Skip to main content
Cancer Biomarkers: Section A of Disease Markers logoLink to Cancer Biomarkers: Section A of Disease Markers
. 2020 Mar 31;27(4):433–443. doi: 10.3233/CBM-190559

ELFN1-AS1 accelerates the proliferation and migration of colorectal cancer via regulation of miR-4644/TRIM44 axis

Ren Lei a,*, Liuchun Feng b, Deng Hong a
PMCID: PMC12662313  PMID: 31929141

Abstract

Faced with the increasing colorectal cancer (CRC) cases, the interrogation of pivotal molecules in CRC appears to be vitally important. Long non-coding RNAs (lncRNAs) are well-known regulators of gene expression at transcriptional, post-transcriptional or epigenetic level, among which the competing endogenous RNA (ceRNA) network is a common way that lncRNAs exert their properties. The current study aimed to provide a new insight into improving the outcomes of CRC patients. Our study detected that ELFN1-AS1 expression was elevated in CRC tissues and cells, and ELFN1-AS1 upregulation was correlated with poor prognosis of CRC sufferers. Besides, it was viewed that ELFN1-AS1 knockdown impeded the proliferation and migration abilities as well as activated the apoptosis ability of CRC cells. In subsequence, mechanism assays also displayed that ELFN1-AS1 targeted miR-4644 to augment TRIM44 level. Finally, rescue experiments confirmed that TRIM44 took part in the ELFN1-AS1-medatied promotional influences on CRC cells proliferation and migration. In conclusion, ELFN1-AS1 exerted pro-proliferation, anti-apoptosis and pro-migration functions on CRC cells by acting as a sponge of miR-4644 to increase TRIM44 expression at mRNA and protein level, providing an additional molecule responsible for the carcinogenesis and progression for CRC.

Keywords: Colorectal cancer (CRC), ELFN1-AS1, miR-4644, TRIM44

1. Introduction

In developing countries, the number of new cases and even mortalities of cancers is steadily increasing owing to rapid economic development and aging population. Colorectal cancer (CRC) arouses the attention of researchers for its second highest incidence and third highest mortality among cancers [1, 2]. There are several treatment patterns for CRC, such as neoadjuvant chemoradiotherapy with radical surgery, surgical resection and anal retention [3]. In Asia, the overall cure rate of CRC is still far from satisfaction in past decades and the 5-year survival remains at nearly 60%, which are largely due to cancer recurrence and metastasis [4, 5].

In the human genome, only 1 to 2% genes encodes proteins and the other genes are non-coding RNAs (ncRNAs) involving small ncRNAs (miRNAs, piRNAs and siRNAs) and long ncRNAs (lncRNAs) with at least 200 nucleotides in length [6, 7, 8, 9]. Increasing evidence has reported that aberrantly expressed lncRNAs are associated with the progression of CRC, either play oncogenic roles or develop tumor suppressor functions in the biological processes [10, 11, 12]. For examples, lncRNA ABHD11-AS1 boosts cell proliferation and invasion in CRC through miR-1254-WNT11 pathway [13]; lncRNA SNHG6 regulates EZH2 expression by sponging miR-26ab and miR-214 in CRC [14]; lncRNA BLACAT1 influences cell proliferation by epigenetic silencing of p15 and indicates a dismal prognosis of CRC [15]. However, the contribution of lncRNAs to CRC is still not completely researched.

LncRNA ELFN1 antisense RNA 1 (ELFN1-AS1) is an upregulated lncRNA in CRC in the cancer genome atlas (TCGA) database. Before its official name was assigned, ELFN1-AS1 was studied as UniGene cluster Hs.104073 and UniGene cluster Hs.633957 in several human tumors [16, 17, 18]. Recently, ELFN1-AS1 was identified as a novel primate gene with possible microRNA function expressed mainly in human cancers and predicted to be key lncRNAs in early colon adenocarcinoma (COAD) [19, 20]. However, the detailed role and regulatory mechanism of ELFN1-AS1 in CRC are not known yet.

The purpose of our research is to interrogate the possible function and molecular mechanism underlying ELFN1-AS1 in CRC. In this paper, we firstly tested that ELFN1-AS1 was heightened in CRC and its knockdown hindered cell proliferation and migration as well as activated cell apoptosis of CRC cells. Since that ELFN1-AS1 located in the cytoplasm could mediate TRIM44 expression but not affect the activity of TRIM44 promoter, we further discovered the competing endogenous RNA (ceRNA) network constituted by ELFN1-AS1, miR-4644 and TRIM44, where ELFN1-AS1 targeted miR-4644 to upregulate TRIM44 expression. Rescue experiments confirmed that ELFN1-AS1 promoted CRC cells proliferation and migration via miR-4644/TRIM44 axis.

2. Materials and methods

2.1. Clinical samples

Sixty-two pairs of tumor samples and normal CRC tissues were collected from patients who underwent surgical resection in the Affiliated Hospital of Southwest Medical University. The fresh tissues were immediately frozen in liquid nitrogen and maintained at -80C. This experiment was approved by the ethics committee of the Affiliated Hospital of Southwest Medical University. All patients involved signed written informed consent.

2.2. Cell culture

Normal colorectal cell (FHC) and CRC cells (HCT116, SW620, HT29, LoVo) were all obtained from the Shanghai Cell Bank of the Chinese Academy of Sciences (China). Cells were all cultivated in RPMI-1640 medium (HyClone, Logan, UT, USA) with 1% penicillin-streptomycin antibiotics (Hyclone) and 10% heat-inactivated fetal bovine serum (FBS; Thermo Fisher Scientific, Waltham, MA, USA). Cells were cultured at 37C with 5% CO2.

2.3. Cell transfection

As for transfection, confluent LoVo and HT29 cells at 50–80% were put into 6-well plates. The specific shRNAs of ELFN1-AS1 (shELFN1-AS1#1/2/3) and shNC from Genechem (Shanghai, China) were separately transfected into HT29 and LoVo cells, of which shELFN1-AS1#2 induced the highest interference efficiency and decreased ELFN1-AS1 relative expression from 99.93% to 21.39% on average. shELFN1-AS1#2 displayed the second highest knockdown efficiency, reducing ELFN1-AS1 relative expression from 100% to 20% on average. The mimics and inhibitors of miR-4644 and corresponding NCs were constructed by Genepharma (Shanghai, China). The TRIM44-overexpression vectors (pcDNA3.1/TRIM44, also written as TRIM44) and empty pcDNA3.1 vectors were obtained from Genepharma. Cell transfection which lasted for 48 h was routinely conducted in triplicate via Lipotransfectamine 3000 (Thermo Fisher Scientific).

2.4. Quantitative real-time PCR (qRT-PCR)

qRT-PCR was performed to explore the expression of RNA. Total RNA from HT29 or LoVo cells was obtained via TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The reverse transcription of RNA into cDNA was accomplished using PrimeScript RT reagent Kit (Takara, Tokyo, Japan). Subsequently, SYBR Green PCR Master Mix (Roche, Mannheim, Germany) on an ABI7300 real-time PCR machine (Applied Biosystems, Foster City, CA, USA) was carried out. Gene expression was calculated in triplicate by 2-ΔΔCt method, U6 and GAPDH served as normalized controls. PCR primer sequences were listed in Supplementary Table 1.

2.5. RNA extraction and microarray analysis

Trizol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA as instructed by the manufacturers. The RNA quality affirmed through formaldehyde agarose gel electrophoresis was quantified by NanoDrop ND-1000. The samples (CRC tissues and non-cancerous tissues) were utilized to synthesize double-stranded cDNA, which was labeled and then hybridized to the LncRNA Expression Microarray (Arraystar 8x60Kv3.0, Rockville, USA). Post hybridization, the arrays were rinsed and the slides were scanned with an Agilent Microarray Scanner (Agilent p/n G2565BA). These data were exported as pair files with the assistance of the Agilent Feature Extraction. The differentially expressed genes were identified by the random variance model and the P-value was calculated via the paired t-test.

2.6. Cell counting kit-8 (CCK-8) assay

Briefly, transfected LoVo and HT29 cells at a cell concentration of 2000 per well were seeded into 96-well plates. After 24, 48, 72, 96 h’s incubation, each well was supplemented with CCK-8 solution (Dojindo, Tokyo, Japan) and cultured for extra 4 h. A multi-mode plate reader (Bio-Tek Instruments, Hopkinton, MA, USA) was utilized to measure the absorbance values at 450 nm.

2.7. 5-ethynyl-2’-deoxyuridine (EdU) staining

The Click-iT Alexa Fluor 488 Imaging Kit (Invitrogen) was utilized in triplicate as the supplier required. Transfected LoVo and HT29 cells were washed twice with 3% bovine serum albumin (BSA; Sigma-Aldrich, Burlington, MA, USA). Then, cells were maintained in EdU-Click reaction-mix and rinsed with 3% BSA. Cell proliferative ability was observed after cell nuclei were stained with DAPI in the dark.

2.8. Caspase-3 activity assay

Transfected HT29 or LoVo cells were cultivated with 1 mL PBS (Thermo Fisher Scientific). Cells were centrifuged for 10 min at 4C after homogenization. Pellets were collected and put in lysis buffer (Beyotime, Shanghai, China). Caspase-3 activity was measured using lysates, assay buffer and Caspase-3 substrate at 37C for 2 h’s incubation. The absorbance values at 405 nm of three independent experiments were examined.

2.9. Transwell assay

After transfection, CRC cells were planted into 24-well plates at a density of 1 × 105 cells in each well, and seeded into the upper chambers (Corning, NY, USA) with serum-free medium. Medium containing 10% FBS was added to the lower chambers. Cell migration occurred during the 12 h’s incubation. Cells on the top side of the filter were scrapped, while migrated cells were fixed with 70% methanol (Beyotime) and stained with 0.1% crystal violet (Beyotime). Migrated cells were visualized and counted in triplicate under a microscope (Olympus, Tokyo, Japan).

2.10. Bioinformatics analysis

According to TCGA database (http://gepia.cancer-pku.cn/index.html), the expression of ELFN1-AS1 was dramatically up-regulated in CRC tissues. DIANA tools (http://carolina.imis.athena-innovation.gr/diana_ tools/web/index.php?r=lncbasev2%2Findex-predicted) and starBase v3.0 (http://starbase.sysu.edu.cn/) predicted that ELFN1-AS1 and TRIM44 contained the binding sites for miR-4644.

2.11. Luciferase reporter assay

TRIM44 promoter was sub-cloned into downstream of the firefly luciferase gene in the pGL3-basic (Gene-chem). CRC cells were co-transfected with the pGL3-TRIM44 promoter and shELFN1-AS1#2 or shNC to affirm the post-transcriptional regulation of ELFN1-AS1 on TRIM44. The wild-type plasmids of ELFN1-AS1 and TRIM44 (ELFN1-AS1-WT, TRIM44-WT; Genepharma), along with their respective mutant plasmids (ELFN1-AS1-Mut, TRIM44-Mut; Genepharma) were co-transfected with miR-4644 mimics or NC mimics by Lipotransfectamine 3000. After 48 h of incubation, the firefly and Renilla luciferase activities were quantified with Dual Luciferase Report Assay System (Promega, Madison, WI, USA). Experimental results were normalized to Renilla activity and repeated three times.

2.12. Ago2-RNA immunoprecipitation (RIP) Assay

Ago2-RIP assay was carried out via Magna RIP™RNA Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA) in line with the standard method. Cells at a confluence of 80–90% were cultivated in RIP lysis buffer (Solarbio, Beijing, China) containing magnetic bead conjugated with anti-Ago2 or anti-IgG antibody (Millipore) overnight at 4C. The immunoprecipitated RNA was acquired after digesting with proteinase K (Absin, Shanghai, China). The purified RNA from three independent experiments was subjected to qRT-PCR method.

2.13. RNA fluorescent in-situ hybridization (FISH) Assay

In this experiment, RNAscope Multiplex Fluorescent Reagent Kit v2 (Advanced Cell Diagnostics, Newark, CA, USA) was utilized. Cells were fixed in 4% paraformaldehyde for 30 min, followed by hybridization with the ELFN1-AS1 probe at 40C for 2 h in HybEZ Oven (Advanced Cell Diagnostics). After washing, the cell nuclei were counterstained with DAPI (blue). Representative pictures were captured using a fluorescence microscope (Nikon, Tokyo, Japan).

2.14. Nuclear-cytoplasmic fractionation

Cells were grown in 10 cm dishes and isolated into two tubes for subcellular fractions and whole-cell extraction. After 5 min of centrifugation at 1000 × g at 4C, cell pellets were resuspended in 500-μL lysis buffer (pH 7.5, 1.5 mM MgCl2, 10 mM Tris-HCl, 140 mM NaCl, 0.05% IGEPAL, 10 U/mL RNasin and protease inhibitor cocktail) and then cultured on ice for transient 10 min. TRIzol Reagent was added into one tube including cell lysate for total RNA extraction. In order to obtain nuclear and cytoplasmic fractions, 500-μL lysis buffer with sucrose was added into a clean tube and the mixed with the cell lysate without mixing the two phases. After being centrifuged at 12000 × g for 10 min at 4C, about 500-μL upper phase was gathered as cytoplasmic fraction and the rest of pellet was resuspended in 500-μL lysis buffer as nuclear fraction. Finally, cytoplasmic and nuclear RNAs were harvested using TRIzol Reagent and dissected via qRT-PCR.

2.15. Western blotting

Cells were lysed on ice for 30 min in RIPA buffer (Sigma-Aldrich). Pierce BCA Protein Assay kit (Ther-mo Fisher Scientific) was utilized to measure the protein concentration based on the specification. Protein samples were separated by SDS-PAGE on a 15% gel and then transferred to PVDF membranes (Millipore). Following blocking with 5% BSA, membranes were treated with anti-TRIM44 antibody (1/2000, ab23 6422, Abcam) and anti-GAPDH antibody (1/1000, ab8245, Abcam) at 4C overnight. Proteins of interest were assessed for more than two times with secondary antibodies using an infrared imaging system (Thermo Fisher Scientific).

2.16. Statistical analysis

Data from at least three independent experiments were expressed as mean ± SD and processed by SPSS 22.0 (IBM, Chicago, IL, USA). Comparisons between two groups were analyzed by the t-test, while comparisons among multiple groups were performed by ANOVA, and pairwise comparison was tested using post-hoc test. P-values less than 0.05 were considered statistically significant.

3. Results

3.1. The silencing of ELFN1-AS1 inhibited the proliferation and migration and activated the apoptosis in CRC

The significantly elevated expression of ELFN1-AS1 in colon adenocarcinoma (COAD) tissues (n= 275) was discovered from the cancer genome atlas (TCGA) database (p< 0.05) (Fig. 1A). Besides, it was detected by qRT-PCR that the level of ELFN1-AS1 was promoted in CRC tissues (n= 62) than in paired normal tissues (n= 62) (Fig.  S1A). More importantly, it was evaluated that the higher level of ELFN1-AS1 (n= 31) is related with poorer prognosis of CRC patients (Fig.  S1B). Then we examined the expression of ELFN1-AS1 was elevated in CRC cells (HCT116, SW620, HT29 and LoVo) than in normal human colorectal FHC cells (Fig. 1B). To affirm the function role of ELFN1-AS1 in CRC, we performed loss-of-function assays through transfection of shELFN1-AS1#1 (sh#1), shELFN1-AS1#2 (sh#2) or shELFN1-AS1#3 (sh#3). Among the three kinds of transfections, sh#1 and sh#2 exhibited better interference efficiencies than sh#3 due to the more overt decline of ELFN1-AS1 expression (Fig. 1C). CCK8 experiment showed that cell viability was significantly repressed by sh#1/2, among which sh#2 caused a better outcome (Fig. 1D). Hence sh#2 was chosen for later function assays. EdU assay demonstrated that cell proliferation was hindered by sh#2 and caspase-3 activity assay indicated that cell apoptosis rate was raised by sh#2 (Fig. 1E and F). Besides, in transwell assay, ELFN1-AS1 silence dramatically inhibited cell migration (Fig. 1G). In summary, ELFN1-AS1 was overexpressed in CRC and its silencing inhibited the cellular activities of CRC cells.

Figure 1.

Figure 1.

ELFN1-AS1 silencing inhibited the proliferation and migration and activated the apoptosis in CRC. (A) TCGA result of the markedly elevated expression of ELFN1-AS1 in colon adenocarcinoma (COAD) tissues. (B) The up-regulation of ELFN1-AS1 in CRC cells was detected by qRT-PCR. (C) The inference efficiency of sh-ELFN1-AS1#1/2/3 in LoVo and HT29 cells was determined by qRT-PCR. (D and E) The influences of ELFN1-AS1 deficiency on cell proliferation were examined by CCK-8 and EdU assays. (F) Caspase-3 activity assay was employed for test of cell apoptosis in sh#2 (sh-ELFN1-AS1#2)-transfected cells. (G) Transwell migration assay was adopted for examination of cell migration. P< 0.05, P< 0.01.

3.2. ELFN1-AS1 modulated TRIM44 expression at post-transcription level

We employed microarray analysis to analyze the top 500 upregulated genes in CRC tissues, among which TRIM44, DPEP1, CDH3, CDK6 and RUNX2 were the top five mRNAs (Fig. 2A). To validate whether ELFN1-AS1 could regulate the expression of these genes, we performed qRT-PCR assay. And the results discovered that when ELFN1-AS1 was silenced, TRIM44 was the most remarkably downregulated gene (Fig. 2B). Since TRIM44 is an oncogene in multiple cancers, including CRC [21], we further explored whether ELFN1-AS1 influenced CRC progression by TRIM44. We then tested the expression level of TRIM44 by qRT-PCR and the results showed that TRIM44 was distinctly upregulated in CRC tissues (n= 62) (Fig.  S1C) and cells (Fig. 2C). And the silencing of ELFN1-AS1 could downregulate TRIM44 mRNA expression but couldn’t pose an impact on the luciferase activity of TRIM44 promoter (Fig. 2D and E). In addition, based on the results from FISH and nuclear-cytoplasmic fractionation assays, ELFN1-AS1 was located in the cytoplasm of LoVo and HT29 cells (Fig. 2F and G). Taken together, ELFN1-AS1 could regulate TRIM44 expression.

Figure 2.

Figure 2.

ELFN1-AS1 regulated TRIM44 expression post-transcriptionally. (A) Five mRNAs containing TRIM44, DPEP1, CDH3, CDK6 and RUNX2 were significantly overexpressed in CRC tissues, as shown in the heatmap. (B) In LoVo and HT29 cells, the impacts of ELFN1-AS1 inhibition on the expression of mRNAs above were affirmed through qRT-PCR. (C) TRIM44 was also heightened in CRC cells, as measured by qRT-PCR. (D) qRT-PCR analysis of TRIM44 expression under repressed ELFN1-AS1 expression. (E) Luciferase reporter validation of the impact of ELFN1-AS1 knockdown on the activity of TRIM44 promoter. (F and G) FISH and nuclear-cytoplasmic fractionation determined the position of ELFN1-AS1 in CRC cells. P< 0.05, P< 0.01.

3.3. ELFN1-AS1 sponged miR-4644 to relieve TRIM44

Considering that lncRNAs can regulate some mRNAs expression through targeting their shared miRNAs in ceRNA network [22, 23], we hypothesized that ELFN1-AS1 might target some miRNA to modulate the expression of TRIM44. The Venn diagram was produced by searching the miRNAs binding with ELFN1-AS1 on DIANA tools and the miRNAs targeting TRIM44 on starBase v3.0, which exhibited the only common miRNA of ELFN1-AS1 and TRIM44: hsa-miR-4644 (Fig. 3A). MiR-4644 was selected for further investigation owing to its tumor-suppressor roles in human carcinomas [24]. Subsequently, qRT-PCR results elucidated that miR-4644 was expressed at low levels in CRC tissues (n= 62) (Fig.  S1D) and cells (Fig. 3B). Next, we explored the direct regulation of ELFN1-AS1 on miR-4644 or miR-4644 on TRIM44. It was observed that miR-4644 expression was increased by ELFN1-AS1 downregulation and TRIM44 expression was decreased by miR-4644 overexpression (Fig. 3C–E). To probe the specific molecular mechanism of ELFN1-AS1 in CRC, we conducted mechanism experiments. The presumed binding sequences between miR-4644 and ELFN1-AS1 (or TRIM44) and the mutated binding sequences were all shown in Fig. 3F. Luciferase reporter assays were employed to validate the binding between miR-4644 and ELFN1-AS1 (or TRIM44), whose results indicated that only the luciferase activity of ELFN1-AS1-WT (or TRIM44-WT) reporter was restrained when miR-4644 was overexpressed (Fig. 3G). RIP assays confirmed that ELFN1-AS1, TRIM44 and miR-4644 were all abundant in Ago2 group but not in IgG group, suggesting that ELFN1-AS1, TRIM44 and miR-4644 constituted the ceRNA network (Fig. 3H). Sequentially, we examined the co-regulation of miR-4644 and ELFN1-AS1 on TRIM44. MiR-4644 was downregulated by miR-4644 inhibitor (Fig. 3I). qRT-PCR and western blot proved that the mRNA and protein levels of TRIM44 were both reduced after ELFN1-AS1 deficiency whereas recovered partly after miR-4644 inhibition (Fig. 3J and K). To sum up, ELFN1-AS1 served as a sponge of miR-4644 to regulate TRIM44.

Figure 3.

Figure 3.

ELFN1-AS1 sponged miR-4644 to relieve TRIM44. (A) The miRNAs targeting TRIM44 from starBase v.3.0 and the targets of ELFN1-AS1 from DIANA tools were gathered to generate the Venn diagram. (B) qRT-PCR results of the expression of miR-4644 in CRC cells and normal human colorectal FHC cells. (C–E) qRT-PCR was used to evaluate the influences of ELFN1-AS1 silencing on miR-4644 or miR-4644 overexpression on TRIM44. (F) The assumed binging sites between miR-4644 and ELFN1-AS1 or TRIM44 and the corresponding mutant binding sites were displayed. (G) Luciferase reporter assays were performed to examine the effect of miR-4644 promotion on the luciferase activity of ELFN1-AS1-Wt or TRIM44-Wt reporter in LoVo and HT29 cells. (H) The relationship among ELFN1-AS1, miR-4644 and TRIM44 was determined via RIP assay. (I–K) The co-effects of ELFN1-AS1 and miR-4644 on TRIM44 expression in mRNA and protein levels were analyzed through qRT-PCR and western blot. P< 0.05, P< 0.01.

3.4. ELFN1-AS1 affected the biological functions of CRC via miR-4644/TRIM44 axis

Rescue experiments were carried out to affirm the whole modulation mechanism underlying ELFN1-AS1. LoVo cells were co-transfected with shNC, sh#2 or sh#2 + TRIM44. The transfection efficacy was verified utilizing qRT-PCR (Fig. 4A). In CCK-8 and EdU assays, cell proliferation was firstly hampered by absence of ELFN1-AS1 but re-gained via TRIM44 overexpression (Fig. 4B and C). And ELFN1-AS1 downregulation markedly activated cell apoptosis, which was neutralized by enforced expression of TRIM44 (Fig. 4D). Through transwell assay, we observed that the migration was obstructed when ELFN1-AS1 was knocked down, and this effect was reversed in part when TRIM44 level was increased (Fig. 4E). In conclusion, TRIM44 overexpression rescued the inhibitory effects of ELFN1-AS1 silence on biological processes of CRC.

Figure 4.

Figure 4.

ELFN1-AS1 affected the biological functions of CRC via miR-4644/TRIM44 axis. (A) The co-transfection efficiency in LoVo cells were dissected by qRT-PCR. (B and C) CCK-8 and EdU experiments were performed to examine cell proliferation in different transfected cells. (D and E) Caspase-3 activity and transwell assays were adopted to estimate cell apoptosis and migration, respectively. P< 0.05, P< 0.01.

4. Discussion

The high expression of ELFN1-AS1 in CRC was once revealed but the function role of ELFN1-AS1 is not clearly explained. In this study, we found that ELFN1-AS1 was overexpressed in CRC and ELFN1-AS1 depletion was an obstruction for physiological processes by repressing the proliferation and migration, and boosting the apoptosis of CRC cells. Furthermore, a ceRNA network among ELFN1-AS1, miR-4644 and TRIM44 was demonstrated. ELFN1-AS1 functioning as a ceRNA targeted miR-4644 for the activation of TRIM44. We indicated the existence of ELFN1-AS1/miR-4644/TRIM44 axis in CRC.

By searching TCGA database, we discovered the upregulation of ELFN1-AS1 in colon adenocarcinoma (COAD) tissues and this phenomenon was also validated in CRC tumors and cells, which were in consistent with the data from past researches that ELFN1-AS1 was overexpressed in COAD and possibly participate the pathological activities of CRC cells [19, 20]. To further explore the role of ELFN1-AS1 in CRC, we carried out loss-of-function assay, which, for the first time, revealed that ELFN1-AS1 downregulation dramatically obstructed the cellular processes of CRC cells.

Extensive evidence has proved that long non-coding RNAs (lncRNAs) contribute to physiological activities of multiple carcinomas via various mechanisms, such as ceRNA network, RNA-binding protein (RBP) interactions and epigenetic regulation [25, 26, 27, 28]. In the ceRNA network, lncRNAs sponge miRNAs as decoys to relieve target mRNAs at post-transcriptional level [29, 30]. In this study, we unexpectedly found the post-transcriptional regulation of ELFN1-AS1 on differentially overexpressed tripartite motif containing 44 (TRIM44), a famous oncogene in multiple carcinomas, CRC contained. For instances, elevated TRIM44 boosts the progression of intrahepatic cholangiocarcinoma through inducing EMT by MAPK signaling [31]; LINC00265 accelerates glycolysis and lactate production of CRC by miR-216b-5p/TRIM44 axis [21]; miR-101-3p restrains EMT to weaken proliferation and metastasis in glioblastoma via decreasing TRIM44 [32]. Given that ELFN1-AS1 was detected to be mainly localized in the cytoplasm, we further confirmed the potential ceRNA role of ELFN1-AS1 in CRC. Has-miR-4644, the only one miRNA shared by ELFN1-AS1 and TRIM44, was gained from the Venn diagram produced by venn website. Mechanism experiments validated that ELFN1-AS1 sponged miR-4644 to modulate TRIM44 expression.

In the end, rescue assays were conducted to affirm the whole mechanism underlying ELFN1-AS1 in CRC, which demonstrated that ELFN1-AS1 enhanced cell proliferation, migration and suppressed apoptosis in CRC via miR-4644/TRIM44 axis. These findings suggested that ELFN1-AS1/miR-4644/TRIM44 axis provides a novel insight into the treatment of CRC patients.

Acknowledgments

We thank the contributions from all participators in this research.

Supplementary data

Table  S1.

PCR primer sequences

Gene name PCR primers
ELFN1-AS1 F: AGTGAATTCGGGGTGCAGAG R: TTCCTGGCTGAAGAACCTGC
TRIM44 F: CTGATGAGGAGCAGAAGGCC R: GCTTGGGCCATCTGAGTCAT
DPEP1 F: TGTGGTGAAGGAGCTGAACC R: CCGAGGAGTGGCTGAAGATG
CDH3 F: TAGTGGTCCACGTGGAGGAT R: GTAGACACACACAGGCTCCCA
CDK6 F: ACTATAGATGCGGGCAAGGC R: TCACACCGAGTAGTGCATCG
RUNX2 F: CTCCAACCCACGAATGCA R: TAGGTGTGGTAGTGAGTGGTGG
miR-4644 F: TGGAGAGAGAAAAGAGACAGAAGTG R: CTCTACAGCTATATTGCCAGCCAC
GAPDH F: CCACCTGGTGCTCAGTGTAG R: CGTTCAGCTCAGGGATGAC
U6 F: CTCGCTTCGGCAGCACA R: AACGCTTCACGAATTTGCGT

Supplementary Fig.  S1.

Supplementary Fig.  S1.

(A) qRT-PCR quantified ELFN1-AS1 expression in CRC tissues (n= 62) and paired normal tissues (n= 62). (B) Overall survival of CRC patients with high (n= 31) or low (n= 31) ELFN1-AS1 expression was analyzed through Kaplan-Meier surviving curves. (C)The levels of TRIM44 in CRC tissues (n= 62) and paired normal tissues (n= 62) were analyzed by qRT-PCR. (D) The expression of miR-4644 in CRC tissues (n= 62) and paired normal tissues (n= 62) was evaluated by qRT-PCR. P< 0.01.

Conflict of interest

There are no conflicts of interest.

References

  • [1]. Torre L.A., Bray F., Siegel R.L., Ferlay J., Lortet-Tieulent J. and Jemal A., Global cancer statistics, 2012, CA Cancer J Clin 65 (2015), 87–108. [DOI] [PubMed] [Google Scholar]
  • [2]. Ferlay J., Soerjomataram I., Dikshit R., Eser S., Mathers C., Rebelo M., Parkin D.M., Forman D. and Bray F., Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012, Int J Cancer 136 (2015), E359–86. [DOI] [PubMed] [Google Scholar]
  • [3]. Benson A.B., 3rd, Venook A.P., Bekaii-Saab T., Chan E., Chen Y.J., Cooper H.S., Engstrom P.F., Enzinger P.C., Fenton M.J., Fuchs C.S., Grem J.L., Grothey A., Hochster H.S., Hunt S., Kamel A., Kirilcuk N., Leong L.A., Lin E., Messersmith W.A., Mulcahy M.F., Murphy J.D., Nurkin S., Rohren E., Ryan D.P., Saltz L., Sharma S., Shibata D., Skibber J.M., Sofocleous C.T., Stoffel E.M., Stotsky-Himelfarb E., Willett C.G., Gregory K.M. and Freedman-Cass D., Rectal Cancer, Version 2.2015, J Natl Compr Canc Netw 13 (2015), 719–28; quiz 728. [DOI] [PubMed] [Google Scholar]
  • [4]. Moghimi-Dehkordi B. and Safaee A., An overview of colorectal cancer survival rates and prognosis in Asia, World J Gastrointest Oncol 4 (2012), 71–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5]. Mazzotti F., Cucchetti A., Claassen Y.H.M., Bos A., Bastiaannet E., Ercolani G. and Dekker J.W.T., Years of Life Lost for Older Patients After Colorectal Cancer Diagnosis, World J Surg (2019). [DOI] [PubMed] [Google Scholar]
  • [6]. Djebali S., Davis C.A., Merkel A., Dobin A., Lassmann T., Mortazavi A., Tanzer A., Lagarde J., Lin W., Schlesinger F., Xue C., Marinov G.K., Khatun J., Williams B.A., Zaleski C., Rozowsky J., Roder M., Kokocinski F., Abdelhamid R.F., Alioto T., Antoshechkin I., Baer M.T., Bar N.S., Batut P., Bell K., Bell I., Chakrabortty S., Chen X., Chrast J., Curado J., Derrien T., Drenkow J., Dumais E., Dumais J., Duttagupta R., Falconnet E., Fastuca M., Fejes-Toth K., Ferreira P., Foissac S., Fullwood M.J., Gao H., Gonzalez D., Gordon A., Gunawardena H., Howald C., Jha S., Johnson R., Kapranov P., King B., Kingswood C., Luo O.J., Park E., Persaud K., Preall J.B., Ribeca P., Risk B., Robyr D., Sammeth M., Schaffer L., See L.H., Shahab A., Skancke J., Suzuki A.M., Takahashi H., Tilgner H., Trout D., Walters N., Wang H., Wrobel J., Yu Y., Ruan X., Hayashizaki Y., Harrow J., Gerstein M., Hubbard T., Reymond A., Antonarakis S.E., Hannon G., Giddings M.C., Ruan Y., Wold B., Carninci P., Guigo R. and Gingeras T.R., Landscape of transcription in human cells, Nature 489 (2012), 101–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7]. Mattick J.S. and Makunin I.V., Non-coding RNA, Hum Mol Genet 15(S1) (2006), R17–29. [DOI] [PubMed] [Google Scholar]
  • [8]. Jia H., Osak M., Bogu G.K., Stanton L.W., Johnson R. and Lipovich L., Genome-wide computational identification and manual annotation of human long noncoding RNA genes, Rna 16 (2010), 1478–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9]. Cabili M.N., Trapnell C., Goff L., Koziol M., Tazon-Vega B., Regev A. and Rinn J.L., Integrative annotation of human large intergenic noncoding RNAs reveals global properties and specific subclasses, Genes Dev 25 (2011), 1915–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10]. Xie X., Tang B., Xiao Y.F., Xie R., Li B.S., Dong H., Zhou J.Y. and Yang S.M., Long non-coding RNAs in colorectal cancer, Oncotarget 7 (2016), 5226–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11]. Zhou J.F., Wang H.G., Ma T.H., Yan W., Wu S.N., Shi Y.T. and Yang X.Z., Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis, Eur Rev Med Pharmacol Sci 22 (2018), 7710–7715. [DOI] [PubMed] [Google Scholar]
  • [12]. Li J., Lian Y., Yan C., Cai Z., Ding J., Ma Z., Peng P. and Wang K., Long non-coding RNA FOXP4-AS1 is an unfavourable prognostic factor and regulates proliferation and apoptosis in colorectal cancer, Cell Prolif 50 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13]. He D., Yue Z., Liu L., Fang X., Chen L. and Han H., Long noncoding RNA ABHD11-AS1 promote cells proliferation and invasion of colorectal cancer via regulating the miR-1254-WNT11 pathway, J Cell Physiol 234 (2019), 12070–12079. [DOI] [PubMed] [Google Scholar]
  • [14]. Xu M., Chen X., Lin K., Zeng K., Liu X., Xu X., Pan B., Xu T., Sun L., He B., Pan Y., Sun H. and Wang S., lncRNA SNHG6 regulates EZH2 expression by sponging miR-26a/b and miR-214 in colorectal cancer, J Hematol Oncol 12 (2019), 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15]. Su J., Zhang E., Han L., Yin D., Liu Z., He X., Zhang Y., Lin F., Lin Q., Mao P., Mao W. and Shen D., Long noncoding RNA BLACAT1 indicates a poor prognosis of colorectal cancer and affects cell proliferation by epigenetically silencing of p15, Cell Death Dis 8 (2017), e2665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16]. Polev D.E., Krukovskaia L.L. and Kozlov A.P., Locus HS.633957 expression in human gastrointestinal tract and tumors, Vopr Onkol 57 (2011), 48–9. [PubMed] [Google Scholar]
  • [17]. Krukovskaja L.L., Baranova A., Tyezelova T., Polev D. and Kozlov A.P., Experimental study of human expressed sequences newly identified in silico as tumor specific, Tumour Biol 26 (2005), 17–24. [DOI] [PubMed] [Google Scholar]
  • [18]. Baranova A.V., Lobashev A.V., Ivanov D.V., Krukovskaya L.L., Yankovsky N.K. and Kozlov A.P., In silico screening for tumour-specific expressed sequences in human genome, FEBS Lett 508 (2001), 143–8. [DOI] [PubMed] [Google Scholar]
  • [19]. Polev D.E., Karnaukhova I.K., Krukovskaya L.L. and Kozlov A.P., ELFN1-AS1: a novel primate gene with possible microRNA function expressed predominantly in human tumors, Biomed Res Int 2014 (2014), 398097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20]. Liu J.X., Li W., Li J.T., Liu F. and Zhou L., Screening key long non-coding RNAs in early-stage colon adenocarcinoma by RNA-sequencing, Epigenomics 10 (2018), 1215–1228. [DOI] [PubMed] [Google Scholar]
  • [21]. Sun S., Li W., Ma X. and Luan H., Long Noncoding RNA LINC00265 Promotes Glycolysis and Lactate Production of Colorectal Cancer through Regulating of miR-216b-5p/TRIM44 Axis, Digestion (2019), 1–10. [DOI] [PubMed] [Google Scholar]
  • [22]. Di Agostino S., Valenti F., Sacconi A., Fontemaggi G., Pallocca M., Pulito C., Ganci F., Muti P., Strano S. and Blandino G., Long Non-coding MIR205HG Depletes Hsa-miR-590-3p Leading to Unrestrained Proliferation in Head and Neck Squamous Cell Carcinoma, Theranostics 8 (2018), 1850–1868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23]. Dong L., Qian J., Chen F., Fan Y. and Long J., LINC00461 promotes cell migration and invasion in breast cancer through miR-30a-5p/integrin beta3 axis, J Cell Biochem 120 (2019), 4851–4862. [DOI] [PubMed] [Google Scholar]
  • [24]. Shen Y., Pan Y., Xu L., Chen L., Liu L., Chen H., Chen Z. and Meng Z., Identifying microRNA-mRNA regulatory network in gemcitabine-resistant cells derived from human pancreatic cancer cells, Tumour Biol 36 (2015), 4525–34. [DOI] [PubMed] [Google Scholar]
  • [25]. Kartha R.V. and Subramanian S., Competing endogenous RNAs (ceRNAs): new entrants to the intricacies of gene regulation, Front Genet 5 (2014), 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26]. Hu X., Li Y., Kong D., Hu L., Liu D. and Wu J., Long noncoding RNA CASC9 promotes LIN7A expression via miR-758-3p to facilitate the malignancy of ovarian cancer, J Cell Physiol 234 (2019), 10800–10808. [DOI] [PubMed] [Google Scholar]
  • [27]. Mang Y., Li L., Ran J., Zhang S., Liu J., Li L., Chen Y., Liu J., Gao Y. and Ren G., Long noncoding RNA NEAT1 promotes cell proliferation and invasion by regulating hnRNP A2 expression in hepatocellular carcinoma cells, Onco Targets Ther 10 (2017), 1003–1016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28]. Dong H., Wang W., Mo S., Chen R., Zou K., Han J., Zhang F. and Hu J., SP1-induced lncRNA AGAP2-AS1 expression promotes chemoresistance of breast cancer by epigenetic regulation of MyD88, J Exp Clin Cancer Res 37 (2018), 202. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • [29]. Rafiee A., Riazi-Rad F., Havaskary M. and Nuri F., Long noncoding RNAs: regulation, function and cancer, Biotechnol Genet Eng Rev 34 (2018), 153–180. [DOI] [PubMed] [Google Scholar]
  • [30]. Salmena L., Poliseno L., Tay Y., Kats L. and Pandolfi P.P., A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell 146 (2011), 353–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31]. Peng R., Zhang P.F., Zhang C., Huang X.Y., Ding Y.B., Deng B., Bai D.S. and Xu Y.P., Elevated TRIM44 promotes intrahepatic cholangiocarcinoma progression by inducing cell EMT via MAPK signaling, Cancer Med 7 (2018), 796–808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32]. Li L., Shao M.Y., Zou S.C., Xiao Z.F. and Chen Z.C., MiR-101-3p inhibits EMT to attenuate proliferation and metastasis in glioblastoma by targeting TRIM44, J Neurooncol 141 (2019), 19–30. [DOI] [PubMed] [Google Scholar]

Articles from Cancer Biomarkers: Section A of Disease Markers are provided here courtesy of SAGE Publications

RESOURCES