.02, P-value < 0.001, q-value = 0.02) are significantly enriched in Dual

Corin suppresses HCC cells growth via triggering Cuproptosis

In this study, we aimed to investigate the anti-HCC effect and mechanism of Corin in HCC cells. Based on changes in cell morphology, we speculated that Corin might exert its antiproliferative effect by inducing cell death (Fig. 5A). Consistently, 7-AAD staining confirmed Corin-induced cell death in HCC, as evidenced by the marked increase in 7-AAD-positive rates in both cell types following Corin treatment (Fig. 5B). To further elucidate the type of Corin-induced cell death, cells with Corin combined with apoptosis, necroptosis, or ferroptosis inhibitors. Notably, none of the cell death inhibitors successfully blocked cell death, suggesting that Corin-induced cell death did not belong to the regularly known cell death types (Fig. 5C). Cuproptosis is recently identified cell death type that is governed by FDX [10]. We found that KDM1A and HDAC1 were significantly negatively correlated with FDX1 expression (Fig. 5D). Meanwhile, A significant negative correlation was observed between FDX1 and KDM1A protein levels (Fig. 5E, R = − 0.51, P < 0.0001) or HDAC1 protein levels (Fig. 5F, R = − 0.5, P < 0.0001). These findings suggest that KDM1A and HDAC1 may suppress Cuproptosis via FDX1 downregulation. Additionally, Corin treatment upregulated FDX1 expression in a dose-dependent manner (Fig. 5E). Furthermore, we treated FDX1-depleted cells with Corin and found that Corin failed to suppress proliferation in HCC cells lacking FDX1 expression (Fig. 5F, G), indicating FDX1 dependency. Collectively, our data revealed that Corin suppresses HCC cells proliferation via FDX1-mediated Cuproptosis.

Fig. 5.

Fig. 5

Open in a new tab

Corin treatment upregulates FDX1 to induce Cuproptosis A Representative images of HepG2 and Hep3B cells treated with DMSO (control) or Corin. Cells treated with Corin (0.6 µM) show visible morphological changes indicative of cell death compared to DMSO-treated cells. B Flow cytometry analysis of 7-AAD staining in HepG2 and Hep3B cells treated with DMSO (blue) or Corin (0.6 µM) (red). The shift in 7-AAD staining indicates increased cell death in Corin-treated cells compared to control. C Inhibition rates of HepG2 cells treated with DMSO, Corin, and various inhibitors. Corin significantly increases cell death, which is not prevented by necroptosis (Necrosulfonamide, 5 µM), apoptosis (Z-VAD-FMK, 10 µM) inhibitors or ferroptosis inhibitors (ferrostatin-1, 10 µM). ***compared to each control, P < 0.001, n.s., compared to each combined treatment, not significant. P-values were determined by Student-t test. D Scatter plots showing negative correlations between FDX1 expression and HDAC1 (left, R = − 0.159, P = 0.00102) or KDM1A expression (right, R = − 0.17, P = 0.000467). These results suggest that FDX1 expression is negatively associated with HDAC1 and KDM1A levels. E, F Scatter plots showing negative correlations between FDX1 and KDM1A (E, R = − 0.51, P < 0.0001) or HDAC1 (F, R = − 0.50, P < 0.0001) protein levels. G Western blot analysis of FDX1 expression in HepG2 and Hep3B cells treated with different concentrations of Corin (+ represents 0.3 µM and +  + represents 0.6 µM). Corin treatment induces FDX1 expression in a dose-dependent manner. β-actin and GAPDH is used as a loading control, and quantification relative to β-actin or GAPDH is shown. H Western blot analysis of FDX1 expression in HepG2 and Hep3B cells expressing indicated lentiviral constructs, followed by DMSO or different concentrations of Corin (+ represents 0.3 µM and +  + represents 0.6 µM) treatment. I Clonogenic assay in HepG2 and Hep3B cells expressing indicated lentiviral constructs with DMSO or different concentrations of Corin (+ represents 0.3 µM and +  + represents 0.6 µM) treatment

Discussion

HCC frequently shows resistance to prevalent treatment strategies such as multi-kinase inhibitors or immune checkpoint inhibitors [1–6], indicating the need for innovative therapeutic alternatives. Considering that melanomas and other cancer cells synergistically respond to combined KDM1A and HDAC inhibition [28, 29, 33], Corin, a bifunctional inhibitor of HDACs and KDM1A, was designed [14] and assessed the anticancer capacity against melanomas [30]. Although the anticancer effect of Corin has been confirmed in diffuse intrinsic pontine glioma (DIPG) and BRAFi-resistant melanomas [31, 32], its role in HCC remains exclusive. In this study, we performed high-throughput drug screening of histone demethylase inhibitors and confirmed that Corin possesses potential application as a selective therapeutic option for HCC.

Molecular classification facilitates a deeper understanding of the diverse nature of HCC and supports the development of tailored therapeutic strategies [34]. Recently, numerous molecular classifications of HCC have been proposed, establishing that HCC can be consistently categorized into several molecular subclasses, each exhibiting distinctive phenotypes based on genomic or transcriptomic profiles [35, 36]. Inspired by Corin, we hypothesized that there may be a KDM1A and HDAC1 double-positive subtype in HCC. Consistent with our hypothesis, we confirmed the existence of a HDAC1/KDM1A dual-positive HCC subtype. Additionally, patients with HDAC1/KDM1A dual-positive HCC exhibited markedly reduced survival rates compared with other groups that were either single positive or double negative. Further transcriptional profiling of the molecular features of the KDM1A/HDAC1-high subtype revealed a high level of damage repair activity accompanied by aberrant activation of the Myc, E2F, and PI3K-AKT pathways. The elevated expression of these pathway-associated genes in the dual-positive subtype indicates that this subgroup may be characterized by rapid proliferation and chemoresistance. Moreover, a previous study indicated the existence of an immunosuppressive microenvironment in tumors with aberrant Myc pathway activation [37]. Overall, these findings suggest that the HDAC1/KDM1A-high subtype may not only possess distinctive molecular characteristics that contribute to high degree of malignancy, but may also maintain malignant phenotype through the Myc pathway, leading to the formation of an immunosuppressive microenvironment.

Copper ions bind directly to the fatty acylated elements of the tricarboxylic acid (TCA) cycle in the mitochondria, resulting in the aggregation of fatty acylated proteins and a decrease in the levels of iron-sulfur cluster proteins, ultimately causing proteotoxic stress and leads to cell death, namely Cuproptosis [10]. Golub et al. demonstrated that Cuproptosis affects lipoylated proteins involved in the TCA cycle, and identified FDX1 as a crucial gene that plays a pivotal role in Cuproptosis [10]. In this study, we found that Corin-induced cell death in HCC cells did not belong to the regularly known cell death types. Further analysis revealed that both KDM1A and HDAC1 were negatively correlated with FDX1 expression. Moreover, Corin treatment induced FDX1 expression in a dose-dependent manner. Corin treatment failed to affect the proliferation rates of FDX1-depleted cells, indicating that Corin-induced cell death type was Cuproptosis. In individuals diagnosed with HCC, elevated levels of Cu2+ have been observed to promote tumor growth, increase chemoresistance, and lead to unfavorable outcomes [14], suggesting that the identification of genes that mediate Cuproptosis defense in HCC may facilitate the development of effective targeted therapies. Based on these findings, we believe that Corin is a promising novel therapeutic option for HCC.

Conclusively, our drug screening results revealed a novel therapeutic option for HCC. Additionally, we characterized a novel malignant subtype of HCC. Moreover, Corin treatment upregulates FDX1 expression to trigger Cuproptosis, which in turn suppresses HCC proliferation, indicating that Corin is a novel Cuproptosis inducer in HCC.

Limitation

However, this study has some limitations that should be considered. The findings are primarily based on in vitro experiments using only two HCC cell lines, which may not fully capture the heterogeneity of the disease, and lack validation in in vivo animal models to confirm the anti-tumor efficacy and mechanism of Corin. Additionally, the reliance on bioinformatic analyses to define a novel HCC subtype also necessitates further experimental and clinical validation.

Conflict of interest

The authors declare no competing interests.

Ethical approval

Not applicable.

Consent for publication

Not applicable.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary file1 (XLSX 11 KB) (11.2KB, xlsx)
Supplementary file2 (XLSX 13 KB) (13.3KB, xlsx)
Supplementary file3 (PDF 254 KB) (253.8KB, pdf)
Supplementary file4 (DOCX 344 KB) (344.6KB, docx)

Acknowledgements

This study was supported by the Affiliated Hospital of Jiangnan University. We would like to thank associate professor Kaisa Cui for the improvement in bioinformatic analysis and the online bioinformatic tools, including GSCA and ACLBI.

Author contributions

Min Liu and Xiaoling Ren contribute equally to this work. This project was conceived and supervised by Zhicheng Gong. Min Liu performed the most experiments and Xiaoling Ren performed bioinformatic analyses. Zhicheng Gong designed the study and prepared the manuscript.

Funding

This study is supported by National Natural Science Foundation of China (82303115), China Postdoctoral Science Foundation (2024M751162), Top Talent Support Program for young and middle-aged people of Wuxi Health Committee (HB2023060) and Wuxi Science and Technology Innovation and Entrepreneurship Fund “Light of Taihu Lake” Science and Technology Tackling Project (K20231055).

Data availability

The data used to support the findings of this study are available from the corresponding author upon request.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Min Liu and Xiaoling Ren have contributed equally.

References

  • 1.Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424. [DOI] [PubMed] [Google Scholar]
  • 2.Forner A, Reig M, Bruix J. Hepatocellular carcinoma. Lancet. 2018;391(10127):1301–14. [DOI] [PubMed] [Google Scholar]
  • 3.Hilmi M, Neuzillet C, Calderaro J, Lafdil F, Pawlotsky JM, Rousseau B. Angiogenesis and immune checkpoint inhibitors as therapies for hepatocellular carcinoma: current knowledge and future research directions. J Immunother Cancer. 2019;7(1):333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Finn RS, Qin S, Ikeda M, Galle PR, Ducreux M, Kim TY, et al. Atezolizumab plus bevacizumab in unresectable hepatocellular carcinoma. N Engl J Med. 2020;382(20):1894–905. [DOI] [PubMed] [Google Scholar]
  • 5.Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF, et al. Sorafenib in advanced hepatocellular carcinoma. N Engl J Med. 2008;359(4):378–90. [DOI] [PubMed] [Google Scholar]
  • 6.Fu R, Jiang S, Li J, Chen H, Zhang X. Activation of the HGF/c-MET axis promotes lenvatinib resistance in hepatocellular carcinoma cells with high c-MET expression. Med Oncol. 2020;37(4):24. [DOI] [PubMed] [Google Scholar]
  • 7.Bhattacharjee A, Chakraborty K, Shukla A. Cellular copper homeostasis: current concepts on its interplay with glutathione homeostasis and its implication in physiology and human diseases. Metallomics. 2017;9(10):1376–88. [DOI] [PubMed] [Google Scholar]
  • 8.Chen L, Min J, Wang F. Copper homeostasis and cuproptosis in health and disease. Signal Transduct Target Ther. 2022;7(1):378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mitra S, Keswani T, Dey M, Bhattacharya S, Sarkar S, Goswami S, et al. Copper-induced immunotoxicity involves cell cycle arrest and cell death in the spleen and thymus. Toxicology. 2012;293(1–3):78–88. [DOI] [PubMed] [Google Scholar]
  • 10.Tsvetkov P, Coy S, Petrova B, Dreishpoon M, Verma A, Abdusamad M, et al. Copper induces cell death by targeting lipoylated TCA cycle proteins. Science. 2022;375(6586):1254–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Guthrie LM, Soma S, Yuan S, Silva A, Zulkifli M, Snavely TC, et al. Elesclomol alleviates Menkes pathology and mortality by escorting Cu to cuproenzymes in mice. Science. 2020;368(6491):620–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jiang Y, Huo Z, Qi X, Zuo T, Wu Z. Copper-induced tumor cell death mechanisms and antitumor theragnostic applications of copper complexes. Nanomed (Lond). 2022;17(5):303–24. [DOI] [PubMed] [Google Scholar]
  • 13.Jaafarzadeh MM, Ranji N, Aboutaleb E. The effect of N-acetylcysteine on the levels of copper, zinc and expression of matrix metalloproteinases in the liver. Pol J Vet Sci. 2021;24(2):191–9. [DOI] [PubMed] [Google Scholar]
  • 14.Fang AP, Chen PY, Wang XY, Liu ZY, Zhang DM, Luo Y, et al. Serum copper and zinc levels at diagnosis and hepatocellular carcinoma survival in the Guangdong Liver Cancer Cohort. Int J Cancer. 2019;144(11):2823–32. [DOI] [PubMed] [Google Scholar]
  • 15.Hanahan D. Hallmarks of cancer: new dimensions. Cancer Discov. 2022;12(1):31–46. [DOI] [PubMed] [Google Scholar]
  • 16.Wang N, Ma T, Yu B. Targeting epigenetic regulators to overcome drug resistance in cancers. Signal Transduct Target Ther. 2023;8(1):69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Deng Y, Li M, Zhuo M, Guo P, Chen Q, Mo P, et al. Histone demethylase JMJD2D promotes the self-renewal of liver cancer stem-like cells by enhancing EpCAM and Sox9 expression. J Biol Chem. 2021;296:100121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ma L, Xu A, Kang L, Cong R, Fan Z, Zhu X, et al. LSD1-demethylated LINC01134 confers oxaliplatin resistance through SP1-induced p62 transcription in HCC. Hepatology. 2021;74(6):3213–34. [DOI] [PubMed] [Google Scholar]
  • 19.Conery AR, Rocnik JL, Trojer P. Small molecule targeting of chromatin writers in cancer. Nat Chem Biol. 2022;18(2):124–33. [DOI] [PubMed] [Google Scholar]
  • 20.Dalpatraj N, Naik A, Thakur N. GSK-J4: an H3K27 histone demethylase inhibitor, as a potential anti-cancer agent. Int J Cancer. 2023;153(6):1130–8. [DOI] [PubMed] [Google Scholar]
  • 21.Fang Y, Liao G, Yu B. LSD1/KDM1A inhibitors in clinical trials: advances and prospects. J Hematol Oncol. 2019;12(1):129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sharma SV, Lee DY, Li B, Quinlan MP, Takahashi F, Maheswaran S, et al. A chromatin-mediated reversible drug-tolerant state in cancer cell subpopulations. Cell. 2010;141(1):69–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Alejo S, Palacios BE, Venkata PP, He Y, Li W, Johnson JD, et al. Lysine-specific histone demethylase 1A (KDM1A/LSD1) inhibition attenuates DNA double-strand break repair and augments the efficacy of temozolomide in glioblastoma. Neuro Oncol. 2023;25(7):1249–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Liu C, Liu L, Chen X, Cheng J, Zhang H, Zhang C, et al. LSD1 stimulates cancer-associated fibroblasts to drive Notch3-dependent self-renewal of liver cancer stem-like cells. Cancer Res. 2018;78(4):938–49. [DOI] [PubMed] [Google Scholar]
  • 25.Gong Z, Li A, Ding J, Li Q, Zhang L, Li Y, et al. OTUD7B deubiquitinates LSD1 to govern its binding partner specificity, homeostasis, and breast cancer metastasis. Adv Sci (Weinh). 2021;8(15):e2004504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Cui K, Gong L, Zhang H, Chen Y, Liu B, Gong Z, et al. EXOSC8 promotes colorectal cancer tumorigenesis via regulating ribosome biogenesis-related processes. Oncogene. 2022;41(50):5397–410. [DOI] [PubMed] [Google Scholar]
  • 27.Cui K, Yao S, Liu B, Sun S, Gong L, Li Q, et al. A novel high-risk subpopulation identified by CTSL and ZBTB7B in gastric cancer. Br J Cancer. 2022;127(8):1450–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Fiskus W, Sharma S, Shah B, Portier BP, Devaraj SG, Liu K, et al. Highly effective combination of LSD1 (KDM1A) antagonist and pan-histone deacetylase inhibitor against human AML cells. Leukemia. 2014;28(11):2155–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Singh MM, Manton CA, Bhat KP, Tsai WW, Aldape K, Barton MC, et al. Inhibition of LSD1 sensitizes glioblastoma cells to histone deacetylase inhibitors. Neuro Oncol. 2011;13(8):894–903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kalin JH, Wu M, Gomez AV, Song Y, Das J, Hayward D, et al. Targeting the CoREST complex with dual histone deacetylase and demethylase inhibitors. Nat Commun. 2018;9(1):53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wu M, Hanly A, Gibson F, Fisher R, Rogers S, Park K, et al. The corest repressor complex mediates phenotype switching and therapy resistance in melanoma. J Clin Invest. 2024. 10.1172/JCI171063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Anastas JN, Zee BM, Kalin JH, Kim M, Guo R, Alexandrescu S, et al. Re-programing chromatin with a bifunctional LSD1/HDAC inhibitor induces therapeutic differentiation in DIPG. Cancer Cell. 2019;36(5):528-544e510. [DOI] [PubMed] [Google Scholar]
  • 33.Vasilatos SN, Katz TA, Oesterreich S, Wan Y, Davidson NE, Huang Y. Crosstalk between lysine-specific demethylase 1 (LSD1) and histone deacetylases mediates antineoplastic efficacy of HDAC inhibitors in human breast cancer cells. Carcinogenesis. 2013;34(6):1196–207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Rebouissou S, Nault JC. Advances in molecular classification and precision oncology in hepatocellular carcinoma. J Hepatol. 2020;72(2):215–29. [DOI] [PubMed] [Google Scholar]
  • 35.Goossens N, Sun X, Hoshida Y. Molecular classification of hepatocellular carcinoma: potential therapeutic implications. Hepat Oncol. 2015;2(4):371–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Li B, Li Y, Zhou H, Xu Y, Cao Y, Cheng C, et al. Multiomics identifies metabolic subtypes based on fatty acid degradation allocating personalized treatment in hepatocellular carcinoma. Hepatology. 2024;79(2):289–306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Davis LN, Walker ZJ, Reiman LT, Parzych SE, Stevens BM, Jordan CT, et al. Myc inhibition potentiates CD8+ T cells against multiple myeloma and overcomes immunomodulatory drug resistance. Clin Cancer Res. 2024;30(14):3023–35. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (XLSX 11 KB) (11.2KB, xlsx)
Supplementary file2 (XLSX 13 KB) (13.3KB, xlsx)
Supplementary file3 (PDF 254 KB) (253.8KB, pdf)
Supplementary file4 (DOCX 344 KB) (344.6KB, docx)

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.

Articles from Clinical and Experimental Medicine are provided here courtesy of Springer

RESOURCES