Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2005 Nov;25(21):9661–9673. doi: 10.1128/MCB.25.21.9661-9673.2005

Phosphotyrosine 1062 Is Critical for the In Vivo Activity of the Ret9 Receptor Tyrosine Kinase Isoform

Adrianne Wong 1,, Silvia Bogni 2,, Pille Kotka 1,, Esther de Graaff 2,§, Vivette D'Agati 3, Frank Costantini 1,¶,*, Vassilis Pachnis 2,¶,*
PMCID: PMC1265823  PMID: 16227613

Abstract

The receptor tyrosine kinase Ret plays a critical role in the development of the mammalian excretory and enteric nervous systems. Differential splicing of the primary Ret transcript results in the generation of two main isoforms, Ret9 and Ret51, whose C-terminal amino acid tails diverge after tyrosine (Y) 1062. Monoisoformic mice expressing only Ret9 develop normally and are healthy and fertile. In contrast, animals expressing only Ret51 have aganglionosis of the distal gut and hypoplastic kidneys. By generating monoisoformic mice in which Y1062 of Ret9 has been mutated to phenylalanine, we demonstrate that this amino acid has a critical role in Ret9 signaling that is necessary for the development of the kidneys and the enteric nervous system. These findings argue that the distinct activities of Ret9 and Ret51 result from the differential regulation of Y1062 by C-terminal flanking sequences. However, a mutation which places Y1062 of Ret51 in a Ret9 context improves only marginally the ability of Ret51 to support renal and enteric nervous system development. Finally, monoisoformic mice expressing a variant of Ret9 in which a C-terminal PDZ-binding motif was mutated develop normally and are healthy. Our studies identify Y1062 as a critical regulator of Ret9 signaling and suggest that Ret51-specific motifs are likely to inhibit the activity of this isoform.


The receptor tyrosine kinase Ret has diverse roles in mammalian embryonic development and disease (5, 50). Mice with targeted deletions of Ret lack enteric ganglia from the entire intestinal wall and have severe kidney defects (13, 17, 40). In addition, germ line and somatic mutations in human RET are associated with a variety of diseases. For example, inactivating mutations of RET result in Hirschsprung's disease (congenital megacolon), a condition that affects 1 in 4,500 infants and is characterized by the absence of enteric ganglia from (usually) the distal colon (9, 10, 33). In contrast to the loss-of-function phenotype, activating germ line mutations of RET are responsible for the cancer syndromes multiple endocrine neoplasia types 2A and 2B (21, 25, 35), while somatic rearrangements of the gene are associated with thyroid papillary carcinomas (36).

Ret is a signaling receptor for members of the glial cell line-derived neurotrophic factor (GDNF) family of ligands, which also include neurturin, persephin, and artemin (1, 5). The interaction between Ret and the GDNF family of ligands is mediated by glycosylphosphatidylinositol-anchored cell surface glycoproteins GFRα1-4 (1, 2, 5). Among the signaling pathways activated by Ret are the mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K) pathways, which regulate cell survival, proliferation, differentiation, migration, and axonal outgrowth (18, 48, 51). As in all receptor tyrosine kinases, activation of Ret is associated with phosphorylation of specific tyrosine (Y) residues resulting in phosphotyrosine (pY) docking sites for intracellular adaptor and effector signaling molecules (39). Among such residues, pY1062 appears to have a critical role in signal initiation, serving as a docking site for protein complexes that activate both the MAPK and the PI3K signaling cascades (3, 6, 11, 19, 22, 26-28).

In vertebrates, differential splicing of the primary Ret transcript results in the formation of two major isoforms, Ret9 and Ret51, which share the first 1,063 amino acids but differ at their carboxy-terminal tails (47); Ret9 has a 9-amino-acid tail, which in Ret51 is replaced by 51 different amino acids. As a result, the sequence context of the multidocking pY1062 site is different between the two isoforms. Ret51 contains two additional tyrosines (corresponding to Y1090 and Y1096 of human Ret), one of which (pY1096) forms a docking site for Grb2 and contributes to the activation of the PI3K/Akt pathway (6, 22). Although the two isoforms behave similarly in a number of in vitro assays, they differ dramatically in their capacity to support normal development. By generating alleles of Ret that encode only one of the two isoforms, we have previously demonstrated that Ret9 is necessary and sufficient to support normal embryogenesis and postnatal life, suggesting that Ret51 is dispensable. In contrast, animals expressing only Ret51 have severe defects in gut innervation and renal development, revealing a requirement for Ret9 (12, 46). Although these observations indicated that isoform-specific carboxy-terminal sequences are critical for the developmental functions of Ret9 and Ret51, the molecular mechanisms underlying the differential requirements of the two Ret isoforms are currently unclear.

According to one model, these differences are a consequence of the effects of isoform-specific sequences on the binding of signaling molecules on pY1062. Such potential effects are highlighted by the binding on pY1062 of the adaptor protein Shc, which contains an SH2 and a PTB phosphotyrosine-binding domain. Due to the sequence divergence of Ret9 and Ret51, which begins at residue 1064, the Shc SH2 domain can bind to pY1062 of Ret9 but not Ret51, while the PTB domain can bind to both isoforms (3, 28). Therefore, the observed functional differences between Ret9 and Ret51 could result, partly or wholly, from the alternative modes of binding to pY1062 of adaptor molecules, including Shc, and their subsequent effects on downstream signaling.

An alternative hypothesis is that signaling modules within the isoform-specific sequences of Ret9 or Ret51 could engage directly with and activate distinct intracellular signaling pathways. Consistent with this view, the scaffolding adaptor protein Shank3 binds to a PDZ-binding motif (1069FTRF1072), which is present at the C terminus of Ret9 but absent from Ret51 (43). Binding of Shank3 can recruit Grb2, leading to sustained activation of the Erk-MAPK and PI3K pathways, both of which are thought to be critical for tubule formation by epithelial kidney cells and scattering of MDCK cells (43). The interaction of Shank3 with Ret9 is blocked by the C-terminal amino acid substitution F1072A, which also inhibits the ability of Ret9 to transduce GDNF signals in MDCK cells (43).

To distinguish between these hypotheses in vivo, we generated three novel monoisoformic mouse strains, which express mutant forms of Ret9 or Ret51, and compared the phenotypes of these animals to those expressing the corresponding wild-type isoforms. Initially, we tested the importance of Y1062 by generating the Ret9-Y1062F allele. Our experiments expand on previous cell culture and in vivo studies (3, 6, 19, 22, 26-28) and show that Y1062 plays an essential role for the in vivo signaling of the Ret9 isoform. We next examined whether the different amino acid context of pY1062 can explain the differential activities of the Ret isoforms. To investigate this question, we created the modified allele Ret51-RI, in which amino acids M1064 and S1065 of Ret51 were replaced by the corresponding amino acids of Ret9 (R1064 and I1065), with the aim of creating a variant of Ret51 in which pY1062 is embedded in Ret9-like context. We hypothesized that this alteration might bestow on Ret51 the ability to support normal development in the absence of Ret9, but we found that the developmental defects of Ret51-RI mice were almost as severe as those of Ret51 mice. Finally, to test the hypothesis that the Ret9-specific C-terminal PDZ-binding motif (43) has an important function unrelated to Y1062, we generated mice expressing a variant of Ret9 in which this motif was abolished. Surprisingly, these mice developed normally and were healthy. Our studies indicate that the differential activities of the Ret isoforms result from the interplay of multiple mechanisms and raise the possibility that the Ret51-specific signaling motifs (such as pY1096) are crucial for the unique signaling properties of the Ret isoforms.

MATERIALS AND METHODS

Animals.

The generation and genotyping of Ret9 and Ret51 animals has been described previously (12). The day of vaginal plug was considered to be E0.5. Following is the strategy used for the generation of the new mouse strains analyzed in this study.

Ret9-Y1062F.

The Y1062F mutation was introduced into the human Ret9 cDNA using the QuikChange site-directed mutagenesis kit (Stratagene). Briefly, a plasmid containing the human Ret9 cDNA was used as a template for PCR amplification using forward (Ret9Y1062Ffw, 5′ATTGAAAACAAGCTTTTTGGTAGAATTTC3′) and reverse (Ret9Y1062Frev, 5′GAAATTCTACCAAAAAGCTTGTTTTCAAT3′) mutagenic primers and Pfu polymerase. The cDNA sequence for I E N K L Y G R I (ATT GAA AAC AAA CTC TAT GGT AGA ATT) was converted to that for I E N K L F G R I (ATT GAA AAC AAG CTT TTT GGT AGA ATT). The altered bases are shown in bold letters, and the HindIII site is underlined. Mutant cDNA clones were identified by HindIII digestion and confirmed by sequencing. To generate the targeting vector, a 1.6-kb BamHI fragment containing the intracellular human Ret9-Y1062F cDNA was fused to the mouse cDNA at nucleotide 2310. A 2.8-kb SacI (866)-DraI (3675) fragment was subsequently cloned into a vector containing the human β-globin polyadenylation signal and a loxP-flanked (floxed) neoR cassette. Finally, a 4.6-kb FseI fragment was inserted into the targeting vector containing a thymidine kinase-encoding cDNA (for negative selection) and the genomic region of mouse Ret encompassing exons 6 to 11.

Ret51-RI.

For Ret51-RI, the mutations were introduced using the same mutagenesis kit except that the PCRs were performed with 100, 250, and 500 ng of template DNA. The human Ret51 cDNA in pBluescript was used as the template. The cDNA sequence for I E N K L Y G M S D (ATT GAA AAC AAA CTC TAT GGC ATG TCA GAC CCG AAC) was converted to that for I E N K L Y G R I D (ATT GAA AAC AAA CTC TAT GGC CGG ATC GAT CCG AAC). The altered bases are shown in bold letters, and the ClaI site is underlined. The following primers were for mutagenesis: 5′GAAAACAAACTCTATGGCCGGATCGATCCGAACTGGCCTGGAGAG3′ (Ret51M/RS/I 5′ primer) and 5′CTCTCCAGGCCAGTTCGGATCGATCCGGCCATAGAGTTTGTTTTC3′ (Ret51M/RS/I 3′ primer). Mutant cDNA clones were identified by ClaI digestion and confirmed by sequencing. The mutated sequence was cloned back into the original hRet51 cDNA using a BglII site in the cDNA and a NotI site in the 3′ multiple cloning site of the vector. The targeting vector was then reconstructed as described previously (12).

Ret9-F1072A.

Ret9 cDNA sequences were changed to create an F-to-A substitution at residue 1072. Silent base changes were used to introduce an AvrII restriction site (C/CTAGG) to facilitate screening of positive mutant clones. The sequence H A F T R F * (CAT GCA TTT ACT AGA TTC TAG CAC CGC TGT CCC C) was converted to H A F T R A * (CAT GCA TTT ACT AGA GCC TAG GAC CGC TGT CCC C). The altered bases are shown in bold letters, and the AvrII site is underlined. The primers for mutagenesis were: 5′CCA TGCATTTACTAGAGCCTAGGACCGCTGTCCCCTTTG3′ (hRet9FA 5′ primer) and 5′CAAAGGGGACAGCGGTCCTAGGCTCTAGTAAATGCATGG (hRet9FA 3′ primer). We performed the site-directed mutagenesis on a 1.8-kb BamHI fragment of human Ret9 cDNA (base pairs 2334 to 4165), and the resulting positive clones were confirmed by sequencing. The BamHI fragment was inserted into the human Ret9 cDNA, which was then inserted into the targeting vector shown in Fig. 1A as described above.

FIG. 1.

FIG. 1.

Targeting of the c-Ret locus. (A) Schematic representation of the targeting strategy. To generate the targeting construct (shown at the top), cDNAs encoding the intracellular part of human Ret9 (green box), the β-globin polyadenylation signal (pA) (white box), and the Neor gene (pgk-Neo; yellow box) were inserted in frame into exon 11 of the mouse locus (light blue) immediately after the segment encoding the transmembrane domain. The wild-type locus is shown in the middle and the targeted locus at the bottom. Solid arrowheads indicate loxP sites. Restriction enzyme digests and probes used for Southern blotting are indicated, as are PCR primers p1 to p4 (arrows). (B) The products generated by the targeting of Ret, as described here and previously (12), are shown. All Ret alleles encode single chimeric receptors with identical extracellular (EC; light blue) and transmembrane (red) domains. Green boxes represent the common intracellular sequence of Ret9 and Ret51, while yellow and magenta represent the Ret9- and Ret51-specific sequences, respectively. Ret9-Y1062F is identical to Ret9 except that Y1062 (black dot) is replaced by F (shown in red). Ret9-F1072A is identical to Ret9 except that F1072 at the carboxy terminus is replaced with A (shown in red). Finally, in Ret51-RI, the amino acids M and S (at the start of the Ret51-specific sequence) have been changed to R and I. The sequence I E N K L Y, shared by Ret9, Ret51, and Ret51-RI, mediates the binding of the Shc PTB domain to Y1062, while the sequence Y G R I, found only in Ret9 and Ret51-RI, mediates the binding of the Shc SH2 domain (24, 28, 31).

Electroporation of embryonic stem cells and generation of mutant mice.

Each targeting vector DNA was linearized with NdeI, purified on a Qiaquick column, and used for electroporation of E14 (Ret9-Y1062F) or W9.5 (Ret51-RI and Ret9-F1072A) embryonic stem (ES) cells (derived from strain 129S1; gifts of Colin Stewart). For Ret9-Y1062F, 15 out of 80 colonies were positive by PCR using primers as described previously (12). For Ret51-RI, 71 out of 129 G418- and ganciclovir-resistant clones, and another 8 out of 40 clones selected only with G418, were correctly targeted, as shown by Southern blotting. For Ret9-F1072A, 33 of 128 clones were correctly targeted. The 15 Ret9-Y1062F clones identified by PCR as well as the first 129 Ret51-RI clones and the 128 Ret9-F1072A clones were screened by EcoRI restriction enzyme digestion and Southern blotting with a probe (a 500-bp PspAI fragment) shown in Fig. 1A. This yielded an 18-kb wild-type fragment and a 14-kb mutant fragment (Fig. 1A). Targeted clones were further analyzed by digestion with HindIII, which yielded a wild-type fragment of ∼9 kb and a mutant fragment of ∼8 kb (Fig. 1A). The second batch of 40 Ret51-RI clones was screened by HindIII digestion. Targeted ES cells were injected into C57BL/6J blastocysts, and resulting chimeric males were crossed with C57BL/6J females to determine germ line transmission. They were also crossed to 129S1 females to obtain the mutations on an inbred 129S1 background. Our previous analysis of Ret9 and Ret51 monoisoformic mice was carried out without removal of the neoR cassette, the presence of which does not influence the expression of the monoisoformic alleles (12). Therefore, in order to be able to compare the phenotype of the mutant strains generated in this study to those previously generated, the neoR cassette was not removed.

Genotyping mutant mice.

Inheritance of the mutant alleles was monitored by PCR using the following primers. Primer p1 (ret9/51 forward) (GCG AGG AGA TGT TCC GCC TGA TGC T) and primer p2 (ret9/51rev) (TAG CAA AAG GGC CTA GCT TGG ACT) yielded a 410-bp band in Ret9, Ret9-Y1062F, and Ret9-F1072A mice and a 690-bp band in Ret51 and Ret51-RI mice. Primer p3 (wt ex 11) (CTG TGT GAT GCG CTG TGC CGC A) and primer p4 (wt intron11) (TGC CGT ATC CAC CAT CTG TGG G) yielded a band of ∼350 bp from the wild-type Ret allele. Two percent agarose gels were used to separate the amplification products. To confirm the genotypes of the mutant mice, DNA isolated from ES cells and tails was PCR amplified using primers p1 and p2 (Fig. 1A), and the PCR products were sequenced using primer p1.

Analysis of kidneys.

In situ hybridization analysis of Ret expression was carried out on fresh frozen sections using a riboprobe generated from the pmcRet7 plasmid (12, 32). The kidneys and urogenital system of newborn (P1) pups were dissected and fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) overnight at 4°C. Kidneys were photographed at 1× magnification, the image was converted to black and white using Adobe Photoshop 5.5, and the cross-sectional area was measured (in the case of Ret51-RI and Ret9-F1072A mutations) using NIH Image (http://rsb.info.nih.gov/ij/). For histology, the kidneys were dehydrated, embedded in paraffin, sectioned at 3 μm, and stained with hematoxylin and eosin.

Analysis of the enteric nervous system (ENS).

In situ hybridization analysis was carried out on fresh frozen sections using riboprobes for Ret (pmcRet7; see above), Scg10 (pScg10, containing part of the mouse Scg10 cDNA; a gift of D. Anderson), and Phox2B (pPhox2B, containing 1.6 kb of mouse Phox2b cDNA; a gift of C. Goridis).

For the analysis of P1 pups, the gastrointestinal tract from stomach to anus was dissected and mesentery removed. The gut was laid out on Whatman 3M paper and fixed in 4% PFA in PBS at 4°C for 1 h. The ENS was visualized by acetylcholinesterase staining as described previously (16). For whole-mount immunostaining, guts were dissected from E11.0 to E13.5 embryos, fixed for 1 h in 4% PFA in PBS (at 4°C), washed three times in PBS at room temperature (RT) for 5 min each, and then incubated with 1 mg/ml TuJ1 antibody (Ab) (MMS-435P, neuronal class III β-tubulin monoclonal Ab, Covance Research Products) in 1:1,000 PBSTBG (1× PBS, 0.1% Triton X-100, 1% bovine serum albumin, 0.15% glycine) at 4°C overnight (ON). The guts were then washed three times in PBST (1× PBS, 0.1% Triton X-100) at RT for 5 min each and then ON in PBST at 4°C. Next, they were incubated at 4°C ON with the appropriate secondary antibodies (biotinylated anti-mouse immunoglobulin G Ab [Vector Labs] or Alexa Fluor568 goat anti-mouse immunoglobulin G diluted in PBSTBG at 1:500), washed three times in PBST at RT for 5 min each, and then incubated in PBST at 4°C. For the biotinylated anti-mouse secondary antibody, staining was developed with the Vector ABC-horseradish peroxidase-conjugated kit using horseradish peroxidase-3,3′-diaminobenzidine substrate according to Vector protocols.

RESULTS

Generation of Ret9-Y1062F knock-in mice.

The distinct requirements for Ret9 and Ret51 in vivo (12) might be explained by the effects of flanking carboxy-terminal sequences on the signaling activity of pY1062, as suggested by a number of in vitro studies (11, 28, 31). We reasoned that for this to be the case, pY1062 ought to be a critical mediator of Ret signaling in vivo. To test this hypothesis, we generated the monoisoformic allele Ret9-Y1062F, encoding a variant of Ret9 in which Y1062 is replaced by phenylalanine (Y1062F), using the strategy we employed previously (12) for the generation of monoisoformic Ret9 and Ret51 mice (Fig. 1A). Briefly, a 10-kb NdeI-XhoI genomic clone was used to insert a cDNA fragment, encoding the intracellular segment of human Ret9 bearing the Y1062F mutation, into exon 11 of the murine Ret gene, immediately downstream of the sequence encoding the transmembrane domain (Fig. 1A) (12). Homologous recombination in ES cells would replace the wild-type locus with an allele encoding a single chimeric receptor composed of the extracellular region of murine Ret fused to the intracellular domain of human Ret9 (Fig. 1B). Correctly targeted ES cells were injected into mouse blastocysts, and animals heterozygous for the Ret9-Y1062F mutation were generated from the resulting chimeras. Analysis of Ret9 and Ret9-Y1062F homozygotes allowed us to test the role of pY1062 in the context of a single isoform and compare directly the phenotypes of mice expressing wild-type Ret9 or Ret9-Y1062F. Similar to Ret9 heterozygotes and homozygotes, Ret9-Y1062F heterozygotes displayed no morphological abnormalities, were fertile, and had normal life spans. However, Ret9-Y1062F homozygotes died shortly after birth. Since early neonatal lethality is also observed in Ret null (Retk−/k) mice (40), we wished to exclude the possibility that our genetic manipulations had silenced the Ret locus. We therefore carried out in situ hybridization on sections from wild-type, Ret9/9, and Ret9-Y1062F/9-Y1062F embryos using a Ret-specific riboprobe. Similar-intensity signals were observed in two regions of high Ret expression (sensory ganglia and the ventral spinal cord) in all embryos analyzed, arguing that the Ret9 and Ret9-Y1062F alleles are expressed at comparable levels (Fig. 2). Therefore, the lethality of Ret9-Y1062F homozygotes is unlikely to result from the failure of this allele to be expressed, suggesting that pY1062 signaling is essential for Ret9 function.

FIG. 2.

FIG. 2.

Expression of Ret9 and Ret9-Y1062F alleles. Fresh frozen sections from E13.5 wild-type (A), Ret9 (B), and Ret9-Y1062F (C) homozygous embryos were hybridized with a Ret-specific riboprobe. Similar levels of expression of the three alleles were observed in the ventral spinal cord (arrowheads) and sensory ganglia (arrows).

pY1062 in Ret9 is necessary for normal kidney formation.

Next we analyzed the role of Y1062 signaling in renal development in animals generated by intercrossing Ret+/9 to Ret+/9-Y1062F parents. Although Ret+/9-Y1062F, Ret+/9, and Ret9/9 animals had kidneys of similar sizes and normal histology, kidneys of Ret9-Y1062F homozygotes were severely hypoplastic (Fig. 3A to C and data not shown) as well as dysplastic, with no recognizable medulla, cortex, or nephrogenic zone and large regions of undifferentiated mesenchyme. Furthermore, the number of recognizable nephric elements (glomeruli, proximal and distal tubules, and collecting ducts) was drastically reduced (Fig. 3, compare panel F to panels D and E). These defects are similar to, albeit somewhat milder than, those observed in Ret null mice, which are often characterized by kidney agenesis (40, 42).

FIG. 3.

FIG. 3.

Signaling by pY1062 is necessary for normal kidney formation. (A to C) The excretory systems of E18.5 wild-type (A), Ret9 (B), and Ret9-Y1062F (C) mutant animals were fixed and photographed as whole-mount preparations under the same magnification. The kidneys of wild-type and Ret9 animals are indistinguishable in size, but the kidneys of Ret9-Y1062F homozygotes are reproducibly smaller. (D to F) Photomicrographs of sections of the kidneys from wild-type (D), Ret9 (E), and Ret9-Y1062F (F) mutant animals stained with hematoxylin and eosin. Histological analysis of Ret9 kidneys showed no obvious differences from those from wild-type animals; both displayed a well-organized medulla (m), cortex (c), and nephrogenic zone (n), with numerous glomeruli (arrows). In contrast, the hypoplastic kidneys of Ret9-Y1062F homozygotes lacked a defined organization, displaying only a few disorganized tubular elements (asterisks) and undifferentiated mesenchyme (arrowhead). (G to I) In situ hybridization analysis of the kidneys from wild-type (G), Ret9 (H), and Ret9-Y1062F (I) E13.5 embryos with a Ret riboprobe. Although a normal number and arrangement of Ret-positive UB tips (arrows) were observed in the kidneys of Ret9 homozygous embryos, there were very few Ret-positive UB tips visible in the Ret9-Y1062F kidneys, reflecting a severe deficiency in UB branching. a, adrenal glands; k, kidneys; sg, sympathetic ganglia; ub, ureteric buds.

The failure of kidney formation in Ret null mice is due to reduced growth and branching of the ureteric bud (UB), which depends on mesenchyme-derived GDNF (38, 41, 42). To examine whether the absence of pY1062 signaling also results in the failure of UB branching, we compared the numbers of UB tips between wild-type, Ret9, and Ret9-Y1062F homozygous embryos (E12.5 to E13.5) by in situ hybridization histochemistry with a Ret-specific riboprobe. This analysis showed that the number of Ret-positive branches was dramatically reduced in Ret9-Y1062F/9-Y1062F embryos (Fig. 3, compare panel I to panels G and H). We conclude that pY1062 signaling is necessary for Ret9 to mediate the growth and branching of the UB during embryogenesis in response to mesenchyme-derived GDNF.

pY1062 in Ret9 is required for normal development of the mammalian ENS.

The second abnormality observed in all homozygous Ret9-Y1062F pups was the absence of milk from the intestine (not shown), indicating a defect in gastrointestinal peristalsis. As Ret plays a critical role in ENS development (13, 40, 49), we performed a histological analysis of the gut from newborn Ret9/9 and Ret9-Y1062F/9-Y1062F animals. Enteric ganglia were present at the level of the cardiac stomach but severely reduced in more caudal gastric regions and throughout the intestine of Ret9-Y1062F homozygotes (data not shown). These findings were confirmed using molecular markers specific for enteric ganglia. Thus, in situ hybridization for Ret or Scg10 (a neuron-specific gene) (52) revealed a large number of enteric ganglia in the gut wall of Ret9/9 perinatal animals (Fig. 4A and data not shown), while none were observed in the intestinal wall of Ret9-Y1062F homozygotes (Fig. 4B and data not shown). This severe phenotype, which is similar to that observed in Ret null mice (40), was observed in all homozygous embryos analyzed at this stage (n = 5). Therefore, in the absence of pY1062 signaling, Ret9 is unable to support ENS formation throughout the intestinal wall.

FIG. 4.

FIG. 4.

Signaling by pY1062 is necessary for normal ENS development. (A to D) Fresh frozen sections from E18.5 (A and B) and E13.5 (C and D) embryos homozygous for the Ret9 (A and C) or the Ret9-Y1062F (B and D) alleles were hybridized with a Ret-specific riboprobe. Although a large number of Ret-expressing cells were detected in the gut of Ret9/9 embryos at both stages analyzed, no Ret-expressing cells were detected in the gut of Ret9-Y1062F homozygous animals at any of the stages analyzed. Arrows in panels A to D indicate the positions of the muscle layers of the gut where ENS ganglia form. Identical results were obtained using the Phox2B and Sox10 riboprobes. (E and F) Whole-mount immunostaining with the TuJ1 antibody of guts from Ret9 (E) and Ret9-Y1062F (F) homozygous E11.5 embryos. TuJ1-positive cells were absent from the distal stomach and the small intestine of Ret9-Y1062F homozygous embryos. c, cecum; li, large intestine; s, stomach; si, small intestine.

In the absence of Ret function, the embryonic gut is not colonized by neural crest cells and their derivatives (13, 30, 49). To determine whether pY1062 signaling is necessary for the colonization of gut by neural crest cells, we analyzed the gut at E12.5 to E13.5 of mouse embryos for expression of several molecular markers of ENS progenitors (such as Ret, Phox2b, and Scg10) (20, 34, 52). As expected, a large number of cells expressing these markers were present in the characteristic ring-like arrangement along the entire length of the gastrointestinal tract of wild-type, Ret9/9, and Ret+/9-Y1062F embryos (Fig. 4C and data not shown). In contrast, no Ret+, Phox2B+, or Scg10+ cells were observed in the distal stomach or throughout the intestine of Ret9-Y1062F homozygous embryos (Fig. 4D and data not shown), suggesting that neural crest cells failed to colonize the embryonic gut. This suggestion was further examined by analyzing E11.0 to E11.5 embryos by whole-mount immunostaining with a neuron-specific (TuJ1) antibody. At this stage, a large number of TuJ1-positive cells were present in the stomach and most of the small intestine of wild-type and Ret9/9 embryos, consistent with the apparently normal development of the ENS in Ret9/9 animals (Fig. 4E). However, in Ret9-Y1062F/9-Y1062F embryos, TuJ1-positive cells were observed only in the stomach and were absent from the anlage of both the small and large intestines (Fig. 4F). Taken together, these data indicate that the Ret9-Y1062F mutation results in the failure of neural crest cells to colonize the anlage of the stomach and the intestine, resulting in total intestinal aganglionosis that is indistinguishable from that of Ret null embryos. Therefore, pY1062 signaling, in the context of Ret9, is required from the earliest stages of enteric neurogenesis.

Generation and analysis of Ret51-RI mutant mice.

Having established the importance of Y1062 for Ret9 signaling, we next tested the hypothesis that the impaired function of Ret51 is due to the effects of isoform-specific sequences flanking Y1062, which may influence the binding of critical signaling factors to this phosphotyrosine. For example, due to the sequence divergence of Ret9 and Ret51 beginning at residue 1064, the SH2 domain of Shc can bind to pY1062 of Ret9 but not Ret51, while the PTB domain of Shc can bind to both isoforms (24, 28, 31). It was therefore possible that the functional differences between Ret9 and Ret51 could result, partly or wholly, from the alternative modes of binding to pY1062 of adaptor proteins and their subsequent effects on downstream signaling events. To investigate this possibility, we generated mice carrying a modified allele, Ret51-RI, in which the M1064 and S1065 residues of Ret51 were replaced by the corresponding amino acids of Ret9 (R1064 and I1065). This was expected to extend the homology of Ret51 to Ret9 by 2 amino acid residues and generate a variant of Ret51 (Ret51-RI) in which pY1062 was embedded in similar flanking sequences (Fig. 1B).

Ret51-RI heterozygotes were intercrossed to produce homozygous offspring, which were born in Mendelian proportions (wild type, 11; Ret51-RI heterozygotes, 26; Ret51-RI homozygotes, 16). To determine whether the modification of Ret51 had altered its ability to support ENS development, we examined the gastrointestinal tracts of Ret51-RI and Ret51 mice by staining with TuJ1 antibody at E13.5 (Fig. 5A and B) and for acetylcholinesterase at day P0 (Fig. 5C and D). Like the Ret51 homozygotes (12), all Ret51-RI homozygotes had aganglionosis of the distal portion of the colon. Measurements of the length of the aganglionic segment suggested that the Ret51-RI mutants might be somewhat less severely affected on average than the Ret51 mutants. However, the transition from normal to aganglionic colon was not always clear-cut, making the quantification of the phenotype inconclusive (data not shown).

FIG. 5.

FIG. 5.

Enteric nervous system defects in Ret51-RI mutant mice. (A) Gut of E13.5 wild-type embryo stained with antibody against the neuronal marker TuJ1. Si, small intestine; Ce, cecum; Li, large intestine. (B) Gut of homozygous Ret51-RI E13.5 embryo stained with anti-TuJ1. Note the absence of neurons in the distal large intestine. (C and D) Distal large intestine of heterozygous (C) and homozygous (D) Ret51-RI newborn mice stained for acetylcholinesterase. In the mutant, the distal large intestine lacks a normal pattern of enteric neurons and only extrinsic nerve fibers are present. a, anus. Black stripes indicate a 1-mm ruler.

To examine the effects of the Ret51-RI amino acid substitutions on the development of the excretory system, the kidneys of Ret51 and miRet51-RI homozygotes were compared at P1. No instances of renal agenesis were observed in either case. However, like the kidneys of Ret51 mutant mice (12), those of miRet51-RI mutants were small and frequently showed histological abnormalities, including cysts and a reduced number of glomeruli (Fig. 6A to D). To compare quantitatively the extent of renal development in Ret51 and Ret51-RI mice, the kidneys were photographed and their cross-sectional areas were measured. The kidneys of Ret51-RI homozygotes (average size, 2.29 ± 0.53 mm2) were significantly larger (P = 0.002) than those of Ret51 homozygotes (1.76 ± 0.95 mm2), although still much smaller than those of control mice (5.05 ± 0.8 mm2) (Fig. 6E). We conclude that although the M1064R S1065I double amino acid substitution results in a modest improvement in the ability of Ret51 to support kidney development, it does not fully rescue the deficiency of the Ret51 isoform.

FIG.6.

FIG.6.

Partial correction of renal hypoplasia in Ret51-RI compared to Ret51 mutant mice. (A and B) Kidneys of wild-type (A) and homozygous Ret51-RI (B) newborn mice. Scale bars, 1 mm. (C) Hematoxylin and eosin-stained section of a wild-type newborn kidney, with well-organized medulla (m), cortex (c), and peripheral nephrogenic zone (n). (D) Sections of two kidneys from a Ret51-RI P1 mouse. Note the reduced size, reduced number of glomeruli (arrows), dilated and cystic tubules (asterisks), and absence of normal nephrogenic zone, features similar to those of Ret51 mutant kidneys (11) (data not shown). Panels C and D are at the same magnification. (E) Distribution of kidney sizes (cross-sectional area) in wild-type, Ret51, and Ret51-RI mutant newborn mice. Ret51 mice were on a mixed C57BL/6J and 129 genetic background. Some Ret51-RI mice were on a similar mixed background, and some were on an inbred 129S1 background; however, there was no significant difference in Ret51-RI mutant kidney sizes between the inbred and mixed backgrounds (two-sample t test assuming unequal variance), so the data were combined.

Generation and analysis of Ret9-F1072A mutant mice.

To test the importance of the carboxy-terminal residue F1072 of Ret9 for the in vivo activity of this isoform, we generated monoisoformic Ret9 mice with the amino acid substitution F1072A (Ret9-F1072A) (Fig. 1B). The presence of the F1072A mutation in the mutant mice was confirmed by amplifying and sequencing this region of the targeted Ret allele from mouse genomic DNA (data not shown). Ret9-F1072A heterozygotes were intercrossed to produce homozygotes, which were born in the expected proportions (wild-type, 19; Ret9-F1072A heterozygotes, 42; Ret9-F1072A homozygotes, 19). Ret9-F1072A homozygotes appeared normal in size, morphology, behavior, and fertility, and no significant mortality was observed, on either a mixed (129S1 and C57BL/6J) or an inbred (129S1) background. Furthermore, staining of the intestines of newborn mice for acetylcholinesterase revealed nodefects in the ENS (Fig. 7A and B), and the kidneys were normal in size and histology (Fig. 7C to G).

FIG. 7.

FIG. 7.

Normal kidneys and enteric nervous system in homozygous Ret9-F1072A mutant mice. (A and B) Distal large intestine from newborn wild-type (A) and mutant (B) mice stained for acetylcholinesterase. (C and D) Kidneys of newborn wild-type (C) and mutant (D) mice. (E and F) Sections of wild-type and mutant newborn kidneys stained with hematoxylin and eosin. (G) Similar distributions of kidney sizes in wild-type, heterozygous, and homozygous mutant newborn mice.

DISCUSSION

Several studies have established that signaling by the receptor tyrosine kinase Ret in response to GDNF family ligands plays a critical role in the development of the excretory and nervous systems (1, 37, 42, 45). Furthermore, it has been previously demonstrated that the two major isoforms, Ret9 and Ret51, are differentially required during embryonic development (12, 46). Here we address the basis for the distinct activities of Ret9 and Ret51 by generating mice bearing three new alleles of Ret. The Ret9-Y1062F mutation, which results in a Y1062F substitution, drastically reduces the ability of this isoform to support development of both the excretory and the enteric nervous systems, demonstrating that, in the context of Ret9, Y1062 performs an essential function in vivo. However, the Ret51-RI mutation, in which 2 amino acids of Ret51 close to Y1062 (M1064R and S1065I) were altered to match the corresponding amino acids of Ret9, failed to confer on Ret51 the ability to support normal renal and ENS development. This indicates that the critical difference between Ret9 and Ret51 lies in more distal carboxy-terminal sequences. The Ret9-F1072A mutation, however, which removes a carboxy-terminal PDZ domain-binding motif specific to Ret9, had no apparent effect on the function of this isoform. Together, these results help to delimit the sequences that are important for signaling by the Ret9 and Ret51 isoforms in vivo.

Role of Y1062 in signaling by Ret9 and Ret51 isoforms.

pY1062 serves as a docking site for several phosphotyrosine-binding proteins that can activate both the MAPK and the PI3K pathways (3, 6, 19, 22, 23, 26-28). The Y1062F substitution, in addition to blocking the binding of these signaling proteins in vitro, abolished the transforming activity of oncogenic forms of both Ret isoforms in cell culture assays (4, 11). Here, we show that, unlike its wild-type counterpart, a mutant Ret9 bearing the Y1062F substitution is unable to support normal development of the kidney and the ENS, leading to perinatal lethality.

It is informative to compare our results to those of Jijiwa and colleagues, who have introduced the same mutation into exon 19 of the wild-type locus, thus generating mice that express both Ret9 and Ret51 isoforms bearing the Y1062F substitution (a strain we will call Ret9,51-Y1062F to distinguish from the Ret9-Y1062F animals described here) (26). Ret9,51-Y1062F homozygotes survived for several weeks after birth and displayed defects considerably milder than those in Ret9-Y1062F mice. For example, unlike the kidneys of Ret9-Y1062F mice, those of Ret9,51-Y1062F animals were reduced in size and weight by approximately only 50% relative to controls and displayed a relatively normal histoarchitecture. In addition, Ret9,51-Y1062F animals also showed various degrees of colonization of the small and large intestine by enteric neurons, in contrast to the total absence of enteric ganglia from the entire intestinal wall of Ret9-Y1062F mice. Interestingly, the effects of the Ret9,51-Y1062F mutation are more similar to those we previously observed in monoisoformic Ret51 mice expressing only wild-type Ret51 (12). This observation suggests that, contrary to its role in the Ret9 isoform, in the context of Ret51, Y1062 has a relatively minor signaling role. Based on this idea, the similar phenotypes of the Ret51 and Ret9,51-Y1062F strains reflect the residual activity of the Ret51 isoform, which is likely to be due to another tyrosine residue, Y1096, which upon phosphorylation is known to activate the PI3K/Akt signaling pathway. This interpretation is supported by recent studies of Degl'Innocenti and colleagues, who used assays involving scattering or branching of cultured cells in response to GDNF or neurturin to examine the role of Y1062 and Y1096 in the function of the two Ret isoforms (11). These authors found that both Ret9 and Ret51 were active in these assays and that the Y1062F substitution abolished the activity of Ret9 but had little or no effect on the activity of Ret51. While mutation of Y1096 in Ret51 also had little or no effect, mutation of both tyrosines eliminated all activity (11). Grb2 is the only signal-transducing protein known to bind directly to Y1096, and dominant negative Grb2 caused a reduction in the induction of scattering or branching by either isoform (11). Binding of Grb2 at Y1096 can activate PI3K/Akt (via Gab adapter proteins), although Y1096 has little or no ability to activate the Ras/Erk pathway (6, 22). It is therefore likely that Y1096 of Ret51 can partially compensate for the Ret51-Y1062F substitution through its ability to activate PI3K/Akt, while Ret9 lacks a motif that can compensate for the Ret9-Y1062F mutation, which eliminates both MAPK and PI3K/Akt activation.

Models for the differing activities of Ret9 and Ret51 in vivo.

In most cell culture assays that have been employed, such as transformation of NIH 3T3 cells by activated forms of Ret and induction of scattering or branching of epithelial cells in response to GDNF, Ret9 and Ret51 have comparable activities (4, 8, 11). However, Ret51 is clearly deficient in its ability to support kidney and ENS development in vivo, while Ret9 is both necessary and sufficient (12). Two specific hypotheses could account for this difference. The first suggests that the altered binding of adaptor proteins to the Y1062 docking site, whose sequence context differs between Ret9 and Ret51, results in different signaling activities for the two isoforms. One such protein is Shc, which binds pY residues through either its PTB or SH2 domain. Upon binding, activated Shc recruits the Grb2/Sos complex, which activates the Ras/MAPK pathway and leads to mitogenesis and transformation, and it also recruits Gab1/2, which results in activation of the PI3 kinase signaling (6, 29). Both Ret9 and Ret51 have a binding site for the Shc PTB domain N-terminal to Y1062, but due to alternative splicing only Ret9 has a C-terminal Shc SH2 binding site (Fig. 1B). As a consequence, the Shc SH2 domain associates specifically with Ret9, while Ret51 has a higher affinity than Ret9 for the Shc PTB domain (28, 31). Therefore, it was possible that the alternative modes of Shc binding to pY1062 of Ret9 and Ret51 affected downstream signaling events that could be responsible for the different developmental functions of the two isoforms. However, we found that changing amino acids M1064 and S1065 of Ret51 to match the sequence of Ret9 (R1064 and I1065) had only a minimal effect on the ability of Ret51 to support development. The kidneys of Ret51-RI homozygous mice were hypodysplastic and only marginally larger than those of Ret51 animals, and there was no clearly discernible improvement in ENS development. At this point it is unclear whether the Ret51-RI isoform we have generated can bind in vivo Shc in a manner similar to that of Ret9. If this were the case, our data would argue that the different modes of binding of Shc to pY1062 of Ret9 and Ret51 may account for, at most, only a fraction of the difference in activity of the two isoforms in supporting in vivo development. Alternatively, it is possible that other proteins that also bind to the Y1062 region of Ret9 and Ret51 could in principle mediate some of the functional differences of the Ret isoforms. Among them is the PDZ-LIM protein Enigma which binds to the Y1062 area of Ret9 in a phosphorylation-independent manner (7, 14, 15) and requires the sequence R1064 I1065 S1066, which is absent in Ret51. Therefore, our Ret51-RI allele is unsuitable to test conclusively the potential role of Enigma in the differential activities of Ret isoforms. Conclusive evidence for a role of Shc and Enigma binding to the Y1062 docking site in the differential activities of Ret9 and Ret51 will require additional experimentation.

We also tested the hypothesis that the ability of the C terminus of Ret9, but not Ret51, to bind to the PDZ domain protein Shank3 accounts for the in vivo functional differences between the Ret isoforms. This suggestion is based on the recent finding that the ability of Ret9 to induce formation of branched tubules by MDCK cells, in response to GDNF and soluble Gfrα1, depended on its capacity to bind Shank3 (43). Thus, mutating the C-terminal phenylalanine of Ret9 (F1072A) blocked its binding to Shank3 and eliminated the activity of Ret9 in the MDCK cell-branching assay. Ret51, which does not contain the Shank binding site, was inactive in this assay under the conditions employed, but addition of the Shank3 binding motif (FTRF) to its C terminus endowed it with the ability to induce branched tubules (43). Therefore, the preferential binding of Shank3 to Ret9, which apparently leads to sustained Erk-MAPK and PI3K signaling, might account for the crucial role of this isoform during kidney and ENS development. However, we found that mice homozygous for Ret9-F1072A, expressing only Ret9 bearing the same F1072A amino acid substitution, were apparently normal. The mutation had no effect on kidney size or histology or on formation of the ENS. While we cannot rule out the possibility that the Ret9-F1072A mice have subtle abnormalities that have not yet been detected, our finding indicates that the differences observed by Shuetz et al. (43) between Ret9 and Ret51 in the MDCK cell assay, and the requirement for a Shank3 binding motif in Ret9, cannot account for the major biological differences between the two isoforms in vivo.

Several hypotheses that may account for the functional differences between Ret9 and Ret51 in vivo remain to be tested. First, other signaling proteins that can bind to pY1062 of Ret9 may interact differently with pY1062 of Ret51 in a manner that is influenced by amino acids C-terminal to reside 1064 and thus not corrected by the Ret51-RI mutation. One such protein may be Enigma, as discussed above (7, 14, 15). Second, the 6 amino acids in the 9-amino-acid Ret9 tail that have not yet been examined by mutagenesis (1066-SHAFTR-1071) may have a positive function yet to be discovered. Third, the long C-terminal tail of Ret51 may have an inhibitory activity on the function of Y1062. The fourth explanation is based on the recent observation that Ret51 has a threefold-shorter half-life than Ret9 in a motor neuron cell line, due to its increased association with the ubiquitin ligase Cbl (44). While Cbl can interact with pY1062 of both Ret9 and Ret51 through Grb2 and Shc, it can also interact via Grb2 with pY1096 of Ret51, which may account for the increased association with, and ubiquitylation of, this isoform (44). The resulting relative instability of Ret51, if it occurs in vivo, might be enough to explain the reduced ability of the Ret51 allele to support development. A prediction of this model is that a mutant form of Ret51 which includes Y1062, but lacks Y1096, might be as stable as Ret9 and capable of supporting normal development in the absence of Ret9. The generation of animals carrying a Ret51-Y1096F mutation will address this possibility directly.

Acknowledgments

We thank Sarah Clayton for technical assistance.

This work was supported by the Medical Research Council and a National Institutes of Health grant (CA23767) to F.C. and V.P. S.B. was a recipient of a grant from Telethon.

REFERENCES

  • 1.Airaksinen, M. S., and M. Saarma. 2002. The GDNF family: signalling, biological functions and therapeutic value. Nat. Rev. Neurosci. 3:383-394. [DOI] [PubMed] [Google Scholar]
  • 2.Airaksinen, M. S., A. Titievsky, and M. Saarma. 1999. GDNF family neurotrophic factor signaling: four masters, one servant? Mol. Cell. Neurosci. 13:313-325. [DOI] [PubMed] [Google Scholar]
  • 3.Arighi, E., L. Alberti, F. Torriti, S. Ghizzoni, M. G. Rizzetti, G. Pelicci, B. Pasini, I. Bongarzone, C. Piutti, M. A. Pierotti, and M. G. Borrello. 1997. Identification of Shc docking site on Ret tyrosine kinase. Oncogene 14: 773-782. [DOI] [PubMed] [Google Scholar]
  • 4.Asai, N., H. Murakami, T. Iwashita, and M. Takahashi. 1996. A mutation at tyrosine 1062 in MEN2A-Ret and MEN2B-Ret impairs their transforming activity and association with shc adaptor proteins. J. Biol. Chem. 271: 17644-17649. [DOI] [PubMed] [Google Scholar]
  • 5.Baloh, R. H., H. Enomoto, E. M. Johnson, Jr., and J. Milbrandt. 2000. The GDNF family ligands and receptors—implications for neural development. Curr. Opin. Neurobiol 10:103-110. [DOI] [PubMed] [Google Scholar]
  • 6.Besset, V., R. P. Scott, and C. F. Ibanez. 2000. Signaling complexes and protein-protein interactions involved in the activation of the ras and phosphatidylinositol 3-kinase pathways by the c-Ret receptor tyrosine kinase. J. Biol. Chem. 275:39159-39166. [DOI] [PubMed] [Google Scholar]
  • 7.Borrello, M. G., E. Mercalli, C. Perego, D. Degl'Innocenti, S. Ghizzoni, E. Arighi, B. Eroini, M. G. Rizzetti, and M. A. Pierotti. 2002. Differential interaction of Enigma protein with the two RET isoforms. Biochem. Biophys. Res. Commun. 296:515-522. [DOI] [PubMed] [Google Scholar]
  • 8.Borrello, M. G., D. P. Smith, B. Pasini, I. Bongarzone, A. Greco, M. J. Lorenzo, E. Arighi, C. Miranda, C. Eng, L. Alberti, et al. 1995. RET activation by germline MEN2A and MEN2B mutations. Oncogene 11: 2419-2427. [PubMed] [Google Scholar]
  • 9.Carrasquillo, M. M., A. S. McCallion, E. G. Puffenberger, C. S. Kashuk, N. Nouri, and A. Chakravarti. 2002. Genome-wide association study and mouse model identify interaction between RET and EDNRB pathways in Hirschsprung disease. Nat. Genet. 32:237-244. [DOI] [PubMed] [Google Scholar]
  • 10.Chakravarti, A. L. S. 2001. Hirschsprung's disease, p. 6231-6255. In C. R. Scriver, A. L. Beaudet, D. Valle, W. S. Sly, B. Childs, K. Kinzler, and B. Vogelstein (ed.), The metabolic and molecular bases of inherited diseases, 8th ed. McGraw-Hill, New York, N.Y.
  • 11.Degl'Innocenti, D., E. Arighi, A. Popsueva, R. Sangregorio, L. Alberti, M. G. Rizzetti, C. Ferrario, H. Sariola, M. A. Pierotti, M. G. Borrello, F. Torriti, S. Ghizzoni, G. Pelicci, B. Pasini, I. Bongarzone, and C. Piutti. 2004. Differential requirement of Tyr1062 multidocking site by RET isoforms to promote neural cell scattering and epithelial cell branching. Oncogene 23: 7297-7309. [DOI] [PubMed] [Google Scholar]
  • 12.de Graaff, E., S. Srinivas, C. Kilkenny, V. D'Agati, B. S. Mankoo, F. Costantini, and V. Pachnis. 2001. Differential activities of the RET tyrosine kinase receptor isoforms during mammalian embryogenesis. Genes Dev. 15: 2433-2444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Durbec, P. L., L. B. Larsson-Blomberg, A. Schuchardt, F. Costantini, and V. Pachnis. 1996. Common origin and developmental dependence on c-ret of subsets of enteric and sympathetic neuroblasts. Development 122:349-358. [DOI] [PubMed] [Google Scholar]
  • 14.Durick, K., G. N. Gill, S. S. Taylor, and R. Y. Wu. 1998. Shc and Enigma are both required for mitogenic signaling by Ret/ptc2. Mitogenic signaling by Ret/ptc2 requires association with enigma via a LIM domain. Mol. Cell. Biol. 18:2298-2308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Durick, K., R. Y. Wu, G. N. Gill, and S. S. Taylor. 1996. Mitogenic signaling by Ret/ptc2 requires association with enigma via a LIM domain. J. Biol. Chem. 271:12691-12694. [DOI] [PubMed] [Google Scholar]
  • 16.Enomoto, H., T. Araki, A. Jackman, R. O. Heuckeroth, W. D. Snider, E. M. Johnson, Jr., and J. Milbrandt. 1998. GFR alpha1-deficient mice have deficits in the enteric nervous system and kidneys. Neuron 21:317-324. [DOI] [PubMed] [Google Scholar]
  • 17.Enomoto, H., P. A. Crawford, A. Gorodinsky, R. O. Heuckeroth, E. M. Johnson, Jr., and J. Milbrandt. 2001. RET signaling is essential for migration, axonal growth and axon guidance of developing sympathetic neurons. Development 128:3963-3974. [DOI] [PubMed] [Google Scholar]
  • 18.Fukuda, T., K. Kiuchi, and M. Takahashi. 2002. Novel mechanism of regulation of Rac activity and lamellipodia formation by RET tyrosine kinase. J. Biol. Chem. 277:19114-19121. [DOI] [PubMed] [Google Scholar]
  • 19.Grimm, J., M. Sachs, S. Britsch, S. Di Cesare, T. Schwarz-Romond, K. Alitalo, and W. Birchmeier. 2001. Novel p62dok family members, dok-4 and dok-5, are substrates of the c-Ret receptor tyrosine kinase and mediate neuronal differentiation. J. Cell Biol. 154:345-354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hannan, A. J., R. C. Henke, R. P. Weinberger, J. W. Sentry, and P. L. Jeffrey. 1996. Differential induction and intracellular localization of SCG10 messenger RNA is associated with neuronal differentiation. Neuroscience 72: 889-900. [DOI] [PubMed] [Google Scholar]
  • 21.Hansford, J. R., and L. M. Mulligan. 2000. Multiple endocrine neoplasia type 2 and RET: from neoplasia to neurogenesis. J. Med. Genet. 37:817-827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hayashi, H., M. Ichihara, T. Iwashita, H. Murakami, Y. Shimono, K. Kawai, K. Kurokawa, Y. Murakumo, T. Imai, H. Funahashi, A. Nakao, and M. Takahashi. 2000. Characterization of intracellular signals via tyrosine 1062 in RET activated by glial cell line-derived neurotrophic factor. Oncogene 19:4469-4475. [DOI] [PubMed] [Google Scholar]
  • 23.Ichihara, M., Y. Murakumo, and M. Takahashi. 2004. RET and neuroendocrine tumors. Cancer Lett. 204:197-211. [DOI] [PubMed] [Google Scholar]
  • 24.Ishiguro, Y., T. Iwashita, H. Murakami, N. Asai, K. Iida, H. Goto, T. Hayakawa, and M. Takahashi. 1999. The role of amino acids surrounding tyrosine 1062 in ret in specific binding of the shc phosphotyrosine-binding domain. Endocrinology 140:3992-3998. [DOI] [PubMed] [Google Scholar]
  • 25.Jhiang, S. M. 2000. The RET proto-oncogene in human cancers. Oncogene 19:5590-5597. [DOI] [PubMed] [Google Scholar]
  • 26.Jijiwa, M., T. Fukuda, K. Kawai, A. Nakamura, K. Kurokawa, Y. Murakumo, M. Ichihara, and M. Takahashi. 2004. A targeting mutation of tyrosine 1062 in Ret causes a marked decrease of enteric neurons and renal hypoplasia. Mol. Cell. Biol. 24:8026-8036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kurokawa, K., T. Iwashita, H. Murakami, H. Hayashi, K. Kawai, and M. Takahashi. 2001. Identification of SNT/FRS2 docking site on RET receptor tyrosine kinase and its role for signal transduction. Oncogene 20:1929-1938. [DOI] [PubMed] [Google Scholar]
  • 28.Lorenzo, M. J., G. D. Gish, C. Houghton, T. J. Stonehouse, T. Pawson, B. A. Ponder, and D. P. Smith. 1997. RET alternate splicing influences the interaction of activated RET with the SH2 and PTB domains of Shc, and the SH2 domain of Grb2. Oncogene 14:763-771. [DOI] [PubMed] [Google Scholar]
  • 29.Margolis, B., J. P. Borg, S. Straight, and D. Meyer. 1999. The function of PTB domain proteins. Kidney Int. 56:1230-1237. [DOI] [PubMed] [Google Scholar]
  • 30.Natarajan, D., C. Marcos-Gutierrez, V. Pachnis, and E. De Graaff. 2002. Requirement of signalling by receptor tyrosine kinase RET for the directed migration of enteric nervous system progenitor cells during mammalian embryogenesis. Development 129:5151-5160. [DOI] [PubMed] [Google Scholar]
  • 31.Ohiwa, M., H. Murakami, T. Iwashita, N. Asai, Y. Iwata, T. Imai, H. Funahashi, H. Takagi, and M. Takahashi. 1997. Characterization of Ret-Shc-Grb2 complex induced by GDNF, MEN 2A, and MEN 2B mutations. Biochem. Biophys. Res. Commun. 237:747-751. [DOI] [PubMed] [Google Scholar]
  • 32.Pachnis, V., B. Mankoo, and F. Costantini. 1993. Expression of the c-ret proto-oncogene during mouse embryogenesis. Development 119:1005-1017. [DOI] [PubMed] [Google Scholar]
  • 33.Parisi, M. A., and R. P. Kapur. 2000. Genetics of Hirschsprung disease. Curr. Opin. Pediatr. 12:610-617. [DOI] [PubMed] [Google Scholar]
  • 34.Pattyn, A., X. Morin, H. Cremer, C. Goridis, and J. F. Brunet. 1999. The homeobox gene Phox2b is essential for the development of autonomic neural crest derivatives. Nature 399:366-370. [DOI] [PubMed] [Google Scholar]
  • 35.Ponder, B. A., and D. Smith. 1996. The MEN II syndromes and the role of the ret proto-oncogene. Adv. Cancer Res. 70:179-222. [DOI] [PubMed] [Google Scholar]
  • 36.Santoro, M., F. Carlomagno, R. M. Melillo, and A. Fusco. 2004. Dysfunction of the RET receptor in human cancer. Cell. Mol. Life Sci. 61:2954-2964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Sariola, H., and M. Saarma. 2003. Novel functions and signalling pathways for GDNF. J. Cell Sci. 116:3855-3862. [DOI] [PubMed] [Google Scholar]
  • 38.Sariola, H., and K. Sainio. 1997. The tip-top branching ureter. Curr. Opin. Cell Biol. 9:877-884. [DOI] [PubMed] [Google Scholar]
  • 39.Schlessinger, J. 2000. Cell signaling by receptor tyrosine kinases. Cell 103:211-225. [DOI] [PubMed] [Google Scholar]
  • 40.Schuchardt, A., V. D'Agati, L. Larsson-Blomberg, F. Costantini, and V. Pachnis. 1994. Defects in the kidney and enteric nervous system of mice lacking the tyrosine kinase receptor Ret. Nature 367:380-383. [DOI] [PubMed] [Google Scholar]
  • 41.Schuchardt, A., V. D'Agati, L. Larsson-Blomberg, F. Costantini, and V. Pachnis. 1995. RET-deficient mice: an animal model for Hirschsprung's disease and renal agenesis. J. Intern. Med. 238:327-332. [DOI] [PubMed] [Google Scholar]
  • 42.Schuchardt, A., V. D'Agati, V. Pachnis, and F. Costantini. 1996. Renal agenesis and hypodysplasia in ret-k- mutant mice result from defects in ureteric bud development. Development 122:1919-1929. [DOI] [PubMed] [Google Scholar]
  • 43.Schuetz, G., M. Rosario, J. Grimm, T. M. Boeckers, E. D. Gundelfinger, and W. Birchmeier. 2004. The neuronal scaffold protein Shank3 mediates signaling and biological function of the receptor tyrosine kinase Ret in epithelial cells. J. Cell Biol. 167:945-952. (First published 29 November 2004; 10.1083/jcb.200404108.) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Scott, R. P., S. Eketjall, H. Aineskog, and C. F. Ibanez. 2005. Distinct turnover of alternatively spliced isoforms of the RET kinase receptor mediated by differential recruitment of the Cbl ubiquitin ligase. J. Biol. Chem. 280:13442-13449. (First published 27 January 2005.) [DOI] [PubMed] [Google Scholar]
  • 45.Shakya, R., T. Watanabe, and F. Costantini. 2005. The role of GDNF/Ret signaling in ureteric bud cell fate and branching morphogenesis. Dev. Cell 8:65-74. [DOI] [PubMed] [Google Scholar]
  • 46.Srinivas, S., Z. Wu, C. M. Chen, V. D'Agati, and F. Costantini. 1999. Dominant effects of RET receptor misexpression and ligand-independent RET signaling on ureteric bud development. Development 126:1375-1386. [DOI] [PubMed] [Google Scholar]
  • 47.Tahira, T., Y. Ishizaka, F. Itoh, T. Sugimura, and M. Nagao. 1990. Characterization of ret proto-oncogene mRNAs encoding two isoforms of the protein product in a human neuroblastoma cell line. Oncogene 5:97-102. [PubMed] [Google Scholar]
  • 48.Takahashi, M. 2001. The GDNF/RET signaling pathway and human diseases. Cytokine Growth Factor Rev. 12:361-373. [DOI] [PubMed] [Google Scholar]
  • 49.Taraviras, S., C. V. Marcos-Gutierrez, P. Durbec, H. Jani, M. Grigoriou, M. Sukumaran, L. C. Wang, M. Hynes, G. Raisman, and V. Pachnis. 1999. Signalling by the RET receptor tyrosine kinase and its role in the development of the mammalian enteric nervous system. Development 126: 2785-2797. [DOI] [PubMed] [Google Scholar]
  • 50.Taraviras, S., and V. Pachnis. 1999. Development of the mammalian enteric nervous system. Curr. Opin. Genet. Dev. 9:321-327. [DOI] [PubMed] [Google Scholar]
  • 51.van Weering, D. H., and J. L. Bos. 1998. Signal transduction by the receptor tyrosine kinase Ret. Recent Results Cancer Res. 154:271-281. [DOI] [PubMed] [Google Scholar]
  • 52.Wuenschell, C. W., N. Mori, and D. J. Anderson. 1990. Analysis of SCG10 gene expression in transgenic mice reveals that neural specificity is achieved through selective derepression. Neuron 4:595-602. [DOI] [PubMed] [Google Scholar]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES