Germacrone Ameliorates Diabetic Kidney Disease by Activating TFEB to Promote Autophagy and Inhibit Inflammation

Abstract

Diabetic kidney disease (DKD) is widely recognized as the primary cause of end-stage renal disease (ESRD). Activating autophagy is considered a key strategy to improve DKD. Here, through luciferase reporter gene screening of several sesquiterpenoids, it was found that germacrone (GER) significantly activated the transcription factor EB (TFEB), and its effect on DKD and the underlying molecular mechanism was investigated. GER significantly improved renal function impairment and alleviated renal pathological damage. GER inhibited NLR family pyrin domain containing 3 (NLRP3)-mediated inflammatory responses both in vitro and in vivo. Mechanistically, GER activated TFEB to promote autophagy and clear NLRP3 inflammasomes, and the GER-mediated degradation of NLRP3 was reversed by the autophagy inhibitor chloroquine (CQ). Additionally, GER did not affect the expression of TFEB protein but increased its expression in the nucleus. This effect was attributed to the dephosphorylation of p-TFEB (S122) protein caused by the activation of protein phosphatase 2A (PP2A) by GER. This result was further confirmed by supplementing with the PP2A inhibitor okadaic acid (OA). Docking results indicated a stable binding between GER and PP2A. These findings highlighted GER as a potential intervention for treating DKD and clarified the underlying mechanism through which it functions by regulating the PP2A-TFEB pathway.

1. Introduction

Diabetic kidney disease (DKD), a chronic renal disorder resulting from diabetes, is the main cause of death among diabetic patients. , The global prevalence of diabetes has reached 347 million people, which is an important reason for the rising incidence of diabetic nephropathy. , Given the increasingly severe prevalence, poor prognosis and huge economic burden of DKD, it has become a major global public health problem. Recent investigations have demonstrated that abnormal glomerular feedback and hypoxia in the renal tubules trigger renal injury in the early stage of DKD. Subsequently, the impairment of renal tubular reabsorption leads to the occurrence of albuminuria, further aggravates DKD through the release of chemotactic and inflammatory factors. The inflammatory response caused by renal tubular injury plays a pivotal role in the main pathological events associated with diabetic renal failure. , Consequently, anti-inflammatory therapy is an imperative priority in managing DKD.

Autophagy, a highly conserved catabolic process, is vital in preserving cellular homeostasis and functionality. , Transcription factor EB (TFEB) functions as the principal regulator of autophagy-lysosomal biogenesis, controlling the expression of autophagy-related genes and multiple various stages of transcriptional activation including lysosome biogenesis, degradation, etc. Additionally, autophagy functions as a stress response under pathological conditions, in which the regulation of TFEB activation is a key factor for autophagy occurrence. Current research primarily focuses on regulating its subcellular localization; specifically, under basal or nutrient-rich conditions, TFEB mainly resides in the cytoplasm and exhibits transcriptional inactivity. However, upon receiving specific signals such as hunger-induced stress, TFEB is released from cytoplasm and actively transported to the nucleus, thereby facilitating the transcription of its target genes and activating autophagy. Several studies have documented the strong correlation between autophagy impairment and the development of diverse kidney diseases, including DKD. More specifically, autophagic dysfunction was been observed in diabetic rats, which was caused by oxidative stress, dysregulated signal transduction of inflammasome, and so on. Furthermore, it has been established that autophagy dysfunction is present in the proximal tubules of individuals with DKD. These discoveries emphasize the potential protective function of autophagy restoration in mitigating various types of renal damage. Autophagy-related proteins have been demonstrated to play a pivotal role in regulating the activation and deactivation of innate immune signals and inflammatory signal transduction pathways. The accumulation of advanced glycosylation end products (AGEs) leads to a reduction in renal autophagy-related protein expression and nuclear transfer of TFEB, resulting in impaired autophagy and lysosome function as well as obstruction of the autophagy pathway in DKD. This accelerates renal cell damage, promotes infiltration of inflammatory cells, and induces phenotypic changes, ultimately leading to increased proteinuria and fibrosis in patients with DKD. Consequently, targeting specific pathways involved in autophagy activation may serve as a crucial therapeutic approach for alleviating renal inflammation and ameliorating tubular injury associated with DKD.

Sesquiterpenes are widely present in various natural medicines, exhibiting a broad spectrum of pharmacological effects encompassing neuroprotection, anti-inflammation, antitumor activity, immune regulation, antioxidation, antibacterial properties as well as hypoglycemic effects. − These attributes have been substantiated through numerous pharmacological and clinical investigations. , In addition, sesquiterpenes have garnered significant attention in the treatment of diabetes due to their potential therapeutic effects. For instance, β-caryophyllene sesquiterpenes exhibit anti-inflammatory properties that are crucial for managing complications associated with diabetes. Artemisinin effectively mitigates insulin resistance, enhances the immune microenvironment, and restores islet cell function, thereby showing promising prospects in treating diabetic complications, particularly diabetic nephropathy. To summarize, sesquiterpenes demonstrates the potential to reverse renal pathological alterations in DKD. However, further investigation is required to establish whether the modulatory effects of sesquiterpenes on inflammation and autophagy contribute to the inhibition of DKD progression. Therefore, the db/db model was employed in this study to assess the amelioration of renal function and pathological damage in DKD mice. Additionally, the study investigated the restoration of autophagy flux disturbances both in vivo and in vitro and elucidated the underlying mechanism involving TFEB.

2. Materials and Methods

2.1. Antibodies and Reagents

Antibody specific for TFEB (ab245350; 1:6000 WB) were purchased from Abcam (UK); Antibody specific for NLRP3 (D4D8T; 1:1000 WB), Caspase-1 (E9R2D; 1:1000 WB), p-TFEB (S122) (E9M5M; 1:1000 WB) were purchased from Cell Signaling Technology (US); Antibody specific for p62 (sc-48402; 1:1000 WB), PPP2R5C (sc-374380) were purchased from Santa Cruz Biotechnology (US); Lamp2 (GB11848; 1:300 IF) was purchased from Service Bio (China); β-actin (20536-1-AP; 1:20000 WB) was purchased from Proteintech (China); Antibody specific for Lamin B (P20700; 1:1000 WB), LC3B (CY5992; 1:1000 WB) were purchased from Abways Technology (China).

The compounds (procurcumadiol, 129673-90-1; (+)-longifolene, 475-20-7) and (okadaic acid, 78111-17-8) (Shanghai Yuan Ye Bio-Technology Co., Ltd., China); (guaiene, 88-84-6)­(Aladdin Bio-Technology Co., Ltd., China); (aerugidiol, 116425-35-5)­(PUSH Bio-Technology Co., Ltd., China); germacrone (GER, Chengdu Must Biotechnology Co., Ltd., China); valsartan (Val, NOVARTIS, Switzerland); DMEM/F12 -Dulbecco’s Modified Eagle Medium, Reduced Serum Medium (OPTI-MEM) and Fetal Bovine Serum (FBS, Gibco, US); AGE-BSA (ab51995, USA); TFEB plasmid was purchased from Promega (USA). Rluc-LC3WT and Rluc-LC3G120A plasmids were gifts from MarjaJããttelã (Addgene plasmid #105003;http://n2t.net/addgene:105003; RRID: Addgene_105003).

2.2. Cell Culture

Human renal tubular epithelial cells (HK-2 cells) were obtained from Procell Life Science & Technology Co., Ltd., ( Wuhan, China). The HK-2 cells were cultured at 37 °C in DMEM/F12K supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin under a humidified atmosphere containing 5% CO₂. The culture medium was refreshed every 2 days to maintain optimal cell growth conditions. The construction of the DKD cell model was induced by using advanced glycation end products (AGEs).

2.3. Luciferase Reporter Assays

The reporter gene firefly luciferase Rluc-LC3^WT/G120A and pTFEB-Luc were transfected into 293T cells. After 24 h of transfection, the cells were incubated with 5, 10, 20 μM GER) was performed. Subsequently, the lytic solution was added to react with the luciferin substrate, the chemiluminescence intensity was measured using microplate reader to assess the activity and expression level of the luciferase reporter gene.

2.4. Cell Viability Assay

HK-2 cells were seeded in 96-well plates and treated with various concentrations of GER for 24 h. After incubation with 5% MTT solution at 37 °C for 4 h, the cells were agitated on a shaker for an additional 10 min following DMSO addition. The absorbance was measured at a wavelength of 450 nm using a micro-ELISA reader (BMG Labtech, Germany).

2.5. Animal Model

The animal experiments utilized 8-week-old male C57BLKS/J ^db/db and C57BLKS/J ^db/m mice, which were obtained from GemPharmatech Co., Ltd., China. The mice were maintained at a temperature of 22 ± 2 °C, and subjected to a 12 h light-dark cycle. The mice were access to water and standard rodent chow ad libitum. After a 7-day adaptation period, the mice were randomly allocated into six groups: db/m groups, db/db groups, db/db + valsartan groups (Val, at a dosage of 10.25 mg/kg), db/db + low-dose GER groups (GER-L, at a dosage of 10 mg/kg), db/db + medium-dose GER groups (at a dosage of 20 mg/kg, GER-M), db/db + high-dose GER groups (GER-H, at a dosage of 40 mg/kg), each consisting of 12 mice. The drug was administered for a duration of 8 weeks in this experimental study. Throughout the entire research process, the physiological parameters of the mice were continuously monitored. Subsequently, the mice were euthanized under urethane-induced anesthesia 24 h after the final administration of anesthesia. Tissue samples were obtained from sedated animals, promptly frozen in liquid nitrogen, and then stored at −80 °C until further analysis. All animal experimental procedures conducted in this study received ethical approval from the Experimental Animal Ethics Committee of the Henan University of Chinese Medicine.

2.6. Biochemical Analyses

Fasting blood glucose levels were assessed. The kidney weight and body weight of mice were recorded, and the kidney weight-to-body weight ratio (KW/BW) was determined. Blood samples were collected and centrifuged to measure blood urea nitrogen (BUN) and serum creatinine (Scr), which served as indicators for renal function evaluation. Urine samples were collected for the detection of urinary creatinine levels in mice, and an Elisa kit (Elabscience Biotechnology Co., Ltd.) was used to quantify urinary albumin levels. The urinary albumin/creatinine ratio (UACR) and urinary albumin excretion rate (UAER) were calculated as the UACR.

2.7. Kidney Histology

The kidneys were fixed in 4% paraformaldehyde for 16 h. Subsequently, the kidney tissue was embedded in paraffin and sliced into sections measuring 4 μm. Following dewaxing with xylene, the structural characteristics of the kidney were observed. The sections underwent staining using H&E, PAS, and Masson techniques were scanned with a scanner (Pannoramic 250FLASH, 3DHISTECH). Glomerular mesangial dilatation was assessed by comparing the area of mesangial dilatation with PAS staining. The degree of renal tubular injury was evaluated by PAS staining. , The renal tubular injury score is assigned based on the degree of damage, including renal tubular dilatation, renal tubular atrophy, vacuole formation, and extracellular matrix accumulation (interstitial volume). It is primarily categorized into five levels (0 = 0%, 1 = 5%, 2 = 5–10%, 3 = 10–20%, 4 = 20–30%, 5 = >30%). The evaluation of collagen area based on Masson staining involved calculating the percentage as follows: collagen area (%) = positive area /total area × 100. Consequently, the extent of glomerular fibrosis was determined.

2.8. Determination of KIM-1 and IL-1β

The levels of KIM1 in serum and IL-1 β in renal tissue were quantified using an Elisa kit (Elabscience Biotechnology Co., Ltd.) to assess renal tubular injury and the expression of inflammatory mediators.

2.9. Molecular Docking

Molecular docking was performed to gain insight into the potential interactions between GER and PP2A. The crystal structure of PP2A was obtained from the Protein Data Bank (PDB, ID: 2JAK). Autodock 4.2, developed by Scripps Institute in La Jolla (California, USA) was employed for virtual screening. Pymol 2.3, provided by Delano Science LLC in San Carlos (USA) was utilized to analyze the docking model meticulously.

2.10. Transmission Electron Microscopy (TEM)

The renal tissue was processed using a 2.5% glutaraldehyde solution for a duration of 4 h, followed by four washes with phosphate-buffered saline (PBS), each lasting 15 min. Subsequently, the tissue was fixed using a 1% acidic solution for 1.5 h. The dehydration process involved repetitive use of different ethanol concentrations. Automated resin processing (Leica, EMTP) was employed for embedding polymerization, while the Leica automatic ultrathin slicer (Leica, EMUC7) was utilized for semithin slice positioning and ultrathin sectioning. Following staining with saturated uranyl acetate solution and lead citrate solution, images were obtained using a transmission electron microscope (JEM-1400). Detailed evaluation of the morphological changes in kidney sections was conducted utilizing the TEM Center of Henan University of Chinese Medicine.

2.11. Immunofluorescence

Renal tissue was subjected to immunofluorescence staining. Paraffin sections were fixed in acetone and ethanol for 20 min, followed by 3 washes with PBS. Subsequently, the sections were treated with a 10% hydrogen peroxide solution and incubated in darkness at room temperature for 5 min. After washing 3 times with PBS, the sections were dried using 20% bovine serum albumin (BSA) for 2 min. Mouse anti-LC3B antibody (BM1, 300:12082, Boster) and Lamp2 antibody (GB1, 150:4, Servicebio) were added to the samples and incubated overnight at 4 °C. This was followed by adding goat antimouse antibody for 5 h. Finally, DAPI was used to stain the nuclei for 40 min before imaging the stained sections under a fluorescence microscope at a magnification of 3 times (Pannoramic 250FLASH, 3DHISTECH).

2.12. Quantitative Real-Time PCR

The renal tissue and cells were subjected to lysis in RNAiso Plus (Takara, Japan) to extract total RNAs following the recommended protocols of the reagent. cDNA was synthesized by Beyort cDNA first strand synthesis kit (Beyotime, China). qPCR was performed using the FastStart Essential DNA Green Master (Roche, Switzerland) and the LightCycler 96 system (Roche, Switzerland). The expression levels of genes were normalized to β-actin, and the mRNA expressions of the respective genes were quantified using the 2 ^–ΔΔCt method. The gene-specific primer pairs used in the experiments are listed in Table .

1. Primer Sequences for qPCR.

species	genes	forward sequences (5′ to 3′)	reverse sequences (5′ to 3′)
mouse sapiens	IL-1β	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG
mouse sapiens	IL-6	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
mouse sapiens	β-actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT
Homo sapiens	KIM1	CCTGTGGATGACTGAGTACCTG	AGCCAGGAGAAATCAAACAGAGG
Homo sapiens	NGAL	CATCTTCTCAAAATTCGAGTGACAA	TGGGAGTAGACAAGGTACAACCC
Homo sapiens	NLRP3	GATCTTCGCTGCGATCAACAG	CGTGCATTATCTGAACCCCAC
Homo sapiens	IL-1β	ATGATGGCTTATTACAGTGGCAA	GTCGGAGATTCGTAGCTGGA
Homo sapiens	IL-6	ATGATGGCTTATTACAGTGGCAA	CCATCTTTGGAAGGTTCAGGTTG
Homo sapiens	β-actin	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT

2.13. Western Blot

The HK-2 cells or renal tissue were lysed using RIPA lysis buffer. Equal amounts of proteins were electrophoresed by SDS-PAGE and subsequently transferred to PVDF membranes. The membranes were then incubated with 5% skim milk at room temperature for 2 h in a triple buffer containing Tween solution. Subsequently, PVDF membrane with primary antibodies was performed overnight at 4 °C, followed by incubation with secondary antibodies (Abways Technology, Shanghai, China) for 2 h at room temperature. Protein expression were detected using an enhanced chemiluminescence (ECL) kit (Yeasen Biotechnology, Shanghai, China) and visualized utilizing the ChemiDoc XRS system (Bio-Rad, California, USA).

2.14. Statistical Analysis

Data are expressed as mean ± standard error of the mean (SEM). t-test was used for comparison between the two groups, and one-way analysis of variance (ANOVA) was used for comparison between multiple groups followed by Dunnett’s post hoc tests. P < 0.05 was considered as statistically significant.

3. Results

3.1. Sesquiterpenoids Enhance the Activation of TFEB

The efficacy of certain sesquiterpenoids in ameliorating pathological damage in DKD has been demonstrated, suggesting their potential as therapeutic agents. Previously, we found that Yishen Tongluo Formula improved DKD. However, the therapeutic effect of sesquiterpenoids in its extract on DKD remains unclear. As activating autophagy is an effective strategy for treating DKD, we screened several structurally similar sesquiterpenoids for their effects on TFEB through a luciferase reporter gene system. As shown in Figure A,B, among several sesquiterpenoids, GER has the strongest activating effect on TFEB. Therefore, it was considered to take GER as the effective sesquiterpenoid component in the Yishen Tongluo Formula for the treatment of DKD. MTT assay demonstrated that GER did not affect the viability of HK-2 cells in the range of 0–20 μM (Figure C). Then, a reporter gene assay was conducted. The results revealed that TFEB luciferase activity increased in a time- and dose-dependent manner following GER treatment (Figure D,E).

1.

Sesquiterpenes with the potential to activate TFEB. (A) Chemical structure of several sesquiterpenoids. (B) Effects of several sesquiterpenoids on the transcriptional activity of TFEB. (C) Influence of GER on cell viability by the MTT assay. (D) Luciferase activity in different concentrations of GER or (E) 20 μM GER treated for indicated times. The data were shown as the mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 vs DMSO.

3.2. GER Ameliorates Renal Insufficiency of db/db Mice

Subsequently, we evaluated the effect of GER on the treatment of DKD. First, the blood glucose levels of db/db mice were assessed, and GER had a significant glycemic control effect (Figure A). The levels of Scr and BUN of db/db mice indicated renal pathological changes, confirming significant renal injury of db/db mice. However, after treatment of GER, these changes were significantly ameliorated (Figure B,C). The alteration in kidney weight/body weight ratio indicated that GER slowed down the hypertrophy of the kidneys (Figure D). Glomerular filtration rate and urine microalbumin are key indicators for evaluating renal function in DKD. The assessment of the glomerular filtration rate and the degree of albuminuria was conducted through the evaluation of the urinary albumin/creatinine ratio (UACR) and the urine albumin excretion rate (UAER). The results indicated that the db/db mice showed a significant increase in UACR and UAER. After 4 weeks and 8 weeks of GER intervention, UACR and UAER gradually decreased in Figure E,F. In conclusion, GER effectively mitigated renal insufficiency of db/db mice.

2.

Effects of GER on the renal function of db/db mice. (A) Blood glucose levels of db/db mice. (B) Serum creatinine (Scr) levels of db/db mice. (C) Blood urea nitrogen (BUN) levels of db/db mice. (D) Kidney weight/body weight (KW/BW). (E, F) UACR and UAER of db/db mice. The data were shown as the mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 vs db/, ^## P < 0. 01, ^### P < 0. 001 vs db/.

3.3. GER Ameliorates Pathological Damage of db/db Mice

The development of DKD was characterized by consistent thickening of the glomerular basement membrane, and mesangial hyperplasia. Consequently, we assessed the extent of pathological damage by examining histopathological sections. H&E and PAS staining confirmed that db/db mice exhibited significant proliferation of glomerular matrix and uniform thickening of the basement membrane. After GER treatment, in addition to the glomerular basement membrane, the renal tubular injury was also significantly improved, which confirmed that GER had a significant advantage in inhibiting the degree of renal tubular injury (Figure A–C). Masson staining revealed substantial collagen deposition and glomerular and interstitial fibrosis in renal tissue of db/db mice, and GER significantly inhibited this effect (Figure A,D). These findings demonstrated that GER mitigated renal pathological damage.

3.

Effect of GER on the renal pathological injury in db/db mice. (A) Representative histological sections in the kidney of db/db mice. (B) Quantitative analysis of mesangial dilatation in PAS staining. (C) Score of renal injury in PAS staining. (D) Quantitative analysis of collagen fibers in Masson staining. The data were shown as the mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 vs db/db, ^## P < 0.01, ^### P < 0.001 vs db/m.

3.4. GER Restores Autophagy Flux in the Kidney of db/db Mice

We examined the renal tubules of db/db mice using TEM to observe the number of autophagosomes and autolysosomes. GER treatment significantly elevated autophagosome (red arrow) and autolysosome counts (blue arrow) (Figure A). Subsequently, we analyzed the fluorescence levels of LC3B and Lamp2 in the kidney of db/db mice using immunofluorescence. The fluorescence levels of both LC3B and Lamp2 were decreased in db/db mice. However, after the administration of GER, there was a notable enhancement in the fluorescence intensity of both LC3B and Lamp2, along with an increase in their colocalization (Figure B,C). Furthermore, western blot analysis revealed that GER resulted in a significant upregulation of crucial autophagy-related proteins, specifically LC3 II, and a noticeable downregulation of p62 expression in the kidney of db/db mice (Figure D–F). These findings suggested that GER facilitated the occurrence of autolysosomes. In summary, our results demonstrated that GER effectively restored autophagy flux in the kidney of db/db mice.

4.

GER induced autophagy activation in the kidney of db/db mice. (A) Representative images obtained from TEM revealed the quantification of autophagosomes and autolysosomes of db/db mice. A red arrow indicated autophagosomes, while a blue arrow represented autolysosomes. (B, C) Immunofluorescence of LC3B (green), Lamp2 (red), and DAPI (Blue) of db/db mice. (D–F) Protein expression of LC3II and p62 of db/db mice. The data are shown as the mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 vs db/m, ^### P < 0.01 vs db/db.

3.5. GER Suppresses Inflammation In Vivo and In Vitro

In the pathological presentation of DKD, inflammation plays a crucial role and has a significant impact on renal tubular cells. , To investigate this, the levels of KIM1 and IL-1β were measured by Elisa in db/db mice. The results showed that renal injury and the release of inflammatory factors were significantly elevated in db/db mice, but were noticeably reduced after treatment with GER (Figure A,B). Additionally, mRNA levels of IL-1β and IL-6 were suppressed after GER intervention (Figure C,D). NLRP3 is an important inflammasome involved in activating inflammatory cytokines like IL-1β. , GER significantly reduced NLRP3 protein expression (Figure E,F). In vitro, GER inhibited the levels of KIM1, NGAL, IL-1β, and IL-6 (Figure G–J). Meanwhile, GER also reduced the expression of NLRP3 protein and cleaved Caspase-1 protein in HK-2 cells, suggesting that GER may be involved in the degradation of the inflammasome complex, thereby hindering the release of pro-inflammatory cytokines (Figure K–M). These findings collectively suggested that GER effectively suppressed inflammatory response in vivo and in vitro.

5.

GER suppressed inflammation in vivo and in vitro. (A) KIM1 in the serum. (B) IL-1β in kidney tissues. (C, D) mRNA expression of IL-1β and IL-6 in kidney tissues. (E, F) Protein expression of NLRP3 of db/db mice. (G–J) mRNA expression of KIM1, NGAL, IL-1β and IL-6 in HK-2 cells. (K–M) Protein expression of NLRP3 and Caspase-1 in HK-2 cells. The data are shown as the mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 vs db/m, ^# P < 0.05, ^## P < 0.01, ^### P < 0.001 vs db/db.

3.6. GER Inhibits Inflammatory Activation by Promoting Autophagy

pRluc-LC3^WT/G120A utilizes the pRluc-LC3 fusion protein as its core component, combining the high dynamic range and sensitivity luciferase with LC3 characteristics to enter lysosomes through an autophagy-dependent mechanism. Since mutant pRluc-LC3^G120A cannot undergo lipidation or bind to the autophagic membrane, it degrades when pRluc-LC3^WT is induced for autophagy, reference protein pRluc-LC3^G120A remains stably expressed. , To verify the effect of GER on autophagic in vitro, LC3 plasmid was transfected and luciferase activity was measured. The treatment with GER significantly reduced the luciferase activity of pRluc-LC3WT/G120A, suggesting that GER promoted autophagy (Figure A). After treatment with AGEs, the expression of LC3II protein in HK-2 cells was significantly decreased, while the expression of p62, an autophagic substrate protein, was significantly increased, indicating that the autophagic process was blocked. GER increased the expression of LC3II protein and inhibited the expression of P62 to promote autophagy (Figure B–D). Subsequently, chloroquine (CQ) an inhibitor of autophagy was used to evaluate whether autophagy is involved in GER-mediated NLRP3 inflammasome degradation. According to Figure E,G, the reduction effect of GER on p62 was hindered after CQ treatment, confirming that CQ inhibited autophagic flux. Similarly, the degradation effect of GER on NLRP3 inflammasome also disappeared, indicating that the degradation of NLRP3 inflammasome by GER depended on autophagy (Figure E–H). Similar alterations were observed in the mRNA levels of NLRP3, IL-1β, KIM1 and NGAL (Figure I–L). Overall, GER suppressed inflammatory activation by promoting autophagy. However, in the subsequent experiment, we will conduct further verification to elucidate the impact of GER on TFEB activation and its role in promoting autophagy.

6.

GER promoted autophagy to inhibit inflammatory activation. (A) The LC3WT/G120A plasmid was transfected into 293T cells to detect autophagic flux. Reporter gene transfection into LC3^WT/G120A plasmid was performed to detect autophagy flux. (B–D) Protein expression of LC3II and p62 protein levels in HK-2 cells. (E–H) Protein expression of LC3II, p62, and NLRP3 in HK-2 cells treated with CQ. (I–L) mRNA expression of NLRP3, IL-1β, KIM1 and NGAL in HK-2 cells treated with CQ. The data are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 vs AGE-BSA, ^# P < 0.05, ^## P < 0.01, ^### P < 0.001 vs BSA.

3.7. GER Facilitates PP2A Activation to Enhance the Translocation of TFEB into the Nucleus

It has been reported that the nuclear translocation of TFEB is its main form of activation and is regulated by its phosphorylation status. Therefore, we further explored the potential mechanism of TFEB activation. GER dose-dependently promoted the expression of TFEB protein in the cell nucleus (Figure A,B). Notably, overall TFEB protein expression did not significantly change in db/db mice after GER treatment in Figure C–F, but p-TFEB (S122) protein expression was significantly inhibited. These findings were consistent with similar results obtained from HK-2 cells (Figure G–J), suggesting that the downregulation of p-TFEB (S122) is crucial for promoting TFEB nuclear translocation. Previous studies have shown that PP2A is involved in the dephosphorylation of proteins, where the B subunit of PP2A plays a critical role and affects protein phosphorylation across. To elucidate whether PP2A modulated the alterations of p-TFEB (122) levels, we initially investigated the expression of the PP2A B subunit (PPP2R5C) both in vitro and in vivo. The results showed in Figure C,D,G,H indicated that the expression of PPP2R5C protein was significantly upregulated after GER treatment. To further validate the relationship between p-TFEB (122) and PPP2R5C, we explored the influence of okadaic acid (OA), an inhibitor of PP2A, on the expression of TFEB and p-TFEB (S122). The results indicated that the GER-mediated degradation of p-TFEB (S122) was reversed by OA (Figure K–M). To further verify how GER regulated PP2A, we used molecular docking to model the binding of GER to the active pocket of the B subunit of PP2A (PDB: 2JAK). The results showed GER formed a hydrogen bond with arginine at position 105 of PP2A, with a binding energy value of −6.9 kcal/mol (Figure N). In conclusion, our research results indicated that GER promoted the dephosphorylation of TFEB by regulating PP2A.

7.

The interaction between GER and PP2A facilitated the translocation of TFEB into the nucleus. (A, B) Protein expression of TFEB in the nucleus and cytoplasm in HK-2 cells. (C–F) Protein expression of PPP2R5C, TFEB, and p-TFEB (S122) of db/db mice. (G–J) Protein expression of PPP2R5C, TFEB, and p-TFEB (S122) protein expression levels in HK-2 cells. (K–M) Protein expression of TFEB and p-TFEB (S122) in HK-2 cells treated with OA. (N)­Molecular docking of GER with PP2A (PDB: 2JAK). The data are shown as the mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 vs db/db or AGE-BSA, ^# P < 0.05, ^## P < 0.01, ^### P < 0.001 vs db/m or BSA.

4. Discussion

In summary, the findings of this study demonstrated that GER promoted PP2A activation, leading to a decrease in the phosphorylation level of TFEB, and subsequently, TFEB entered the nucleus to promote autophagy. In the efficacy study, GER ameliorated renal dysfunction and mitigated pathological damage. Additionally, GER plays a crucial role in inhibiting NLRP3 inflammasome activation and IL-1β release by promoting autophagy (Figure ).

8.

Proposed mechanism of GER in improving DKD. GER bound to PP2A, facilitating TFEB dephosphorylation to enter the nucleus, activating autophagy to inhibit renal inflammation and alleviate the progress of DKD.

Sesquiterpenes, which are the most abundant and structurally diverse group among terpenoids, exhibit wide distribution across animals, plants, and microorganisms. They possess potent biological activities and play crucial roles in various biological processes. GER, a sesquiterpene compound found in Curcumae longae Rhizoma, Curcumae radix, Astragali radix, and other traditional Chinese medicines, is known for its medicinal and culinary applications as well as its potent anti-inflammatory properties. − Literature reports indicated that GER administration upregulated the expression of the anti-inflammatory mediator IL-10 while downregulated pro-inflammatory cytokines like IL-1 and IL-6, thereby exerting an anti-inflammatory effect in renal fibrosis. , Renal tubular injury caused by renal inflammation contributes to the development of DKD. , Previous investigations of the Yishen Tongluo formula have confirmed the efficacy of this traditional Chinese medicine in ameliorating the renal pathology of DKD. The anti-inflammatory effects of its sesquiterpene extract in inhibiting renal inflammation in DKD require further exploration. In this study, the administration of GER relieved symptoms associated with renal injury, restored glomerular and renal tubular morphology and structure, and inhibited inflammation-induced renal tubular injury (Figures –). These findings suggested that GER played a protective role in DKD through its anti-inflammatory effect. Furthermore, our current study demonstrated that the therapeutic effect of GER on inflammatory factors and markers of renal injury was reversed by autophagy blockers, indicating that the activation of autophagy served as a molecular mechanism by which GER inhibited renal inflammation and injury (Figure ). Currently, the commonly used drugs for treating DKD in clinical practice mainly include SGLT2 inhibitors and angiotensin receptor blockers (ARBs). , SGLT2 inhibitors improve DKD by inhibiting SGLT2 in the renal tubules and reducing the reabsorption of glucose. ARBs reduce glomerular hypertension and proteinuria and delay renal fibrosis by inhibiting the generation of angiotensin II or its binding to receptors. However, they may cause hyperkalemia and changes in renal function. From the perspective of renal tubular injury, we found that GER alleviated renal tubular inflammatory responses and improved DKD by promoting autophagy. In this study, we used the ARB drug Val as a positive control. Both GER and Val alleviated the pathological damage in DKD mice and improved renal fibrosis. However, GER did not cause renal function damage but instead improved it, suggesting that GER may be a potential therapeutic drug for DKD. As a potential therapeutic drug for DKD, we will continue to investigate the pharmacokinetic characteristics and clinical safety of GER in the future.

TFEB, a crucial transcription factor in autophagy-lysosome biogenesis, has become an attractive therapeutic target for various human diseases associated with autophagy or lysosomal dysfunction due to its involvement in the intracellular clearance pathway. , Subsequent research has elucidated that TFEB functions as a positive regulator of autophagy, facilitating the autophagic flux and in the formation of autophagosome. Concomitantly, the function of TFEB is predominantly modulated by its phosphorylation status and intracellular positioning. The interplay of various signaling cascades and the role of TFEB phosphorylation are critical determinants of its subcellular distribution. , Current insights into the nuclear translocation of TFEB suggests that phosphorylation serves as a pivotal regulatory mechanism underlying its activity, with this process being finely tuned by an array of phosphatases and kinases. For instance, kinases such as mTORC1, ERK2 and AKT are associated with the phosphorylation of TFEB. mTORC1, as the primary kinase complex, typically phosphorylates TFEB at S142 or S211. , ERK2 predominantly phosphorylates TFEB at S142, which inhibits its nuclear translocation. AKT phosphorylates TFEB at S46, leading to the inhibition of its nuclear translocation. TFEB is dephosphorylated by two phosphatases, CaN and PP2A. In starvation, lysosomal calcium is released, leading to an elevation in cytoplasmic calcium concentration. This elevation subsequently facilitates CaN activation, as CaN is a calcium-dependent phosphatase. CaN dephosphorylates S142 and S211 residues, promoting TFEB nuclear translocation.

PP2A, a major serine/threonine phosphatase, plays a crucial role in maintaining the balance of phosphorylation signals essential for cellular proliferation and differentiation. Comprised of scaffold subunit A, regulatory subunit B, and catalytic subunit C, it generates diverse functional and substrate-specific PP2A complexes across various cell types and tissues. While subunits A and C exhibit sequence conservation among eukaryotes, regulatory subunit B assumes a pivotal role in governing the localization and activity of distinct holoenzymes. It has been reported that specific binding between the core dimer and one of the regulatory B subunits enables PP2A to exert regulatory flexibility as well as substrate specificity. Moreover, B subunits of PP2A independently regulates multiple cellular functions. Further investigation is needed to understand the impact of PP2A on nuclear translocation. PP2A is widely recognized as the primary regulator of the cell cycle, with its B subunit playing a crucial role in governing the localization and activity of various holoenzymes. Moreover, this subunit actively dephosphorylates numerous transcription factors and has been shown to target TFEB at multiple serine sites (S109, S114, and S122). , In our study, we demonstrated the stable binding of GER and PP2A, effectively inhibiting TFEB phosphorylation at S122. This inhibition resulted in a significant increase in the nuclear localization of TFEB and a substantial decrease in cytoplasmic distribution (Figure ). Therefore, these findings suggestted that the interaction between GER and PP2A facilitated the dephosphorylation of TFEB (S122) and promoted its nuclear translocation, ultimately activating autophagy. PP2A exerted protective effects in DKD through anti-inflammatory, maintaining the structural stability of podocytes and regulating fibrosis-related pathways. PP2A inhibited the activation of the NF-κB signaling pathway by dephosphorylating the p65 subunit (p-p65), thereby alleviating renal inflammatory responses. Additionally, PP2A stabilized the F-actin microfilament network by dephosphorylating the T335 site of Drebrin-1, improving podocyte migration and adhesion ability, and reducing proteinuria. These studies suggestted that PP2A may be a potential target for the treatment of DKD.

5. Conclusions

Overall, these findings provide new insights into the role of TFEB in DKD and establish a link between the regulation of autophagy activation and the reduction of renal tubular inflammation, as well as the slowing of DKD progression. Based on this understanding, the interaction between PP2A and TFEB may be a potential target for promoting autophagy activation therapy, which could be an effective intervention for treating DKD. The mechanism underlying its action may involve regulating TFEB nuclear translocation to suppress inflammation in DKD by activating autophagy relying on PP2A-TFEB interaction (Figure ). These findings suggest that GER may serve as a potential therapeutic agent for attenuating renal inflammatory injury and ameliorating DKD.

Glossary

Abbreviations

ANOVA

one-way analysis of variance

BUN

blood urea nitrogen

BSA

bovine serum albumin

CQ

chloroquine

DKD

diabetic kidney disease

ESRD

end-stage renal disease

GER

germacrone

KW/BW

kidney weight-to-body weight ratio

NLRP3

NLR family pyrin domain containing 3

OA

okadaic acid

PP2A

protein phosphatase 2A

Scr

serum creatinine

SEM

standard error of the mean

TEM

transmission electron microscopy

TFEB

transcription factor EB

UACR

urinary albumin/creatinine ratio

UAER

urinary albumin excretion rate

Val

valsartan

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.5c00038.

• PP2A agonist FTY720 that was used for positive control for molecular docking to enhance the reliability of the prediction of the binding between PP2A and GER (PDF)

#.

Z.X. and M.W. made equal contributions to this work. Z.X.: supervision, investigation, writing–original draft, and writing–review and editing. M.W. and X.Z.: data curation, formal analysis, investigation, methodology, and writing–original draft. Q.S.: data curation and investigation. X.S.: data curation and methodology. J.J.C.: conceptualization and investigation. J.X.: funding acquisition, supervision, investigation, and writing–review and editing. Z.Z.: supervision, methodology, resources, and writing–review and editing. T.L.: data curation, formal analysis, software, and visualization. G.G.: data curation, formal analysis, and writing-original draft.

The authors declare no competing financial interest.

This article published ASAP on July 18, 2025. Figures 3 and 4 have been updated and the corrected versions reposted on July 24, 2025.