Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2005 Oct;71(10):5702–5709. doi: 10.1128/AEM.71.10.5702-5709.2005

Real-Time PCR Detection of Vibrio vulnificus in Oysters: Comparison of Oligonucleotide Primers and Probes Targeting vvhA

Gitika Panicker 1,†, Asim K Bej 1,*
PMCID: PMC1265985  PMID: 16204478

Abstract

We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (CT) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 103 V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 × 103 CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.


Consumption of raw or undercooked oysters has long been a cause for concern with the food regulatory and health agencies. These shellfish are known reservoirs of a multitude of pathogenic bacteria and viruses that have been linked to several outbreaks worldwide (33). In the United States, a majority of the consumable oysters are harvested from the Gulf of Mexico water (gulf water), which over the years has been the cause for an increasing number of Vibrio vulnificus-related illnesses. V. vulnificus is a naturally occurring, gram-negative bacterium capable of causing gastroenteritis and fatal septicemia, through the consumption of raw oysters, in immunocompromised patients or people with a high iron content in their bloodstream (19). Contact of an open wound to seawater or shellfish carrying V. vulnificus can also lead to septicemia or amputation of the infected body part (30). Due to an increased number of disease incidents, the state of California in April 2003 released emergency restrictions on the sale of all oysters harvested between April and October from the Gulf of Mexico unless they are treated with a scientifically validated process to reduce V. vulnificus to a nondetectable level (<30 CFU/g of oyster) (California Department of Health Services [http://www.dhs.ca.gov]). Although, several naturally occurring Vibrio spp. are present in oysters, the heightened concern for V. vulnificus is due to the associated mortality rate of 60% (14, 22). Thus, routine monitoring of oysters for this microorganism by using a rapid detection method would help better implement Interstate Shellfish Sanitation Conference (ISSC) guidelines for a steady supply of consumable oysters considered to be safe from V. vulnificus.

The current guidelines recommended by the ISSC for the detection of this pathogen requires a minimum detection level of <30 CFU/g in post-harvest-treated oysters to be considered safe from V. vulnificus for consumption (14). The detection methodologies approved by the U.S. Food and Drug Administration range from most-probable-number method, followed by growth on selective media, biochemical testing, and colony blot DNA-DNA hybridization (17). These procedures although specific, are time-consuming and laborious, often taking 4 to 5 days to complete. The utilization of PCR-based assays would, however, allow a rapid and reliable detection of a microbial pathogen in clinical, environmental, and food samples (2). The recent introduction of real-time PCR provides a rapid, specific, sensitive, and quantitative analysis platform for the detection of food-borne pathogens (4, 5, 7, 8, 11, 14, 15). The TaqMan PCR involves validation of the PCR-amplified DNA after hybridization of the fluorogenic probes internal to the amplicon in a reaction. Other advantages of this method compared to conventional PCR are faster temperature ramp times and ease of interpretation of results. Also, the application of additional methods for postamplification analysis of the amplicons such as agarose gel electrophoresis, DNA-DNA hybridization, and sequencing are not required. Several studies describe the use of the V. vulnificus hemolysin A (vvhA) gene (39) as a species-specific target for the detection of V. vulnificus by both conventional and real-time PCR methods (6, 7, 9, 13, 19-21, 28, 29, 32). The oligonucleotide primers for the real-time PCR in some of these reports were selected from various segments of vvhA, generating amplicon lengths of 100 bp (7), 205 bp (28, 29), and 383 bp (9). The report by Campbell and Wright (7) used the TaqMan PCR method, which generated a 100-bp amplicon, but a limited number of V. vulnificus, non- V. vulnificus, and non-Vibrio spp. were tested to establish high detection specificity. The studies by Fukushima et al. (9) and Panicker et al. (28, 29) used SYBR Green I dye for real-time PCR, generating 383- and 205-bp amplicons, respectively. Our objective was to develop a TaqMan-based real-time PCR assay that will allow detection of this pathogen in oysters with high specificity and sensitivity and is in compliance with the recent ISSC guidelines. The primer sets producing the range of amplicon sizes described by the aforementioned reports appear to be ideal for evaluating a TaqMan-based real-time PCR and assessing its effectiveness for the detection of this pathogen in oysters. Therefore, we have compared here the specificity of three sets of oligonucleotide primers and respective dual- labeled TaqMan probes for real-time PCR amplification of vvhA. Two specific sets of primers and probes were then used to develop a TaqMan PCR assay for the detection of V. vulnificus in oysters.

MATERIALS AND METHODS

Bacterial strains.

The list of V. vulnificus strains used in the present study has been previously described by Panicker et al. (28). For optimization of PCR amplification on purified DNA from pure cultures or DNA from seeded oyster tissue homogenates, V. vulnificus clinical strain MO6-24(O) was used (12). V. vulnificus strains were grown on half-strength (18.7 g/liter) marine agar (Becton Dickinson, Franklin Lakes, NJ) or on modified cellobiose-polymyxin-colistin (mCPC) (11, 36) agar wherever appropriate. V. parahaemolyticus strains on nutrient agar (Difco) supplemented with 3% (wt/vol) NaCl. All other Vibrio spp. were grown on full-strength marine agar (37.4 g/liter). The nonvibrio strains and V. cholerae were grown on Luria-Bertani (LB) agar (25) agar. The seeded oyster tissue homogenates were enriched in gulf water (salinity, 18 ppt) supplemented with 0.2% (wt/vol) Bacto peptone (GWP-18) (Difco).

DNA purification.

Genomic DNA from a pure culture of V. vulnificus was purified by using the procedure described by Ausubel et al. (3). Briefly, cells were suspended in 567 μl of Tris-EDTA buffer (10 mM Tris-Cl [pH 8.0], 1 mM EDTA) with 30 μl of 10% (wt/vol) sodium dodecyl sulfate and 3 μl of proteinase K (20 mg/ml) (Sigma, St. Louis, MO) and lysed for 1 h at 37°C. Next, 100 μl of 5 M NaCl and 80 μl of cetyltrimethylammonium bromide-NaCl were added, followed by incubation for 10 min at 65°C. DNA was purified by extraction with chloroform-isoamyl alcohol (24:1), followed by extraction with phenol-chloroform-isoamyl alcohol (25:24:1). The DNA was then precipitated with isopropanol, centrifuged for 5 min at 10,000 × g, washed with cold 70% (vol/vol) ethanol, and dried with a DNA SpeedVac (Savant Instrument, Inc., Holbrook, N.Y.). The dried DNA was resuspended in 25 μl of the Tris-EDTA buffer described above, and the DNA concentration was measured with a Lambda II spectrophotometer (Perkin-Elmer, Shelton, Conn.) at a wavelength of 260 nm.

Selection of oligonucleotide primers and probes.

For comparative analysis of the TaqMan PCR assay, three sets of oligonucleotide primers were selected from previously reported studies, which generated a minimum of a 100-bp amplicon, followed by an approximate increment of twice the length for the next two amplicons, which were 205 and 383 bp, respectively (Table 1). The primer sequences were analyzed by the OligoAnalyzer software (IDT) for the percent GC content, self-dimer, and hairpin structures. The TaqMan probe for the 205- and 383-bp amplicons was selected by using the IDT SciTools PrimerQuest software (IDT) with 50% GC content, lack of strong hairpin or self-dimer structures, and absence of d(G) residues at the 5′ end (Table 1). The TaqMan probe for the 100-bp amplicon was directly used as described by Campbell and Wright (7) without further modification. The melting temperatures (Tm) of the primers and probes were determined by the following formula: Tm (°C) = 2(A + T) + 4(G + C) (34). These primer and probe sequences were subjected to BLAST analysis using the National Center for Biotechnology Information GenBank database (http://www.ncbi.nlm.nih.gov). All oligonucleotides primers and probes were custom synthesized by Integrated DNA Technology, Inc., Coralville, IA.

TABLE 1.

Oligonucleotide primer and probe sequences used in this study

Primer or probea Sequence (5′→3′)b Primer location Amplicon size (bp) Tm (°C) Source or reference
F-vvh785 TTCCAACTTCAAACCGAACTATGAC 785-810 205 66 6, 28, 29
R-vvh990 ATTCCAGTCGATGCGAATACGTTG 967-990 70 6, 28, 29
P-vvh874 5′-ROX-AAC TAT CGT GCA CGC TTT GGT ACC GT-3′-BHQ-2 874-899 78 This study
F-vvh731 CTC ACT GGG GCA GTG GCT 731-748 383 60 9
R-vvh1113 CCA GCC GTT AAC CGA ACC A 1095-1113 60 9
F-vvh1059 TGT TTA TGG TGA GAA CGG TGA CA 1059-1081 100 66 7
R-vvh1159 TTC TTT ATC TAG GCC CCA AAC TTG 1135-1159 68 7
P-vvh1109 5′-FAM- CCG TTA ACC GAA CCA CCC GCA A-3′-BHQ-1 1088-1109 70 7
a

F, forward primer; R, reverse primer; P, probe.

b

ROX, 6-carboxy-X-rhodamine; BHQ-2, Black Hole-2 quencher dye; FAM, 6-fluorescein; BHQ-1, Black Hole-1 quencher dye.

Optimization of real-time PCR with TaqMan assay.

TaqMan PCRs with F-vvh785 and R-vvh990 primers (6, 28) was performed with 2.5 μl of 10× PCR buffer (10× buffer consisted of 200 mM Tris-Cl [pH 8.4], 500 mM KCl), 5 μl of 25 mM MgCl2, 200 μM concentrations of deoxynucleoside triphosphates (Sigma, St. Louis, MO), 0.24 μM ROX-labeled vvhA probe, 0.4 μM concentrations of vvhA primers, 1.5 U of Taq DNA polymerase (Promega, Madison, WI) and an appropriate amount of sterile deionized MilliQ (Millipore, Bedford, MA) water to bring the total reaction volume to 25 μl. The PCR cycling parameters were as follows: initial denaturation of the template DNA was set at 94°C for 120 s, followed by 40 cycles of amplification of the template DNA (each cycle consisting of denaturation at 94°C for 15 s and primer annealing at 58°C for 15 s) and primer extension on the template DNA at 72°C for 20 s. The TaqMan assay using vvhA primers (F-vvh1059/R-vvh1159) and probe (P-vvh1109) reported by Campbell and Wright (7) were also tested, but using the parameters suggested by the authors, or by using a higher primer annealing temperatures (60 or 62°C) and MgCl2 (2.5 or 5 mM) concentrations. The TaqMan probes used in the present study were labeled either with 6-carboxy-X-rhodamine (ROX) fluorescent dye at the 5′ end and a Black Hole-2 quencher dye (BHQ-2) at the 3′ end or 6-fluorescein (FAM) dye at the 5′ end and BHQ-1 at the 3′ end. The threshold fluorescence level in all experiments was set at a default value of 30 U. All PCR amplification reactions were performed in a Cepheid Smart Cycler instrument (Cepheid, Sunnyvale, CA). During the primer extension step of each amplification cycle, an increase in the fluorescence was recorded by the FAM channel at 518 nm and the ROX channel set at 605 nm. The minimum threshold value was set at 30 fluorescence units. The PCR-amplified DNA was further analyzed in an agarose gel (1% [wt/vol]).

Sensitivity of detection.

Purified genomic DNA from V. vulnificus MO6-24(O) was 10-fold serially diluted between 1 ng and 0.01 pg in autoclaved (121°C for 20 min at 15 lb/in2) deionized MilliQ water and subjected to TaqMan PCR amplification using F-vvh785/R-vvh990 and F-vvh731/R-vvh1113 with P-vvh874 TaqMan probe. In addition, a pure culture of V. vulnificus MO6-24(O) was grown in GWP-18 at 37°C to an optical density at 600 nm (OD600) of 0.2, and viable plate counts were performed on mCPC agar plates. The V. vulnificus culture was then 10-fold serially diluted in GWP-18 from 105 CFU/ml to extinction. Next, a 1-ml aliquot from each dilution was centrifuged at 12,000 × g for 10 min; the supernatant was discarded, and the cell pellets were resuspended in 200 μl of Instagene matrix (Bio-Rad Laboratories, Hercules, CA). The cell pellets resuspended in Instagene were then incubated at 56°C for 10 min, followed by boiling for 20 min to release the DNA. The samples were cooled to room temperature and centrifuged at 3,000 × g for 3 min, and an aliquot (3 μl) was used for PCR amplification (28). All reactions were performed in triplicate.

Real-time PCR inhibition control study.

Unseeded oyster tissue homogenate (1 g) was enriched in 50 ml of GWP-18 for 5 h at 37°C. After enrichment, a 1-ml aliquot was centrifuged and treated with Instagene (Bio-Rad) as described before. The inhibition control experiment was performed by using 3 μl of the Instagene-purified enriched unseeded oyster samples mixed with 0.1 ng to 0.01 pg of purified genomic DNA (2) from V. vulnificus. The TaqMan PCR amplification was conducted using F-vvh785/R-vvh990 and F-vvh731/R-vvh1113 primers with P-vvh874 probe. Sensitivity of detection was then compared to that of the detection level observed for the serially diluted purified DNA in autoclaved MilliQ-deionized water. All reactions were performed in triplicate.

Detection of seeded V. vulnificus in oyster tissue homogenate.

Oysters used in the optimization of the multiplex PCR assay were purchased from local seafood restaurants. The oysters were shucked, and the tissue was homogenized using standard methods of the American Public Health Association (1) and then frozen at −80°C until needed. At least three aliquots (1 g each) of oyster tissue homogenate from each sample were 10-fold serially diluted in sterile GWP-18 and plated onto mCPC agar to determine the viable plate counts. Any cellobiose-positive colonies on mCPC agar plates were individually PCR amplified with the vvh-specific primers to confirm the actual number of V. vulnificus cells in the samples. Exponentially grown V. vulnificus cultures (OD600 = 0.2) were then 10-fold serially diluted from a concentration of 104 CFU/ml to extinction. Viable plate counts on mCPC agar were performed as described above. Next, each serially diluted culture was added to 50 ml of GWP-18 containing 1 g of oyster tissue homogenate, followed by incubation at 37°C for 5 h in a rotary shaker incubator set at 150 rpm (Innova 4000; New Brunswick Scientific Co., Inc., Edison, NJ). The number of V. vulnificus cells after 5-h enrichment was determined by a viable plate count on mCPC agar (11, 36). One-milliliter aliquots from the enriched samples were then subjected to DNA extraction using Instagene matrix (Bio-Rad) as described above. An aliquot (3 μl) of the sample was used for PCR amplification. All reactions were performed in triplicate.

Detection of V. vulnificus in natural oysters.

Fifty oysters were collected between May and June 2004 from the Gulf of Mexico near Dauphin Island, Alabama. The water temperature (20 ± 3°C) was recorded, and salinity (17 ± 4 ppt) was measured by using a refractometer (Reichert Scientific Instrument, Buffalo, N.Y.) during collection. Immediately after collection, the oysters were kept on ice until used. The shell surfaces of the oysters were cleaned, and shell stocks were homogenized for 2 min in a Waring blender (Fisher Scientific) according to a procedure described elsewhere (1). Each sample consisted of shell-stocks from five oysters. The tissue homogenate (1 g) from each sample was then added to 50 ml of GWP-18 and enriched for 5 h at 37°C on a rotary shaker incubator (New Brunswick Scientific, Inc., Edison, NJ) set at 150 rpm. The viable plate count of V. vulnificus before and after enrichment was determined on mCPC agar as described before (28, 36). A 5-ml supernatant from each enriched culture was collected and centrifuged at 12,000 × g for 10 min, and the pellet was treated with Instagene matrix (28). For PCR amplification, a 3-μl aliquot of the treated sample was used. All reactions were performed in triplicate with appropriate PCR controls.

RESULTS

Specificity of detection.

BLAST analysis for selected primers and probes exhibited complete homology with vvhA (GenBank accession no. M34670) listed in the NCBI genome database. All V. vulnificus isolates exhibited positive amplification of 205 bp (6, 28), 383 bp (9), and 100 bp (7) amplicons with primer sets F-vvh785/R-vvh990, F-vvh731/R-vvh1113, and F-vvh1059/R-vvh1159, respectively (Table 2). The base pairing of the TaqMan probes (P-vvh874 or P-vvh1109) to their respective vvhA amplicons confirmed the specificity of detection. The increase in fluorescence crossing the threshold value (30 fluorescence units) at a specific cycle (CT) denoted the positive amplification of the targeted gene. TaqMan PCR on 12 other vibrios and 25 nonvibrios using F-vvh785/R-vvh990 and F-vvh731/R-vvh1113 primer pairs and P-vvh874 probe exhibited no amplification of a 205-bp amplicon (Table 2). However, some of the Vibrio spp., P. shigelloides, and A. hydrophila strains exhibited positive CT values with F-vvh1059/R-vvh1159 primers and P-vvh1109 TaqMan probe using PCR conditions described by the authors (Fig. 1) or by increasing the primer annealing temperatures or the MgCl2 concentrations (Table 3) (7). Agarose gel electrophoresis of these samples demonstrated the presence of an ∼100-bp DNA band, which was distinct from the primer-dimer artifacts (data not shown).

TABLE 2.

Specificity of detection using oligonucleotide primers and fluorogenic probes for vvh tested on clinical and environmental isolates of V. vulnificus, as well as other Vibrio spp. and nonvibrio isolates, by TaqMan assaya

Strain type No. of strains detected/no. tested (%) with primer-probe combinationb:
F-vvh785/R-vvh990/P-vvh874 F-vvh731/R-vvh1113/P-vvh874 F-vvh1054/R-vvh1159/P-vvh1109
V. vulnificus clinical isolates 40/40 (100) 40/40 (100) 40/40 (100)
V. vulnificus environmental isolates 41/41 (100) 41/41 (100) 41/41 (100)
Other Vibrio spp. 0/12 (0) 0/12 (0) 9/12 (75)c
Nonvibrio isolates 0/25 (0) 0/25 (0) 2/25 (8)d
a

The strains tested in this study were described previously (23). The primers and probes are described in Table 1.

b

Primer-probe combinations are given as forward primer/reverse primer/probe.

c

The nine strains exhibiting positive detection were V. hollisae 89A1960 and 89A4206; V. fluvialis CDC 1954-82; V. furnissii CDC 1958-83; V. alginolyticus Z106, ATCC 17749, and ATCC 19108; and V. mimicus ATCC 33653 and WMS33.

d

The two strains exhibiting positive detection were A. hydrophila FDA 9271 and P. shigelloides ATCC 14029.

FIG. 1.

FIG. 1.

Real-time PCR specificity using primers F-vvh1059 and R-vvh1159 with P-1109 on various Vibrio spp., P. shigelloides, and A. hydrophila. The CT values for TaqMan PCR for each of the strains are listed in Table 3.

TABLE 3.

Real-time PCR specificity of detection using primers F-vvh1059 and R-vvh1159 with P-1109 on various Vibrio spp., P. shigelloides, and A. hydrophila

Bacterial strain Mean CT (FAM channel) ± SDa at:
60°C annealing temp 62°C annealing temp
P. shigelloides ATCC 14029 33.92 ± 0.08 34.62 ± 0.03
V. alginolyticus ATCC 19108 27.96 ± 0.04 28.75 ± 0.02
V. mimicus WMS33 30.41 ± 0.06 31.39 ± 0.04
V. mimicus ATCC 33653 25.48 ± 0.15 27.31 ± 0.04
A. hydrophila FDA 9271 29.34 ± 0.04 32.11 ± 0.02
V. alginolyticus ATCC 17749 30.76 ± 0.06 30.76 ± 0.06
V. alginolyticus Z106 31.19 ± 0.11 31.95 ± 0.07
V. fluvialis CDC 1954-82 29.42 ± 0.05 31.06 ± 0.03
V. hollisae 89A7053 31.77 ± 0.03 33.04 ± 0.06
V. hollisae 89A1960 30.22 ± 0.04 31.46 ± 0.07
V. furnissii CDC 1958-83 30.68 ± 0.13 32.08 ± 0.09
V. vulnificus (positive control) 12.19 ± 0.06 12.69 ± 0.12
PCR-negative control 0.0 0.0
a

The data are means for three independent experiments. The results were consistent with PCR reactions in buffer consisting of various concentrations of MgCl2 (2.5 or 5 mM) as described in Materials and Methods.

Sensitivity of detection.

Real-time PCR conducted on serial-dilutions of genomic DNA purified from V. vulnificus exhibited consistent amplification of vvhA at the 1-pg level using both F-vvh785/R-vvh990 and F-vvh731/R-vvh1113 primers with P-vvh874 probe (Table 4). An increase in CT value with an increment of two to three cycles was noticeable as the concentration of DNA in the samples decreased for both sets of primers. Alternatively, unenriched 10-fold serial-dilution of pure cultures of V. vulnificus exhibited a detection level of 103 CFU/ml with these primers and probe (Table 4). The viable plate count for the exponentially grown V. vulnificus culture (OD600 = 0.2) was 1.2 × 108 CFU/ml (standard deviation, 0.34 × 108 CFU/ml; n = 3). The CT values for the purified DNA and the pure culture cells exhibited consistent results for both primer sets. Also, a good correlation between the CT values of purified DNA and pure cultures samples can be established provided that each cell carries a single copy of the targeted gene (Table 4).

TABLE 4.

Sensitivity of detection of purified DNA and serially diluted pure cultures of V. vulnificus MO6-24(O) using primer sets F-vvh785/R-vvh990 and F-vvh731/R-vvh1113 with P-vvh874 probe by TaqMan assaya

Sample Amt of DNA Mean CT value (ROX channel) ± SD
Mean viable plate count (CFU/ml) ± SD Mean CT value (ROX channel) ± SD
F-vvh785/R-vvh990 with P-vvh874 F-vvh731/R-vvh1113 with P-vvh874 F-vvh785/R-vvh990 with P-vvh874 F-vvh731/R-vvh1113 with P-vvh874
1 1 ng 18.96 ± 0.24 18.12 ± 0.15 105 ± 0.16 18.77 ± 0.34 17.92 ± 0.53
2 0.1 ng 22.86 ± 0.52 23.67 ± 0.06 104 ± 0.08 22.49 ± 0.26 22.85 ± 0.08
3 0.01 ng 25.66 ± 0.18 25.29 ± 0.12 103 ± 0.13 24.79 ± 0.5 25.47 ± 0.35
4 1 pg 28.88 ± 0.31 27.95 ± 0.61 102 ± 0.09 0.0 0.0
5 0.1 pg 0.0 0.0 101 ± 0.04 0.0 0.0
6 0.01 pg 0.0 0.0 100 ± 0.02 0.0 0.0
7 (PCR-positive control)b 16.1 ± 0.12 16.85 ± 0.05 12.27 ± 0.08 13.14 ± 0.12
8 (PCR-negative control)c 0.0 0.0 0.0 0.0
a

The data are means for three independent experiments.

b

PCR with purified genomic DNA from V. vulnificus.

c

PCR without any DNA.

PCR inhibition control study in oysters.

Results from the inhibition control experiments indicated that oyster tissue matrix spiked with purified DNA did not affect the sensitivity of detection by real-time PCR (Fig. 2). The level of detection achieved was the same (1 pg) as that of purified DNA when using F-vvh785/R-vvh990 and F-vvh731/R-vvh1113 primer pairs with P-vvh874 probe (Table 5). However, the CT values for the spiked oyster samples were one to two cycles higher than that of purified DNA diluted in MilliQ water, suggesting that the presence of oyster tissue homogenate did have some inhibitory effect but was not significant enough to affect the sensitivity of detection. The results were consistent with three replicate experiments.

FIG. 2.

FIG. 2.

Real-time PCR inhibition assay performed on 5-h-enriched oyster tissue homogenate samples spiked with 10-fold serially diluted purified DNA from V. vulnificus MO6-24(O) with the different primer sets. (A) Results with primer pair F-vvh785/R-vvh990 and probe P-vvh874; (B) results with primer pair F-vvh731/R-vvh1113 and probe P-vvh874. Sample 1, 1 ng; sample 2, 0.1 ng; sample 3, 0.01 ng; sample 4, 1 pg; sample 5, 0.1 pg; sample 6, 0.01 pg; sample 7, Negative control (unseeded oyster homogenate). The numbers marked also correspond to the sample numbers shown in Table 5.

TABLE 5.

Determination of PCR inhibition involved in detection of DNA from V. vulnificus in 5-h-enriched oyster tissue by TaqMan assaya

Sampleb Amt of DNA Mean purified DNA CT (ROX channel) ± SD Mean purified DNA plus enriched oyster tissue homogenate CT ± SDb with:
F-vvh785/R-vvh990 F-vvh731/R-vvh1113
1 (PCR-positive control)c 16.1 ± 0.12 18.44 ± 0.086 18.93 ± 0.13
2 0.1 ng 22.86 ± 0.52 24.59 ± 0.24 23.62 ± 0.15
3 0.01 ng 25.66 ± 0.18 29.31 ± 0.33 27.69 ± 0.51
4 1 pg 28.88 ± 0.31 33.77 ± 0.53 34.0 ± 0.42
5 0.1 pg 0.0 0.0 0.0
6 0.01 pg 0.0 0.0 0.0
7 (negative control)d 0.0 0.0 0.0
a

The data are means for three independent experiments.

b

The sample numbers correspond to the numbers in Fig. 2.

c

PCR with purified genomic DNA from V. vulnificus.

d

Unseeded oyster tissue homogenate.

Detection of V. vulnificus in seeded oyster tissue homogenate.

The TaqMan PCR amplification exhibited detection of 3 × 103 V. vulnificus CFU, which resulted from an initial cell count of 1 CFU in 1 g of seeded oyster tissue homogenate after 5 h of enrichment (Table 6). An overall increase in the CT values, relative to the number of V. vulnificus, was noticeable in 1 g of enriched oyster tissue samples seeded with an initial cell count of between 104 and 100 CFU (Table 6). This experiment demonstrated that a 5-h enrichment resulted in a sufficient level of V. vulnificus from an initial inoculum of 100 CFU/g of oyster tissue homogenate to achieve positive detection of this pathogen (14). Unseeded oyster tissue homogenate did not yield amplification of the vvhA target, which was confirmed by the lack of cellobiose-positive yellow colonies on mCPC agar. Consistent results were recorded for three replicate samples.

TABLE 6.

Sensitivity of detection in oyster tissue homogenate seeded with V. vulnificus MO6-24(O) by using TaqMan assay after a 5-h enrichmenta

Sample Mean viable plate count (CFU/g) ± SD
Mean CT (ROX channel) ± SD
Prior to enrichment After 5 h of enrichment F-vvh785/R-vvh990 F-vvh731/R-vvh1113
1 (1 ± 0.07) × 104 (4 ± 0.14) × 106 16.27 ± 0.18 16.85 ± 0.07
2 (1 ± 0.09) × 103 (7 ± 0.26) × 105 16.95 ± 0.34 17.13 ± 0.03
3 (1 ± 0.06) × 102 (3 ± 0.17) × 105 17.84 ± 0.21 18.16 ± 0.15
4 (1 ± 0.02) × 101 (4 ± 0.07) × 104 22.14 ± 0.18 22.18 ± 0.14
5 (1 ± 0.03) × 100 (3 ± 0.09) × 103 25.03 ± 0.06 25.69 ± 0.24
6 0 0 0.0 0.0
7 (PCR-positive control)b 16.27 ± 0.12 16.52 ± 0.09
8 (PCR-negative control)c 0.0 0.0
a

The data are means for three independent experiments.

b

Unseeded oyster tissue homogenate spiked with 0.1 μg of purified DNA.

c

Unseeded oyster tissue homogenate.

Detection of V. vulnificus in natural oysters.

Application of the TaqMan PCR on natural oysters exhibited positive detection of all samples after enrichment. The viable plate counts on mCPC agar before enrichment exhibited the presence of cellobiose-positive colonies ranging from 4 ± 0.04 CFU/g (n = 3) to 102 ± 0.03 CFU/g (n = 3) (Table 7). After 5 h of enrichment, the viable plate counts was recorded between 2.3 × 103 CFU/g (n = 3) and 8.4 × 105 CFU/g (n = 3), which approximates an expected cell division time of 30 min for this pathogen in a rich growth medium (17, 27). Therefore, TaqMan PCR assay inclusive of 5-h enrichment of the initial V. vulnificus counts of <10 CFU/g in natural oysters collected from Gulf of Mexico during summer months is in compliance with the current ISSC guidelines (14). The CT values for each sample were in agreement with the viable plate count data (Table 7). These data were comparable to the controlled experiment of oyster tissue homogenates with seeded V. vulnificus after 5 h of enrichment (Table 6). The CT values for the F-vvh785/R-vvh990 and F-vvh731/R-vvh1113 primer pairs with P-vvh874 probe were consistent for all samples.

TABLE 7.

Viable plate counts and TaqMan PCR detection of naturally occurring V. vulnificus in oysters

Sample Mean viable plate count before 5-h enrichment (CFU/ml)a ± SD CT (ROX channel)b
Mean viable plate count after 5-h enrichment (CFU/ml)a± SD CT (ROX channel)b
F-vvh785/R-vvh990 F-vvh731/R-vvh1113 F-vvh785/R-vvh990 F-vvh731/R-vvh1113
1 18 ± 0.03 0.0 0.0 (1.6 ± 0.14) × 104 23.14 ± 0.02 23.57 ± 0.08
2 27 ± 0.02 0.0 0.0 (3.2 ± 0.09) × 104 22.95 ± 0.06 22.81 ± 0.04
3 4 ± 0.04 0.0 0.0 (2.3 ± 0.03) × 103 26.42 ± 0.04 25.89 ± 0.06
4 9 ± 0.02 0.0 0.0 (6.0 ± 0.07) × 103 25.32 ± 0.05 25.98 ± 0.09
5 63 ± 0.06 0.0 0.0 (1.8 ± 0.12) × 104 24.14 ± 0.12 24.13 ± 0.08
6 102 ± 0.03 0.0 0.0 (8.4 ± 0.13) × 105 16.94 ± 0.24 17.06 ± 0.18
7 89 ± 0.02 0.0 0.0 (5.0 ± 0.09) × 105 17.46 ± 0.05 17.85 ± 0.06
8 31 ± 0.07 0.0 0.0 (8.5 ± 0.27) × 104 19.95 ± 0.17 20.26 ± 0.05
9 8 ± 0.01 0.0 0.0 (8.0 ± 0.14) × 103 24.86 ± 0.03 24.34 ± 0.18
10 29 ± 0.05 0.0 0.0 (3.5 ± 0.04) × 104 22.69 ± 0.18 22.32 ± 0.09
PCR-positive controlc 0.0 0.0 17.13 ± 0.06 17.58 ± 1.5
PCR-negative controld 0.0 0.0 0.0 0.0
a

CFU/ml on mCPC agar. The data are means for three independent counts.

b

The data are means from three PCR experiments for each sample.

c

PCR with purified genomic DNA from V. vulnificus.

d

PCR without any DNA.

DISCUSSION

V. vulnificus is the leading cause of seafood-related deaths in the United States (10). Every year during the summer months, an increase in V. vulnificus-related illnesses due to consumption of raw oysters or wound infections, primarily along the Gulf of Mexico states in the United States, have been reported. As a result, the reduced consumer confidence has led to significant losses for the seafood industries located along the U.S. Gulf Coast region. The recent emergency restrictions implemented in California, which are the first of their kind in the United States, on the sale of oysters harvested from the Gulf of Mexico has caused further financial losses to the seafood industries (California Department of Health Services, April 2003 [http://www.dhs.ca.gov]) Thus, the ISSC recommends routine monitoring of the harvested oysters and requires that post-harvest-treated oysters contain <30 CFU of V. vulnificus in 1 g of oysters, which helps determine whether the consumable oysters are relatively safe from V. vulnificus (14).

We describe here a rapid and specific method for detection of V. vulnificus in shellfish by TaqMan PCR assay, following comparison of suitable oligonucleotide primers and probe for vvhA. The cytotoxin hemolysin protein encoded by vvhA in V. vulnificus has been reported to exhibit potent cytolysin activity and could have a lethal effect on mice (18). However, this protein is expressed in both virulent and avirulent V. vulnificus strains, suggesting that this may not be the primary virulent factor for this pathogen (26). Specific detection of both virulent and avirulent strains of this pathogen was developed by using the vvhA-specific gene probe method (40). Subsequently, several studies demonstrated PCR-based detection of V. vulnificus by using oligonucleotide primers specific for this gene. However, none of them to our knowledge, except F-vvh785/R-vvh990, have been tested on an extensive list of clinical and environmental V. vulnificus isolates (28, 29). This primer set was used in the SYBR Green I-based real-time PCR which, although a specific and sensitive assay of detection, required the validation of the amplicon by melting curve analysis performed at the end of the run.

TaqMan PCR assay offers real-time monitoring of the targeted amplicon with high specificity and does not require postamplification analysis for confirmation of the results. The report by Campbell and Wright (7) was the first study utilizing the TaqMan PCR-based detection of this pathogen. However, the F-vvh1059/R-vvh1159 primers and probe P-vvh1109 used by Campbell and Wright (7) exhibited false-positive results, making it not ideal for routine monitoring of oysters for the presence of V. vulnificus. The amplification of other Vibrio spp. by these primers and detection of the amplicons by the TaqMan probe and gel electrophoresis was consistent with increased stringency of the PCR conditions, suggesting that the results were most probably not due to reaction artifacts. The other Vibrio spp. detected by the TaqMan PCR with F-vvh1059/R-vvh1159 primers and P-vvh1109 probe were apparently not tested by Campbell and Wright (7). Therefore, it was necessary to test alternative primers and probes for the detection of this pathogen to reduce the potential incidence of false-positive results, and avoid the need for a post-PCR thermal dissociation analysis to improve assay speed. In the present study, we selected a TaqMan probe internal to the F-vvh785/R-vvh990 primers and established a specific detection of V. vulnificus in oysters. Also, the comparative analysis showed that both F-vvh785/R-vvh990 and F-vvh731/R-vvh1113 primer sets, along with the common P-vvh874 probe, are suitable for the detection of this pathogen in oysters with the sensitivity and specificity required by the ISSC.

One of the important criteria for establishing a reliable TaqMan PCR-based detection of microbial pathogens in oyster tissue matrix is the recovery of sufficiently pure targeted DNA with minimum or no inhibitory effect on the reaction. Kaufman et al. (16) reported that sensitivity of TaqMan PCR detection of V. parahaemolyticus was compromised to 1 to 2 logs by the oyster tissue homogenate compared to the mantle fluid. Dilution of the recovered DNA samples or increasing the PCR volume could help achieve a consistent level of detection (7). In the present study, the sample enrichment step led to significant dilution of the tissue homogenate, which possibly helped avoid inhibition of the TaqMan PCR results. The Instagene matrix-purified targeted DNA from seeded V. vulnificus in pure cultures or enriched oyster tissue homogenate exhibited the same level of sensitivity of detection of this pathogen. Therefore, from this experiment it is apparent that the Instagene-based method of DNA purification is simple to use and can easily be adopted and applied for routine monitoring of this pathogen in shellfish without compromising the specificity and sensitivity of detection of V. vulnificus in enriched oyster tissue homogenate. An alternate method of DNA purification using magnetic beads exhibited a high level of sensitivity of detection of seeded V. cholerae in oyster tissue homogenate (23) and of Salmonella enterica (8) and Listeria monocytogenes (4) in food matrices. However, application of a comparable method for purification of V. vulnificus DNA from enriched oyster tissue homogenate using the Bugs'n Beads kit (GenPoint AS, Oslo, Norway) exhibited inconsistent results (data not shown). Interestingly, in the present study, the sensitivity of detection for unenriched pure culture of V. vulnificus was 103 CFU/ml. Recovery of template DNA from this low number of cells was possible since particulates in gulf water may have helped coprecipitation of bacterial cells during centrifugation.

The inhibition control experiments performed with spiked oyster tissue homogenate samples showed that the sensitivity of detection by TaqMan PCR was not significantly inhibited by the presence of the oyster tissue homogenate extracts. Also, it helped further demonstrate that the Instagene matrix-based extraction procedure provided sufficiently purified template to allow sensitive detection by real-time PCR. The purified genomic DNA by Ausubel et al. (3) was used in the present study to optimize reagent concentrations and reaction conditions for TaqMan PCR.

By using the optimum PCR temperature cycling parameters and reagents, it was possible to detect a level of 3 × 103 CFU V. vulnificus per ml of enrichment broth after 5 h of enrichment of an initial 1 CFU/g of oyster tissue homogenate (seeded). The enrichment step helped increase the sensitivity of detection from unenriched 103 CFU/g to an initial inoculum of 1 CFU/g, which is well within the required ISSC guidelines (14). The 5-h enrichment was sufficient to achieve this level of detection, since the optimum doubling time for this pathogen (ca. 30 min) provided enough targets for accurate and sensitive detection by this method (27, 28).

Typically, oysters harbor a total of 103 to 105 CFU bacteria per g of tissue during the summer months (35), of which V. vulnificus may comprise between 10 and 50% of the culturable population, as determined by colorimetric DNA-probe colony hybridization (41). In the present study, the viable plate counts of V. vulnificus in natural oysters determined on mCPC-agar supported the presence of this pathogen at a comparable level. However, it has been reported that V. vulnificus in natural oysters may remain in a physiologically compromised state, giving a viable plate count that does not accurately represent the actual cell count in the sample (37, 38). In the present study, although the CT values from TaqMan PCR on pure cultures correlated with the purified genomic DNA, these values could not be accurately applied on enriched cultures of natural oysters due to the variable growth rate of the indigenous V. vulnificus population. However, detection of initial V. vulnificus of <10 CFU/g in natural oysters was accomplished on enriched samples, which could not be achieved in unenriched pure cultures.

The entire method, including sample processing, enrichment, and real-time PCR amplification, could be completed in a single day. This is in contrast to conventional methods such as the most-probable-number approach, followed by biochemical testing and colony blot hybridization, that takes approximately 3 to 4 days to complete (17, 31). Rapid detection of this pathogen in consumable oysters at a level that meets the recent ISSC guidelines therefore would help reduce the incidence of illness and fatality that result from ingestion of raw shellfish.

Acknowledgments

This study was supported by funds from the Mississippi-Alabama Sea Grant Consortium, the National Oceanic and Atmospheric Administration, the U.S. Department of Commerce, and the University of Alabama at Birmingham through research grant R/SP-8.

We thank Angelo DePaola, Jr., and Charles A. Kaysner for providing the V. vulnificus strains and some of the other vibrio strains and for helpful suggestions.

REFERENCES

  • 1.American Public Health Association. 1970. Recommended procedures for the examination of seawater and shellfish, 4th ed. American Public Health Association, Washington, D.C.
  • 2.Atlas, R. M., and A. K. Bej. 1994. Polymerase chain reaction, p. 418-435. In P. Gerhardt, R. G. E. Murray, W. A. Wood, and N. R. Kraig (ed.), Methods for general and molecular bacteriology. ASM Press, Washington, D.C.
  • 3.Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Smith, J. G. Sideman, and K. Struhl (ed.). 1987. Current protocols in molecular biology, p. 2.10-2.11. John Wiley & Sons, Inc., New York, N.Y.
  • 4.Bassler, H. A., S. J. Flood, K. J. Livak, J. Marmaro, R. Knorr, and C. A. Batt. 1995. Use of a fluorogenic probe in a PCR-based assay for the detection of Listeria monocytogenes. Appl. Environ. Microbiol. 61:3724-3728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Blackstone, G. M., J. L. Nordstrom, M. C. L. Vickery, M. D. Bowen, R. F. Meyer, and A. Depaola. 2003. Detection of pathogenic Vibrio parahaemolyticus in oyster enrichments by real-time PCR. J. Microbiol. Methods 53:149-155. [DOI] [PubMed] [Google Scholar]
  • 6.Brasher, C. W., A. DePaola, D. D. Jones, and A. K. Bej. 1998. Detection of microbial pathogens in shellfish with multiplex PCR. Curr. Microbiol. 37:101-107. [DOI] [PubMed] [Google Scholar]
  • 7.Campbell, M. S., and A. C. Wright. 2003. Real-time PCR analysis of Vibrio vulnificus from oysters. Appl. Environ. Microbiol. 69:7137-7144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chen, S., A. Yee, M. Griffiths, C. Larkin, C. T. Yamashiro, R. Behari, C. Paszko-Kolva, K. Rahn, and S. A. De Grandis. 1997. The evaluation of a fluorogenic polymerase chain reaction assay for the detection of Salmonella species in food commodities. Int. Food Microbiol. 35:239-250. [DOI] [PubMed] [Google Scholar]
  • 9.Fukushima, H., Y. Tsunomori, and R. Seki. 2003. Duplex real-time SYBR green PCR assays for detection of 17 species of food- or waterborne pathogens in stools. J. Clin. Microbiol. 41:5134-5146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Glatzer, M. 2001. Vibrio vulnificus shellfish cases file from 1989-2000. U.S. Food and Drug Administration, Washington, D.C.
  • 11.Harwood, V. J., J. P. Gandhi, and A. C. Wright. 2004. Methods for isolation and confirmation of Vibrio vulnificus from oysters and environmental sources: a review. J. Microbiol. Methods 59:301-316. [DOI] [PubMed] [Google Scholar]
  • 12.Hayat, U., G. P. Reddy, C. A. Bush, J. A. Johnson, A. C. Wright, and J. G. J. Morris. 1993. Capsular types of Vibrio vulnificus: an analysis of strains from clinical and environmental sources. J. Infect. Dis. 168:758-762. [DOI] [PubMed] [Google Scholar]
  • 13.Hill, W. E., S. P. Keasler, M. W. Truckess, P. Feng, C. A. Kaysner, and K. A. Lampel. 1990. Polymerase chain reaction identification of Vibrio vulnificus in artificially contaminated oysters. Appl. Environ. Microbiol. 57:707-711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Interstate Shellfish Sanitation Conference. 2003. Issue relating to a Vibrio vulnificus risk management plan for oysters. Interstate Shellfish Sanitation Conference, Columbia, S.C.
  • 15.Jothikumar, N., and M. W. Griffiths. 2002. Rapid detection of Escherichia coli O157:H7 with multiplex real-time PCR assays. Appl. Environ. Microbiol. 68:3169-3171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kaufman, G. E., G. M. Blackstone, M. C. L. Vickery, A. K. Bej, J. Bowers, M. D. Bowen, R. F. Myer, and A. DePaola. 2004. Real-time PCR quantification of Vibrio parahaemolyticus in oysters using an alternative matrix. J. Food Prot. 67:2424-2429. [DOI] [PubMed] [Google Scholar]
  • 17.Kaysner, C. A., and DePaola A., Jr. 2001. Vibrio, p. 405-420. In F. P. Downes and K. Ito (ed.), Compendium of methods for the microbiological examination of food. American Public Health Association, Washington, D.C.
  • 18.Kreger, A. S., and D. Lockwood. 1981. Detection of extracellular toxin(s) produced by Vibrio vulnificus. Infect. Immun. 33:583-590. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kumamoto, K. S., and D. J. Vukich. 1998. Clinical infections of Vibrio vulnificus: a case report and review of the literature. J. Emerg. Med. 16:61-66. [DOI] [PubMed] [Google Scholar]
  • 20.Lee, J. Y., J. B. Eun, and S. H. Choi. 1997. Improving detection of Vibrio vulnificus in Octopus variabilis by PCR. J. Food Sci. 62:179-182. [Google Scholar]
  • 21.Lee, S. E., S. Y. Kim, S. J. Kim, H. S. Kim, J. H. Shin, S. H. Choi, S. S. Chung, and J. H. Rhee. 1998. Direct identification of Vibrio vulnificus in clinical specimens by nested PCR. J. Clin. Microbiol. 36:2887-2892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Linkous, D. A., and J. D. Oliver. 1999. Pathogenesis of Vibrio vulnificus. FEMS Microbiol. Lett. 174:207-214. [DOI] [PubMed] [Google Scholar]
  • 23.Lyon, W. J. 2001. TaqMan PCR for detection of Vibrio cholerae O1, O139, non-O1, and non-O139 in pure cultures, raw oysters, and synthetic seawater. Appl. Environ. Microbiol. 67:4685-4693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Massad, G., and J. D. Oliver. 1987. New selective and differential medium for Vibrio cholerae and Vibrio vulnificus. Appl. Environ. Microbiol. 53: 2262-2264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 26.Morris, J. G., Jr., A. C. Wright, L. M. Simpson, P. K. Wood, D. E. Johnson, and J. D. Oliver. 1987. Virulence of Vibrio vulnificus: association with utilization of transferrin-bound iron and lack of correlation with levels of cytotoxin or protease production. FEMS Microbiol. Lett. 40:55-59. [Google Scholar]
  • 27.Oliver, J. D. 1989. Vibrio vulnificus, p. 552-554. In M. P. Doyle (ed.), Foodborne bacterial pathogens. Marcel Dekker, Inc., New York, N.Y.
  • 28.Panicker, G., M. L. Myers, and A. K. Bej. 2004. Rapid detection of Vibrio vulnificus in shellfish and Gulf of Mexico water by real-time PCR. Appl. Environ. Microbiol. 70:498-507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Panicker, G., M. C. L. Vickery, and A. K. Bej. 2004. Multiplex PCR detection of clinical and environmental strains of Vibrio vulnificus in shellfish. Can. J. Microbiol. 50:911-922. [DOI] [PubMed] [Google Scholar]
  • 30.Patel, V. J., E. Gardner, and C. S. Burton. 2002. Vibrio vulnificus septicemia and leg ulcer. J. Am. Acad. Dermatol. 46:S144-145. [DOI] [PubMed] [Google Scholar]
  • 31.Peeler, J. T., G. A. Houghtby, and A. P. Rainosek. 1992. The most probable number technique, p. 105-120. In F. P. Downes and K. Ito (ed.), Compendium of methods for the microbiological examination of food. American Public Health Association, Washington, D.C.
  • 32.Pfeffer, C. S., M. F. Hite, and J. D. Oliver. 2003. Ecology of Vibrio vulnificus in estuarine waters of eastern North Carolina. Appl. Environ. Microbiol. 69:3526-3531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Potasman, I., A. Paz, and M. Odeh. 2002. Infectious outbreaks associated with bivalve shellfish consumption: a worldwide perspective. Clin. Infect. Dis. 35:921-928. [DOI] [PubMed] [Google Scholar]
  • 34.Rychilk, W., and R. E. Rhoads. 1989. A computer program for choosing optimal oligonucleotides for filter hybridization, sequencing and in vitro amplification of DNA. Nucleic Acids. Res. 17:8543-8551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tamplin, M. L., G. E. Rodrick, N. J. Blake, and T. Cuba. 1982. Isolation and characterization of Vibrio vulnificus from two Florida estuaries. Appl. Environ. Microbiol. 44:1466-1470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tamplin, M. L., A. L. Martin, A. D. Ruple, D. W. Cook, and C. W. Kasper. 1991. Enzyme immunoassay for identification of Vibrio vulnificus in seawater, sediment, and oysters. Appl. Environ. Microbiol. 57:1235-1240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tamplin, M. L., and G. M. Capers. 1992. Persistence of Vibrio vulnificus in tissues of gulf coast oysters, Crassostrea virginica, exposed to seawater disinfected with UV light. Appl. Environ. Microbiol. 58:1506-1510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Weichart, D., D. McDougald, D. Jacobs, and S. Kjelleberg. 1997. In situ analysis of nucleic acids in cold-induced nonculturable Vibrio vulnificus. Appl. Environ. Microbiol. 63:2754-2758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wright, A. C., J. G. J. Morris, D. R. J. Maneval, K. Richardson, and J. B. Kaper. 1985. Cloning of the cytotoxin-hemolysin gene of Vibrio vulnificus. Infect. Immun. 50:922-924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wright, A. C., G. A. Miceli, W. L. Landry, J. B. Christy, W. D. Watkins, and J. G. Morris, Jr. 1993. Rapid identification of Vibrio vulnificus on nonselective media with an alkaline phosphatase-labeled oligonucleotide probe. Appl. Environ. Microbiol. 59:541-546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Wright, A. C., R. T. Hill, J. A. Johnson, M. C. Roghman, R. R. Colwell, and J. G. Morris, Jr. 1996. Distribution of Vibrio vulnificus in the Chesapeake Bay. Appl. Environ. Microbiol. 62:717-724. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES