Skip to main content
NCBI home page
Food Chemistry: Molecular Sciences logoLink to Food Chemistry: Molecular Sciences
. 2025 Nov 5;11:100325. doi: 10.1016/j.fochms.2025.100325

Adeno-associated virus-miR-128-3p sponge regulates breast muscle growth and intramuscular fat content in chickens

Tingqi Zhu a,1, Lekun Deng a,1, Yuehua He a, Wenjie Liang a, Pingquan Liu a, Shuangxing Liu a, Haishan Guo a, Donghua Li a,c, Fengbin Yan a,c, Yadong Tian a,c, Ruirui Jiang a,c, Xiangtao Kang a,b,c, Weiwei Jin a, Zhunan Li a,⁎, Wenting Li a,b,c,⁎, Guirong Sun a,b,c,⁎
PMCID: PMC12657813  PMID: 41322359

Abstract

Chicken meat is a major source of protein worldwide, and consumer demand for its consumption and quality is increasing. Although broilers grow rapidly to meet consumer demand, broilers have problems of low flavor substances and low intramuscular fat. Balancing the “quantity” and “quality” of chicken meat is the core of breeding. Among microRNAs, miR-128 can regulate myoblast proliferation and fat accumulation, it remains unclear whether miR-128 exerts the same function in vivo. Thus, this study constructed an adeno-associated virus (AAV)-mediated miR-128-3p sponge vector was constructed, and 20 chickens were equally assigned to a control group (injected with Cytomegalovirus (CMV) vector) and an experimental group (injected with AAV-miR-128-3p sponge vector). The results showed that the body weight, breast muscle weight, and breast muscle rate of the experimental group increased, the muscle fiber diameter enlarged, the mRNA expression of miR-128-3p in breast muscle decreased, and the lipid droplet area in breast and leg muscles as well as the crude fat content in breast muscle increased. In addition, lipidomic analysis revealed that the levels of 5 types of triglycerides (TG) in breast muscle was up-regulated. This study demonstrates that the AAV-miR-128-3p sponge vector can increase the growth rate and intramuscular fat (IMF) content of chickens, providing a targeted approach to improve poultry meat quality.

Keywords: Chicken meat, Lipidomic analysis, Triglycerides, Intramuscular fat

Highlights

  • •

    First in vivo: AAV-miR-128-3p sponge builds miRNA-targeted model, avoids off-target.

  • •

    miR-128-3p (muscle/fat) dual regulation first in vivo, fills avian gap.

  • •

    miR-128-3p regulates lipoprotein pathways to affect fat metabolism.

  • •

    AAV-miR-128-3p sponge: new chicken growth/IMF tool, boosts muscle/IMF.

1. Introduction

Chicken meat is a primary global protein source (Attia et al., 2022; Gurunathan et al., 2022). With the improvement of living standards and changes in dietary structures, consumer demand for chicken has shifted from the growth of per capita consumption to quality improvement. Tenderness, juiciness, and flavor are core quality indicators, all of which are directly regulated by intramuscular fat (IMF) content (Cao et al., 2023; Mir et al., 2017). Broilers can efficiently meet daily meat consumption demands due to their rapid growth and short slaughter cycle (Fanatico et al., 2007). However, compared with traditional slow-growing chicken breeds, their short growth period leads to insufficient muscle fat accumulation, which not only reduces the production of flavor compounds (Deng et al., 2022; Tang et al., 2009), but also directly decreases IMF content (Sheng et al., 2013), becoming a key bottleneck in balancing the “quantity” and “quality” of chicken meat. Therefore, improving IMF content while maintaining the growth rate of broilers has become a core goal in current breeding research. Nevertheless, the coordinated expression mechanisms of genes regulating growth and IMF metabolism remain unclear, which has restricted the development of precise breeding technologies.

MicroRNAs (miRNAs) are key regulators of intramuscular adipocyte differentiation (Chen et al., 2013) and lipid metabolism (Chen et al., 2019); they inhibit gene expression by targeting the 3′ untranslated region (3’UTR) of mRNA and play a core role in the “growth-metabolism” coordinated regulatory network. Among them, research on the functions of the miR-128 family has made partial progress: Motohashi et al. (2013) showed that miR-128 influences myoblast proliferation via the IRS1/Akt insulin signaling pathway. Yu et al. (2015) demonstrated that miR-128 suppresses CYP2C9 expression by targeting its 3’UTR, while Zhang, Yao, et al. (2017) reported that miR-128 promoted adipogenic differentiation by inhibiting the vascular endothelial growth factor (VEGF) pathway. Wagschal et al. (2015) linked miR-128 to triglyceride and cholesterol metabolism through the regulation of low-density lipoprotein receptor (LDLR), ATP binding cassette transporter A1 (ABCA1), and other cholesterol lipoprotein transport genes. Chen et al. (2018) found in 3 T3-L1 preadipocytes that miR-128 inhibits preadipocyte differentiation and promotes lipolysis by targeting PPARG and Sertad2. Notably, most of the aforementioned functional studies on miR-128 have focused on mammals (mice, humans), while research in poultry remains limited—only Zhu et al. (2023) reported in chicken primary intramuscular adipocytes that miR-128-3p could promote the proliferation of intramuscular adipocytes by targeting the FDPS gene, with no involvement in the regulation of myoblast proliferation. Collectively, miR-128 accelerates myoblast proliferation and modulates fat accumulation in mammals, but its synergistic regulatory role in “muscle growth-fat metabolism” in poultry remains unclear.

Our previous in vitro experiments further showed that knocking down miR-128-3p in chicken preadipocytes significantly promotes cell differentiation and triglyceride accumulation, while its overexpression exerts the opposite effect (Zhu et al., 2023). Combined with the “growth-metabolism” regulatory function of miR-128 in mammals, we speculate that miR-128-3p may simultaneously regulate muscle growth and fat metabolism in poultry. However, existing studies have notable limitations: on the one hand, the synergistic regulatory effect of miR-128-3p on muscle yield and IMF content in live chickens has not been verified, making it difficult to translate in vitro findings into practical production; on the other hand, research on in vivo intervention tools and regulatory efficiency for miR-128-3p is still lacking.

Based on this, this study hypothesizes that inhibiting the expression of miR-128-3p in vivo can simultaneously improve the growth rate and IMF content of broilers, thereby achieving a balance between the “quantity” and “quality” of chicken meat. The reason for choosing the AAV vector is that it has the advantages of strong tissue targeting, long-term expression, and high biosafety in poultry. In this study, an AAV-mediated miR-128-3p sponge vector was constructed, and its regulatory effects on muscle yield and IMF content of broilers were verified through in vivo experiments. The purpose of this study is to provide a targeted tool for the precise regulation of genes related to growth and IMF metabolism, and at the same time offer a new technical direction for broiler quality breeding.

2. Materials and methods

2.1. Ethical statement

All animal experiments were conducted under the supervision of the Animal Care Committee of the College of Animal Science and Technology, Henan Agricultural University, and followed protocols approved by the Institutional Animal Care and Use Committee (IACUC) of China. Every effort was made to minimize animal suffering.

2.2. Experimental animals and design

Twenty 14-day-old Arbor Acres (AA) broilers of similar body weight and good health were selected, including 10 roosters and 10 hens. The roosters and hens were evenly assigned into two groups: the experimental group injected with miR-128-3p adeno-associated virus (AAV9-c-gga-miR-128-3p sponge-ZsGreen) and the control group injected with the basic vector (AAV9-CMV-ZsGreen). One week before the experiment, the broilers were transferred to a standardized chicken house for feeding. At 21 days of age, the broilers were weighed, and AAV or the basic vector was injected. According to body weight, the experimental group received intramuscular injections of miR-128-3p AAV into the breast muscle at a dose of 1 μL/4 g, with half of the dose administered into the left and right breast muscles, respectively. Injections were performed in a “rice”-shape pattern (evenly distributed) at 10 μL per site, with a depth of approximately 2 cm. A 1 mL sterile syringe was used for slow injections at each site. Before and after the injection, the injection sites on the chest were disinfected with alcohol swabs to avoid unnecessary infections.

2.3. Preparation and quality control of AAV-miR-128-3p sponge

The reverse complementary sequence of miR-128-3p (Table 1, SEQ ID NO:1) was obtained via sequencing, and a mutated reverse complementary sequence (Table 1, SEQ ID NO:3) was designed and synthesized to avoid degradation by the RNA interference machinery. The miR-128-3p sponge sequence was constructed by tandemly repeating SEQ ID NO:3 four times. Using pHBAAV-CMV-MCS-T2A-ZsGreen as the basic vector, the experimental procedures comprised the following steps: vector digestion and recovery, target fragment acquisition (primer information in Table 2), ligation of the target fragment to the vector, transformation into DH5α competent cells, bacterial liquid PCR identification, and sequencing alignment. Following successful sequencing, bacterial liquid was amplified, and plasmids were extracted and purified using a commercial kit (MACHEREY-NAGEL, Düren, Germany), operations strictly followed the kit instructions. Purified plasmids were verified for quality before cell transfection, with concentrations >200 ng/μL and an OD260/280 ratio of 1.8–2.0. The prepared plasmid pHBAAV-CMV-miR-128-3p sponge-T2A-ZsGreen was co-transfected with pAAV-RC and pHelper into AAV-293 cells using a three-plasmid system. After 6 h of transfection, the medium was replaced with complete medium containing 10 % fetal bovine serum. At 72 h post-transfection, AAV-293 cells rich in viral particles were collected, lysed by three cycles of freeze-thawing, and the supernatant containing viral particles was harvested. High-titer purified AAV particles were obtained through nuclease treatment and column purification. Finally, the AAV preparations were tested for bacterial/fungal contamination, mycoplasma, and viral titer.

Table 1.

Sequence information of target genes.

Name Sequence
SEQ ID NO:1 TCACAGTGAACCGGTCTCTTT
SEQ ID NO:2 AAAGAGACCGGTTCACTGTGA
SEQ ID NO:3 AAAGAGACCAACCACTGTGA
miR-128-3p sponge AAAGAGACCAACCACTGTGAtatacAAAGAGACCAACCACTGTGAacatcAAAGAGACCAACCACTGTGAtcttcaAAAGAGACCAACCACTGTGA
Open in a new tab

Table 2.

Primer design for miR-128-3p sponge.

Primer Sequence (5′ → 3′)
miR-128-3p sponge-F acagaattcAAAGAGACCAACCACTGTGAtatacAAAGAGACCAACCACTGTGAacatcAAAGAGAC
miR-128-3p sponge-R acaaagcttTCACAGTGGTTGGTCTCTTTtgaagaTCACAGTGGTTGGTCTCTTTgatgtTCACAGT
Open in a new tab

2.4. Sample collection

On day 21 after injection, the broilers were slaughtered. Intact left and right breast muscles were dissected and weighed. The complete right breast muscle was stored at −80 °C for subsequent analysis of crude fat, crude protein, and lipidomics. Subsets of liver, left breast muscle, and leg muscle tissues were stored at −80 °C for real-time fluorescence quantitative PCR, while left breast muscle and leg muscle tissues were fixed in 4 % paraformaldehyde for subsequent HE staining and Oil Red O staining.

2.5. RT-qPCR

Total RNA was isolated from breast muscle, leg muscle, and liver tissues (3 samples per treatment group) using TRIzol reagent (Invitrogen Life Technologies, Shanghai, China) according to the manufacturer's instructions. Reverse transcription of total RNA was performed using reverse transcriptase, followed by quantification of RNA concentration, quality, and integrity with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Gene expression data were normalized to a reference gene using the ΔΔCT method, Each gene expression assay included 2 technical replicates, and 2^-ΔCT values were statistically analyzed. All primers used in qRT-PCR are listed in Table 3.

Table 3.

Gene primer sequences.

Gene Primer sequences Gene Primer sequences
GAPDH F: gaacatcatcccagcgtcca
R: cggcaggtcaggtcaacaac		 FABP F: ctgctacctggcctgacaaa
R: cagtgtgccactgtctaggg
miR-128-3p F: cagcacatatactaaaattggaacg
R: acgaatttgcgtgtcatcc		 APOA1 F: tgggcaaacagcttgacctgaa
R: gaagggccggatcttctcct
CEBPA F: aagatgatgcccgccgaccac
R: catggccttcaccagcgagctt		 ACC F: gcttcccatttgccgtccta
R: gccattctcaccacctgattactg
FASN F: gattgtttccccacttcgac
R: ctgttgccagcataatgtcc		 FDPS F: ctcatcacagctcccgtct
R: ctcgtgttcttccttactgtcg
PPARG F: acctcacgaggagtcttcca
R: gcttctccttctccgcttgt
Open in a new tab

2.6. HE staining of breast muscle tissue

In brief, left breast was fixed in 4 % neutral buffered formalin, dehydrated in ethyl alcohol, cleared in xylene, and finally embedded in paraffin. The paraffin-embedded tissues were cut into 5-μm-thick sections using a microtome (Frozen microtome, Thermo Fisher Scientific, model CRYOSTAR NX50, Shanghai, China) and stained with hematoxylin and eosin (H&E). For histological observation, slides were investigated by optical microscopy at a final magnification of ×100. Setting scale and measurements were performed using Image-pro plus software. In the measurement of muscle fiber diameter, at least 10 random fields of view containing muscle fibers were selected for determination.

2.7. Oil red O staining of breast and leg muscle tissues

After sectioning, paraffin-embedded breast and leg muscle tissues underwent preprocessing steps including fixation, dehydration, and clearing, followed by immersion in preheated Oil Red O staining solution for a specified duration. Excess stain was rapidly rinsed off with distilled water, and cell nuclei were counterstained with hematoxylin. Tissues were then dehydrated and cleared again before coverslipping. This process rendered fat red and cell nuclei blue, enabling clear visualization of intra-tissue fat distribution and structure. Lipid droplet area was quantified using Image-J software (Media Cybernetics, Inc., Rockville, MD, USA). Six visual fields were selected from each group (experimental and control) for imaging, with efforts to fill the field of view with tissue and ensure consistent background lighting across all photographs.

2.8. Determination of crude protein and crude fat

Seven grams of breast and leg muscle samples were air-dried in an oven at 105 °C for 4–5 h. Crude protein and fat contents were measured using the air-dried samples. Crude protein was determined via the Kjeldahl method using a Kjeldahl apparatus (KT-2300, FOSS, Hilleroed, Denmark). Crude fat content was assessed using the diethyl ether extraction-submersion method (Soxhlet extractor method).

2.9. Sample preparation and lipid extraction

Lipids were extracted according to methyl tert-butyl ether (MTBE) method. Briefly, a 200-μL volume of water was added to 30 mg sample and vortexed for 5 s. Subsequently, 240 μL of precooling methanol was added and the mixture vortexed for 30 s. After that, 800 μL of MTBE was added and the mixture was sonicated 20 min at 4 °C followed by sitting still for 30 min at room temperature. The solution was centrifuged at 14000g for 15 min at 10 °C and the upper organic solvent layer was obtained and dried under nitrogen.

2.10. Lipid identification

Metabolite information was acquired using liquid chromatography-mass spectrometry (LC-MS) in both positive and negative ion modes. Raw data were processed via LipidSearch software for lipid annotation. Preprocessing steps included peak alignment (to correct retention time deviations among different samples), identification and extraction of lipid molecules and internal standard lipids (to filter target lipid signals), generating a data matrix containing information such as mass-to-charge ratio (m/z), retention time, and peak response values. Absolute concentrations of analytes were calculated using the isotope internal standard method, leveraging the response abundance ratio (peak area ratio) between the analyte and internal standard, along with the known concentration of the internal standard. All annotated results were subjected to secondary lipid identification using LipidSearch with the following parameters: precursor tolerance: 5 ppm, product tolerance: 5 ppm, and product ion threshold: 5 %. In subsequent differential lipid screening analyses, the fold change (FC) threshold was set to “FC > 2 or < 0.5” and the p-value threshold was set to “P < 0.05” to screen for differentially expressed lipid molecules with statistical significance.

2.11. Statistical analysis

Data were analyzed by one-way analysis of variance followed by Duncan's multiple range test using SPSS version 23.0. P-values of less than 0.05 were considered statistically significant. The data were the average value ± standard error. GraphPad Prism version 8.0 was used for plotting.

3. Results

3.1. Construction and quality testing of AAV-miR-128-3p

The construction and quality testing of the AAV-miR-128-3p are shown in Figs. 1A–1E. The construction process of the miR-128-3p AAV is depicted in Fig. 1A. Following sequencing alignment, the red-marked region in Fig. 1B indicates the miR-128-3p sponge target fragment, confirming successful construction of the miR-128-3p AAV (Fig. 1C). Mycoplasma contamination testing revealed that samples 1, 2, 3, and 6 were contaminated, while samples 4 and 5 showed no bands, indicating no mycoplasma infection (Fig. 1D). Standard curve analysis determined the titers of AAV9-c-gga-miR-128-3p sponge-ZsGreen and AAV9-CMV-ZsGreen to be 1.7 × 1012 vg/mL and 1.8 × 1012 vg/mL vg/mL, respectively (Table 4).

Fig. 1.

Fig. 1

Open in a new tab

Construction and quality detection of miR-128-3p adeno - associated virus. (A) Construction process of miR-128-3p adeno - associated virus. (B) Plasmid sequencing results of miR-128-3p adeno - associated virus. (C) Plasmid sequencing alignment results of miR-128-3p adeno - associated virus. (D) Mycoplasma detection of miR-128-3p adeno - associated virus. The presence of a band at the 500 bp position indicates mycoplasma contamination, while the absence of a band indicates no mycoplasma contamination.

Table 4.

Sample Titers.

Sample Titer (vg/mL)
Experimental Group (AAV9-c-gga-miR-128-3p sponge-ZsGreen) 1.7 × 1012
Control Group (AAV9-CMV-ZsGreen) 1.8 × 1012
Open in a new tab

3.2. Effects of miR-128-3p on body weight and breast muscle of AA broilers

The effects of miR-128-3p on body weight and breast muscle of AA broilers are shown in Figs. 2A–2E. Compared with the control group, the body weight (Fig. 2A), breast muscle weight (Fig. 2B), and breast muscle rate (Fig. 2C) of the experimental group increased by 0.127 kg, 22.304 g, and 0.766 %, respectively; however, these differences were not statistically significant (P > 0.05). Notably, the muscle fiber diameter in the experimental group was significantly larger than that in the control group (P < 0.05) (Fig. 2D).

Fig. 2.

Fig. 2

Open in a new tab

Effects of miR-128-3p on body weight and pectoralis major of AA broilers. (A) Body weights of different treatment groups. (B) Weights of pectoralis major in different treatment groups. (C) Pectoralis major rates of different treatment groups. (D) Hematoxylin - Eosin (HE) staining of pectoralis major in the control group. Scale bar: 100 μm. (E) HE staining of pectoralis major in the experimental group. Scale bar: 100 μm. (F) Quantification of pectoralis major muscle fiber diameters in different treatment groups. * indicates P < 0.05, ** indicates P < 0.01.

3.3. Effects of miR-128-3p on fat deposition in muscles and liver

The effects of miR-128-3p on fat deposition in muscles and liver are illustrated in Figs. 3A–3G. qRT-PCR results showed that miR-128-3p mRNA expression in breast muscle was significantly lower in the experimental group than in the control group (P < 0.05), while the expression of the lipid deposition-related gene FDPS was significantly higher (P < 0.05) (Fig. 3A). In leg muscle, miR-128-3p mRNA expression did not differ significantly between groups (P > 0.05), but the expression of lipid synthesis-related genes CEBPA, ACC, and FDPS was significantly upregulated in the experimental group (P < 0.05) (Fig. 3B). In the liver, miR-128-3p mRNA expression showed no significant difference (P > 0.05), while ACC expression (a lipid deposition-related gene) was significantly higher in the experimental group (P < 0.05) (Fig. 3C). Oil Red O staining further revealed that the lipid droplet area in both breast and leg muscles was significantly larger in the experimental group than in the control group (P < 0.05) (Figs. 3D–3G).

Fig. 3.

Fig. 3

Open in a new tab

Effects of miR-128-3p on fat deposition in muscles and liver. (A) mRNA expression levels of miR-128-3p and lipid deposition - related genes (CEBPA, FASN, PPARG, FABP, APOA1, ACC, FDPS) in the pectoralis major of different treatment groups. (B) mRNA expression levels of miR-128-3p and lipid deposition - related genes (CEBPA, FASN, PPARG, FABP, APOA1, ACC, FDPS) in the leg muscles of different treatment groups. (C) mRNA expression levels of miR-128-3p and lipid deposition - related genes (CEBPA, FASN, PPARG, FABP, APOA1, ACC, FDPS) in the liver of different treatment groups. (D) Oil Red O staining of the pectoralis major in different treatment groups. (E) Quantification of Oil Red O staining of the pectoralis major in different treatment groups. (F) Oil Red O staining of the leg muscles in different treatment groups. (G) Quantification of Oil Red O staining of the leg muscles in different treatment groups. * indicates P < 0.05, ** indicates P < 0.01. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.4. Effects of miR-128-3p on crude fat and crude protein in muscles

The effects of miR-128-3p on crude fat and crude protein in muscles are shown in Figs. 4A–4D. The experimental group had significantly higher crude fat content in breast muscle than the control group (P < 0.05) (Fig. 4A). While crude protein content was higher in both breast and leg muscles of the experimental group, these differences were not statistically significant (P > 0.05) (Fig. 4B, D). Crude fat and crude protein contents in leg muscle showed high consistency between groups (P > 0.05) (Fig. 4C).

Fig. 4.

Fig. 4

Open in a new tab

Effects of miR-128-3p on crude fat and crude protein contents in muscles. (A) Crude fat content in the pectoralis major of different treatment groups. (B) Crude protein content in the pectoralis major of different treatment groups. (C) Crude fat content in the leg muscles of different treatment groups. (D) Crude protein content in the leg muscles of different treatment groups. * indicates P < 0.05, ** indicates P < 0.01.

3.5. Lipidomics analysis

To investigate the effects of miR-128-3p on the lipid composition of chicken breast muscle, lipidomics sequencing was performed on breast muscle samples (3 replicates per group). Lipidomics results showed that three replicate quality control (QC) samples were tightly clustered under both positive and negative ion modes (Fig. 5A and B), indicating good experimental reproducibility. All breast muscle samples from the two groups fell within the 95 % confidence interval (Fig. 5C). To avoid overfitting in the supervised model, permutation testing was used to validate model effectiveness. As permutation retention decreased, both R2 and Q2 of the random model gradually declined, confirming no overfitting and stable model performance (Fig. 5D). A total of 1627 lipids were identified in the two groups, classified into 43 major categories. Triglyceride (TG), phosphatidylcholine (PC), and phosphatidylethanolamine (PE) comprised 320, 300, and 211 species, respectively, accounting for 19.7 %, 18.4 %, and 13.0 % of the total lipids—the top three most abundant categories (Fig. 5E).

Fig. 5.

Fig. 5

Open in a new tab

Relationships between pectoralis major samples and lipid classification in the miR-128-3p sponge group and CMV group. (A) Quality control PCA plot of different treatment groups in positive ion mode. (B) Quality control PCA plot of different treatment groups in negative ion mode. (C) OPLS-DA score plot of different treatment groups. (D) Permutation test plot. (E) Lipid classification diagram identified in pectoralis major of the two groups.

Using VIP > 1 and P value <0.05 as criteria for differential lipid screening, compared with the NC (control) group, the TG (experimental) group showed 7 lipids with increased abundance and 33 lipids with decreased abundance (Fig. 6B). These 40 differential lipids were primarily classified into 8 categories, with PE, PC, and TG being the most abundant (Fig. 6C). Abundance analysis of the 8 differential lipid classes revealed that the increased lipids were mainly phosphatidylserine (PS) and TG, while the remaining six lipid classes showed varying degrees of decrease (Fig. 6E). Further analysis of the increased PS and TG lipids showed that all PS species and five TG species were significantly upregulated in the TG group compared to the NC group. Notably, TG (20:3e_11:4_14:4) + NH was significantly downregulated, while most TG species were upregulated, consistent with increased muscle fat accumulation in breast muscle.

Fig. 6.

Fig. 6

Open in a new tab

Differential lipid analysis of pectoralis major between the miR-128-3p sponge group and CMV group. (A) Volcano plot of differential lipids in different treatment groups. (B) Histogram of differential lipids in different treatment groups. (C) Classification display of differential lipids between the two groups. (D) Abundance comparison of 8 differential lipids between the two groups. (E) Abundance comparison of differential lipid TG between the two groups. (F) Abundance comparison of differential lipid PS between the two groups.

Clustering heatmap analysis of the 40 differential lipids revealed that most lipids showed a downward trend after miR-128-3p sponge AAV injection. All lipids were divided into two clusters: Cluster 1 was predominantly composed of PE, and Cluster 2 was mainly TG (Fig. 7A). Lipids in Cluster 1 showed higher abundance in the NC group, while those in Cluster 2 were more abundant in the TG group. VIP analysis of the 40 differential lipids identified 19 key lipids with VIP > 2 (Fig. 7B), including significantly upregulated TG (16:2e_10:3_22:6) + NH and TG (18:4_9:0_10:2) + Na.

Fig. 7.

Fig. 7

Open in a new tab

Individualized analysis of 40 differential lipids in the pectoralis major between the miR-128-3p sponge group and CMV group. (A) Clustering heatmap of 40 differential lipids. (B) VIP (Variable Importance in the Projection) analysis of 40 differential lipids. (C) Abundance comparison of differential lipids with VIP ≥ 2.

Clustering correlation analysis between the 40 differential lipids and eight lipid deposition-related genes (FDPS, FABP, ACC, PPARG, FASN, CEBPA, miR-128-3p, APOA1) classified the lipids into two groups: seven lipids (mostly TG and PS) showed negative correlations with miR-128-3p and APOA1 (r < −0.3) but positive correlations with FDPS, FABP, and other genes (r > 0.2); the remaining 33 lipids (mostly PC and PE) exhibited positive correlations with miR-128-3p and APOA1 (r > 0.2) and negative correlations with FDPS, FABP, and other genes (r < −0.2) (Fig. 8). This correlation pattern suggests that miR-128-3p and APOA1 may jointly regulate lipid metabolic pathways, while other genes participate in lipid deposition through an opposing mechanism. The antagonistic effects of these two gene clusters likely maintain muscle lipid homeostasis.

Fig. 8.

Fig. 8

Open in a new tab

Pearson correlation analysis of 40 differential lipids with 8 lipid-related genes (FDPS, FABP, ACC, PPARG, FASN, CEBPA, miR-128-3p, APOA1).

4. Discussion

Body weight and breast muscle weight are the most intuitive indicators for measuring chicken meat production. Our results showed that body weight, breast muscle weight, and breast muscle rate were all increased in the experimental group compared with the control group, which is generally consistent with previous studies. Research has shown that miR-214 (Liu et al., 2010), miR-125b (Ge et al., 2011), and miR-148a (Zhang et al., 2012) can affect muscle growth and development by regulating genes related to muscle cell proliferation and differentiation. This phenomenon may be attributed to miR-128-3p participating in signaling pathways associated with muscle development, thereby exerting an impact on body weight and breast muscle weight. This is consistent with the finding by Motohashi et al. (2013) that miR-128 can affect myoblast proliferation by regulating the IRS1/Akt insulin signaling pathway. HE staining observed a significant increase in muscle fiber diameter in the experimental group, which may be related to miR-128-3p regulation of muscle cell proliferation and differentiation. From a cell biology perspective, the increase in muscle fiber diameter may be caused by multiple factors, such as increased intracellular protein synthesis, enhanced cell fusion, or changes in extracellular matrix components (Schiaffino & Reggiani, 2011). For example, some studies have found that specific miRNAs can regulate the synthesis of key proteins such as IGFBP5, Sp1, MyoD, and CDKN1A in muscle cells, thereby influencing the structure and function of muscle fibers (Dai et al., 2016; Ma et al., 2015; Zhang, Zhang, et al., 2017). RT-qPCR results showed that miR-128-3p expression in the breast muscle of the experimental group was significantly lower than that in the control group, while the expression of the lipid synthesis metabolism-related gene FDPS (farnesyl diphosphate synthase) was significantly higher. There was no significant difference in miR-128-3p expression in the leg muscle between the experimental and control groups, but the expression of lipid synthesis metabolism-related genes CEBPA (CCAAT/enhancer binding protein alpha), ACC, and FDPS was significantly higher in the experimental group. In the liver, miR-128-3p expression did not differ significantly between groups, while the lipid synthesis gene ACC was significantly upregulated in the experimental group. These results indicate that miR-128-3p has different regulatory effects in different tissues and cell types (Huang et al., 2015; Qu et al., 2020; Shi et al., 2021). Oil Red O staining showed that the lipid droplet area in the breast and leg muscles of the experimental group was significantly larger than that in the control group, visually demonstrating the promoting effect of AAV-miR-128-3p sponge on fat deposition. The increase in lipid droplet area may be due to increased intracellular lipid synthesis, enhanced lipid transport, or changes in the expression of lipid storage-related proteins (Haney et al., 2023; Liang et al., 2025; Zhang et al., 2024). Some studies have shown that specific gene regulation can affect the expression of key proteins such as fatty acid-binding protein (FABP) (Abdalla et al., 2024) and acetyl-CoA carboxylase (ACC) (Xu et al., 2024), thereby altering lipid synthesis and storage. The experimental group had significantly higher crude fat content in breast muscle than the control group, while there was no significant difference in protein content between breast and leg muscles. From the perspective of nutritional metabolism, the metabolic processes of fat and protein in animals are interrelated but relatively independent (Ling et al., 2023), suggesting that miR-128-3p has a greater impact on muscle fat metabolism than on protein metabolism. Lipidomics analysis revealed two antagonistic lipid-gene regulatory modules: five TG and one PS lipid species were negatively correlated with miR-128-3p and APOA1 but positively correlated with lipid synthesis genes such as FDPS. In contrast, 23 PC and PE phospholipid species showed the opposite trend. This phenomenon may reflect the metabolic balance between membrane phospholipids (PC and PE) and storage lipids (TG). The miR-128-3p sponge may preferentially promote the synthesis of energy-storage lipids while reducing the consumption of membrane-structural lipids, thereby maintaining myocyte homeostasis (Fan & Tan, 2024; Shyu et al., 2019). As a key component of high-density lipoprotein, the negative correlation between APOA1 and TG suggests that lipoprotein transport pathways may be involved in muscle fat deposition regulation, which is consistent with the conclusion that miR-128 regulates cholesterol lipoprotein transport genes (Wagschal et al., 2015). This study provides important target tools for precise regulation of the coordinated expression of chicken growth-related genes and IMF metabolism-related genes. In vivo injection of AAV-miR-128-3p sponge can improve both chicken growth rate and meat quality, meeting consumer demands for both the quantity and quality (such as tenderness, juiciness, and flavor) of chicken meat. However, the interaction relationships and regulatory networks among these genes still require further in-depth study.

Despite the meaningful findings of this study, there are limitations: first, the mechanism by which miR-128-3p regulates lipid metabolism was only explored through gene expression and lipidomics analyses, lacking direct evidence from functional experiments (e.g., verifying the reversal effect by knocking down FDPS/CEBPA); second, the experiment was only conducted under standardized conditions using specific broiler breeds, limiting the generalizability of conclusions to local chicken breeds or different rearing environments; third, only short-term effects were studied, and the long-term impacts of the AAV-miR-128-3p sponge on chicken reproductive performance and meat safety remain uninvestigated.

Future research should: conduct rescue experiments to validate the direct targets of miR-128-3p and the mediating role of FDPS; expand to local chicken breeds and simulate practical rearing conditions to test the sponge's adaptability; perform long-term feeding trials and safety assessments to support commercial application; and combine single-cell RNA sequencing with spatial lipidomics to clarify its cell-type-specific roles in muscle/liver tissues and enrich understanding of the molecular network.

5. Conclusion

This study validated that in vivo inhibition of miR-128-3p via the AAV-miR-128-3p sponge vector simultaneously improved AA broilers' growth performance (increased body weight, breast muscle weight, and muscle fiber diameter) and IMF content (larger lipid droplet area and higher crude fat in breast muscle). Lipidomics showed 5 upregulated TG species in breast muscle, with miR-128-3p negatively correlated with TG and APOA1. These findings confirm miR-128-3p regulates broiler growth and IMF metabolism, providing a targeted tool for precise breeding and avian lipid metabolism research.

CRediT authorship contribution statement

Tingqi Zhu: Writing – original draft, Visualization, Validation, Resources, Methodology, Data curation. Lekun Deng: Visualization, Validation, Data curation. Yuehua He: Validation, Data curation. Wenjie Liang: Visualization, Validation. Pingquan Liu: Visualization, Validation. Shuangxing Liu: Visualization, Data curation. Haishan Guo: Validation, Data curation. Donghua Li: Supervision, Methodology. Fengbin Yan: Supervision, Methodology. Yadong Tian: Supervision, Methodology. Ruirui Jiang: Supervision, Methodology. Xiangtao Kang: Resources, Conceptualization. Weiwei Jin: Resources, Methodology. Zhunan Li: Writing – review & editing, Visualization, Supervision, Methodology, Conceptualization. Wenting Li: Supervision, Methodology. Guirong Sun: Resources, Methodology, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgement

This work was supported by the Biological Breeding-National Science and Technology Major Project (2023ZD0406403), grants from the National Natural Science Foundation of China (32072710), the Shennong Laboratory (SN01-2022-05), the Henan Province Zhongyuan Scholar Workstation (234400510023), and the Science and Technology Innovation 2030 Major Projects (2023ZD0405203).

Contributor Information

Zhunan Li, Email: lizhunan2020@163.com.

Wenting Li, Email: liwenting_5959@hotmail.com.

Guirong Sun, Email: grsun2000@126.com.

Data availability

Data will be made available on request.

References

  1. Abdalla M.A., Abubaker J., Abu-Farha M., Al-Khairi I., Cherian P., Qaddoumi M.G.…Al-Mulla F. Investigating the role of FABP4 in diabetes and obesity and the influence of age and ethnicity: A comprehensive analysis of a cohort from the KEDP-study. International Journal of Molecular Sciences. 2024;25 doi: 10.3390/ijms25094578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Attia Y.A., Rahman M.T., Hossain M.J., Basiouni S., Khafaga A.F., Shehata A.A., Hafez H.M. Poultry production and sustainability in developing countries under the COVID-19 crisis: Lessons learned. Animals : an Open Access Journal from MDPI. 2022;12 doi: 10.3390/ani12050644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cao Y., Xing Y., Guan H., Ma C., Jia Q., Tian W.…Li H. Genomic insights into molecular regulation mechanisms of intramuscular fat deposition in chicken. Genes (Basel) 2023;14 doi: 10.3390/genes14122197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chen C., Deng Y., Hu X., Ren H., Zhu J., Fu S., Xie J., Peng Y. miR-128-3p regulates 3T3-L1 adipogenesis and lipolysis by targeting Pparg and Sertad2. Journal of Physiology and Biochemistry. 2018;74:381–393. doi: 10.1007/s13105-018-0625-1. [DOI] [PubMed] [Google Scholar]
  5. Chen L., Song J., Cui J., Hou J., Zheng X., Li C., Liu L. microRNAs regulate adipocyte differentiation. Cell Biology International. 2013;37:533–546. doi: 10.1002/cbin.10063. [DOI] [PubMed] [Google Scholar]
  6. Chen Y., Zhao Y., Jin W., Li Y., Zhang Y., Ma X.…Li G. MicroRNAs and their regulatory networks in Chinese Gushi chicken abdominal adipose tissue during postnatal late development. BMC Genomics. 2019;20:778. doi: 10.1186/s12864-019-6094-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dai Y., Zhang W.R., Wang Y.M., Liu X.F., Li X., Ding X.B., Guo H. MicroRNA-128 regulates the proliferation and differentiation of bovine skeletal muscle satellite cells by repressing Sp1. Molecular and Cellular Biochemistry. 2016;414:37–46. doi: 10.1007/s11010-016-2656-7. [DOI] [PubMed] [Google Scholar]
  8. Deng S., Xing T., Li C., Xu X., Zhou G. The effect of breed and age on the growth performance, carcass traits and metabolic profile in breast muscle of Chinese indigenous chickens. Foods. 2022;11 doi: 10.3390/foods11030483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Fan H., Tan Y. Lipid droplet–mitochondria contacts in health and disease. International Journal of Molecular Sciences. 2024;25 doi: 10.3390/ijms25136878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fanatico A.C., Pillai P.B., Emmert J.L., Owens C.M. Meat quality of slow- and fast-growing chicken genotypes fed low-nutrient or standard diets and raised indoors or with outdoor access. Poultry Science. 2007;86:2245–2255. doi: 10.1093/ps/86.10.2245. [DOI] [PubMed] [Google Scholar]
  11. Ge Y., Sun Y., Chen J. IGF-II is regulated by microRNA-125b in skeletal myogenesis. The Journal of Cell Biology. 2011;192:69–81. doi: 10.1083/jcb.201007165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gurunathan K., Tahseen A., Manyam S. Effect of aerobic and modified atmosphere packaging on quality characteristics of chicken leg meat at refrigerated storage. Poultry Science. 2022;101 doi: 10.1016/j.psj.2022.102170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Haney M.S., Pálovics R., Munson C.N., Long C., Johansson P., Yip O.…Wyss-Coray T. APOE4/4 is linked to damaging lipid droplets in Alzheimer’s microglia. bioRxiv : The Preprint Server for Biology. 2023 doi: 10.1101/2023.07.21.549930. [DOI] [Google Scholar]
  14. Huang C.Y., Huang X.P., Zhu J.Y., Chen Z.G., Li X.J., Zhang X.H.…Wu G.B. miR-128-3p suppresses hepatocellular carcinoma proliferation by regulating PIK3R1 and is correlated with the prognosis of HCC patients. Oncology Reports. 2015;33:2889–2898. doi: 10.3892/or.2015.3936. [DOI] [PubMed] [Google Scholar]
  15. Liang B., Fu L., Liu P. Regulation of lipid droplet dynamics and lipid homeostasis by hydroxysteroid dehydrogenase proteins. Trends in Cell Biology. 2025;35:153–165. doi: 10.1016/j.tcb.2024.10.010. [DOI] [PubMed] [Google Scholar]
  16. Ling Z.-N., Jiang Y.-F., Ru J.-N., Lu J.-H., Ding B., Wu J. Amino acid metabolism in health and disease. Signal Transduction and Targeted Therapy. 2023;8:345. doi: 10.1038/s41392-023-01569-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Liu J., Luo X.J., Xiong A.W., Zhang Z.D., Yue S., Zhu M.S., Cheng S.Y. MicroRNA-214 promotes myogenic differentiation by facilitating exit from mitosis via down-regulation of proto-oncogene N-ras. The Journal of Biological Chemistry. 2010;285:26599–26607. doi: 10.1074/jbc.M110.115824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ma G., Wang Y., Li Y., Cui L., Zhao Y., Zhao B., Li K. MiR-206, a key modulator of skeletal muscle development and disease. International Journal of Biological Sciences. 2015;11:345–352. doi: 10.7150/ijbs.10921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Mir N.A., Rafiq A., Kumar F., Singh V., Shukla V. Determinants of broiler chicken meat quality and factors affecting them: A review. Journal of Food Science and Technology. 2017;54:2997–3009. doi: 10.1007/s13197-017-2789-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Motohashi N., Alexander M.S., Shimizu-Motohashi Y., Myers J.A., Kawahara G., Kunkel L.M. Regulation of IRS1/Akt insulin signaling by microRNA-128a during myogenesis. Journal of Cell Science. 2013;126:2678–2691. doi: 10.1242/jcs.119966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Qu C., Liu X., Guo Y., Fo Y., Chen X., Zhou J., Yang B. MiR-128-3p inhibits vascular smooth muscle cell proliferation and migration by repressing FOXO4/MMP9 signaling pathway. Molecular Medicine (Cambridge, Mass.) 2020;26:116. doi: 10.1186/s10020-020-00242-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Schiaffino S., Reggiani C. Fiber types in mammalian skeletal muscles. Physiological Reviews. 2011;91:1447–1531. doi: 10.1152/physrev.00031.2010. [DOI] [PubMed] [Google Scholar]
  23. Sheng Z., Pettersson M.E., Hu X., Luo C., Qu H., Shu D.…Li N. Genetic dissection of growth traits in a Chinese indigenous × commercial broiler chicken cross. BMC Genomics. 2013;14 doi: 10.1186/1471-2164-14-151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Shi Y., Yan F., Wang F., Pan L. MiR-128-3p suppresses tumor proliferation and metastasis via targeting CDC6 in hepatocellular carcinoma cells. Tissue & Cell. 2021;72 doi: 10.1016/j.tice.2021.101534. [DOI] [PubMed] [Google Scholar]
  25. Shyu P., Ng B.S.H., Ho N., Chaw R., Seah Y.L., Marvalim C., Thibault G. Membrane phospholipid alteration causes chronic ER stress through early degradation of homeostatic ER-resident proteins. Scientific Reports. 2019;9:8637. doi: 10.1038/s41598-019-45020-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Tang H., Gong Y.Z., Wu C.X., Jiang J., Wang Y., Li K. Variation of meat quality traits among five genotypes of chicken. Poultry Science. 2009;88:2212–2218. doi: 10.3382/ps.2008-00036. [DOI] [PubMed] [Google Scholar]
  27. Wagschal A., Najafi-Shoushtari S.H., Wang L., Goedeke L., Sinha S., deLemos A.S.…Näär A.M. Genome-wide identification of microRNAs regulating cholesterol and triglyceride homeostasis. Nature Medicine. 2015;21:1290–1297. doi: 10.1038/nm.3980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Xu Y., Lin Z., Hou J., Ye K., Han S., Liang Y.…Gao H. A bacterial transcription activator dedicated to the expression of the enzyme catalyzing the first committed step in fatty acid biosynthesis. Nucleic Acids Research. 2024;52:12930–12944. doi: 10.1093/nar/gkae960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Yu D.K., Green B., Marrone A., Guo Y.L., Kadlubar S., Lin D.X.…Ning B.T. Suppression of CYP2C9 by MicroRNA hsa-miR-128-3p in human liver cells and association with hepatocellular carcinoma. Scientific Reports. 2015;5 doi: 10.1038/srep08534. ARTN 853410.1038/srep08534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zhang J., Ying Z.Z., Tang Z.L., Long L.Q., Li K. MicroRNA-148a promotes myogenic differentiation by targeting the ROCK1 gene. The Journal of Biological Chemistry. 2012;287:21093–21101. doi: 10.1074/jbc.M111.330381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Zhang T., Linghu K.-G., Tan J., Wang M., Chen D., Shen Y., Wu J., Shi M., Zhou Y., Tang L., Liu L., Qin Z.-H., Guo B. TIGAR exacerbates obesity by triggering LRRK2-mediated defects in macroautophagy and chaperone-mediated autophagy in adipocytes. Autophagy. 2024;20:1741–1761. doi: 10.1080/15548627.2024.2338576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Zhang W., Yao C., Wei Z., Dong Q. miR-128 promoted adipogenic differentiation and inhibited osteogenic differentiation of human mesenchymal stem cells by suppression of VEGF pathway. Journal of Receptors and Signal Transduction. 2017;37:217–223. doi: 10.1080/10799893.2016.1212375. [DOI] [PubMed] [Google Scholar]
  33. Zhang W.R., Zhang H.N., Wang Y.M., Dai Y., Liu X.F., Li X.…Guo H. miR-143 regulates proliferation and differentiation of bovine skeletal muscle satellite cells by targeting IGFBP5. In vitro cellular & developmental biology. Animal. 2017;53:265–271. doi: 10.1007/s11626-016-0109-y. [DOI] [PubMed] [Google Scholar]
  34. Zhu S., Zhang B., Zhu T., Wang D., Liu C., Liu Y., He Y., Liang W., Li W., Han R., Li D., Yan F., Tian Y., Li G., Kang X., Li Z., Jiang R., Sun G. miR-128-3p inhibits intramuscular adipocytes differentiation in chickens by downregulating FDPS. BMC Genomics. 2023;24:540. doi: 10.1186/s12864-023-09649-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be made available on request.

Articles from Food Chemistry: Molecular Sciences are provided here courtesy of Elsevier

RESOURCES