PIK75 effectively reverses PI3K‒AKT activation caused by palbociclib resistance and synergistically inhibits the progression of esophageal squamous cell carcinoma

Abstract

China is one of the countries with a high incidence of esophageal squamous cell carcinoma (ESCC). At present, the main treatment method for ESCC is surgery combined with chemotherapy and radiotherapy, and the efficacy of drug therapy is not ideal. Cyclin-dependent kinase inhibitors (CDKi) have shown amazing efficacy in treating some types of cancer, especially breast cancer, but their therapeutic effects on ESCC are limited. In the present study, we found that the CDK inhibitor palbociclib could successfully arrest cells in the G0/G1 phase but did not inhibit the proliferation of some types of ESCC cells. Further experiments revealed that activation of the PI3K‒AKT pathway was key for palbociclib resistance. Therefore, we investigated the potential of combining palbociclib with the novel PI3K inhibitor PIK75 to inhibit the growth of ESCC cell lines and xenograft tumors. The combined use of palbociclib and PIK75 synergistically inhibited the expression of the cell cycle proteins CCNE1, CDC6, and CDC25A, as well as the abnormal activation of PIK3CA and AKT phosphorylation. The combination of these two drugs synergistically inhibited tumor cell cycle progression and promoted apoptosis in vitro and in vivo, which provides a promising idea for the treatment of ESCC in the future.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-26858-5.

Introduction

Esophageal cancer, a gastrointestinal malignancy originating from the esophageal mucosal epithelium, is the eighth most common malignancy worldwide and often causes death¹. Esophageal cancer is divided into two subtypes: esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma (EAC), of which ESCC accounts for approximately 90% of esophageal cancer cases in China². The incidence of ESCC varies significantly in different geographical regions, and the incidence and mortality rates are high in Asia, especially in China³. Patients with ESCC have no obvious symptoms in the early stage, and symptoms such as lymphadenopathy and dysphagia only appear in the late stage⁴. As a result, diagnosis occurs mainly in the advanced stages, and the prognosis is extremely poor, with a five-year survival rate of less than 20%⁵. At present, the main treatment method is still surgery combined with chemotherapy and radiotherapy, and therapeutic effects are limited in the advanced stage⁶. Therefore, new treatment strategies for ESCC are urgently needed. In recent decades, advances in molecular biology technology have led to great progress in tumor-targeted therapy. Inhibitors of EGFR, PARP or CDK4/6 have been used for many tumor types, but no targeted drug has been approved for use in ESCC^7,8.

One of the characteristics of malignant tumors is the uncontrolled malignant transformation and proliferation of tumor cells due to disordered cell cycle regulation⁹. Cyclin-dependent kinases (CDKs) are key regulators of the cell cycle, and their dysregulation is a hallmark of many cancers¹⁰. CDK4 and CDK6 are two kinases in a family of CDKs that promote cell division by binding to cyclins to form complexes and are key regulators of the cellular transition to S phase¹¹. CDK4/6 inhibitors effectively prevent the transition from G1 to S phase, inducing cell cycle arrest and apoptosis in cancer cells. Over the past decade, significant progress has been made in the development of CDK inhibitors. To date, United States Food and Drug Administration-approved CDK4/6 inhibitors such as palbociclib, abemaciclib and ribociclib have shown significant advantages in the treatment of breast cancer¹². However, CDK4/6 inhibitors are less effective against digestive tract tumors, especially ESCC. The greatest problem with CDK4/6 inhibitors in the treatment of ESCC is the development of drug resistance, and the combination of drugs to overcome CDK4/6 inhibitor resistance is a common strategy in ESCC treatment¹³. Therefore, identifying the resistance mechanism of CDK4/6 inhibitors to expand their application in ESCC is a current research focus.

The PI3K/AKT signaling pathway is one of the critical intracellular pathways that regulates cell motility, proliferation, and apoptosis¹⁴. Abnormal activation and aberrant mutations in the PI3K/AKT pathway affect and promote the survival and progression of tumor cells in many human cancers^15,16. PI3K consists of a regulatory subunit p85 and a catalytic subunit p110, which phosphorylates the third carbon atom of the inositol ring of PI and recruits signaling proteins to the cell membrane, thereby activating a series of subsequent signaling pathways¹⁷. Abnormalities in the PIK3CA gene, which encodes the catalytic subunit p110α of PI3K, are key and relatively common causes of tumorigenesis and drug resistance in ESCC¹⁸. The expression of PIK3CA could be used as a reference for the poor prognosis of ESCC patients^19,20. PIK3CA mutations are significantly associated with the expression of phosphorylated AKT^19,21. Owing to the important role of PIK3CA, many inhibitors have been discovered and used to inhibit PIK3CA. PIK75 is an inhibitor that selectively inhibits the p110α isoform of PI3K²². Studies have shown that PIK75 effectively inhibits proliferation and induces apoptosis in cancer^23,24. However, the therapeutic role of PIK75 in ESCC has not yet been explored.

In the present study, we wanted to explore whether palbociclib also has good efficacy in ESCC, but unexpectedly, we found that not all ESCC cells were sensitive to palbociclib. RNA sequencing revealed that the PI3K–AKT pathway was abnormally activated in the palbociclib-resistant KYSE30 cells. Therefore, we used the novel p110α inhibitor PIK75 and found that the addition of PIK75 strongly suppressed the phosphorylation of AKT in ESCC cells. The combination of palbociclib and PIK75, which synergistically disrupted the cell cycle process and promoted apoptosis, had better anti-tumor effects by simultaneously disrupting cell cycle progression and survival pathways, providing a new idea for the treatment of ESCC.

Results

The CDK inhibitor palbociclib has limited efficacy on the growth of several ESCC cell line by affecting cell cycle progression

To evaluate the role of CDK inhibitors in ESCC, we treated multiple ESCC cell lines with different concentrations of palbociclib for 48 h (Fig. 1A). The absorbance of MTT in cells was determined at 570 nm, and the IC50 values of the six cell lines were calculated. The IC50 of palbociclib in breast cancer cells is generally at the nM level, and the IC50 values in 30 types of breast cancer cells are less than 570 nM²⁰. Compared with breast cancer cells, ESCC cells were not sensitive to palbociclib^20,25, especially KYSE30, KYSE150 and TE1 cells, which were extremely insensitive to CDK inhibitors, with IC50 values of approximately 20 µM (Fig. 1B). The results of the colony formation assay after treating the six cell lines with 2 µM palbociclib for 7 days revealed that KYSE30, KYSE150 and TE1 cells were insensitive to palbociclib, whereas the number of KYSE410, KYSE450 and KYSE510 colonies was significantly reduced (Fig. 1C). We also evaluated the inhibitory effect of palbociclib on ESCC cells over a longer period of 5 days, and the results were consistent with the above results (Fig. 1D). The proliferation of all six cell lines was inhibited to some extent, but three cell lines, KYSE30, KYSE150 and TE1, were relatively resistant to palbociclib, and KYSE410, KYSE450 and KYSE510 presented significant inhibition of cell growth at low concentrations. In conclusion, we found that some ESCC cells were resistant to palbociclib.

Fig. 1.

The CDK inhibitor palbociclib has limited efficacy upon the growth of several ESCC cells by affecting cell cycle progression. (A) 48 h cell viability assay for palbociclib treatment in different ESCC cell lines, n = 3. (B) Predicted IC50 value of palbociclib in different ESCC cell lines and calculated, presented as mean ± SD. (C) Representative images of colony growth in different ESCC cells with the addition of palbociclib, n = 3. (D) Cell proliferation assay after addition of palbociclib to in different ESCC cell lines, n = 3 (E) Representative images of cell cycle detection by flow technology, n = 3. The Data shown represent the mean ± SD.

To further explore the mode of action of palbociclib, we examined the changes in the cell cycle after palbociclib treatment by flow cytometry (Fig. 1E). We selected KYSE30 and KYSE150 cells, which were insensitive to palbociclib, and KYSE450 cells, which were sensitive to palbociclib. After treatment with palbociclib, the number of cells in the G0/G1 phase significantly increased, and the number of cells in the S phase were significantly decreased. These results indicate that palbociclib effectively affected the cell cycle, but blockade of cell cycle progression did not significantly slow the growth of KYSE30 and KYSE150 cells. In addition, the role of apoptosis in the development of tumors cannot be ignored, so we likewise examined apoptosis (Supplementary Fig. 1) upon palbociclib treatment. The apoptosis of KYSE30 cells was unchanged after treatment with palbociclib, whereas the apoptosis of palbociclib-sensitive KYSE450 cells increased. In summary, these results indicate that palbociclib could induce cell cycle arrest both in sensitive and resistant ESCC cells. However, compared to the sensitive cell lines, the resistant cells show a significant resistance to the apoptosis induced by palbociclib.

Palbociclib unexpectedly activates the PI3K–AKT pathway, which is associated with resistance to CDK inhibitor

To identify the key factors involved in the insensitivity of ESCC cells to palbociclib treatment, we selected KYSE30 cells that were insensitive to palbociclib for RNA sequencing (Supplementary Table 1). Differentially expressed genes that were downregulated after palbociclib treatment were subjected to KEGG enrichment analysis, which revealed that the cell cycle pathway was significantly enriched (Fig. 2A). Similarly, GO analysis revealed that cell biological processes related to the cell cycle, such as DNA replication and chromosome synthesis, were affected (Fig. 2B). Therefore, the expression of cell cycle-related genes at the mRNA and protein levels was further examined. The expression levels of CCNE1, CDC6, CDC25A, CCND1 and E2F1were downregulated after palbociclib treatment (Fig. 2C and D and Supplementary Fig. 2). These results further reveal that CDK inhibitors could inhibit key cell cycle-related molecules, although this inhibition had little effect on the proliferation of ESCC cells.

Fig. 2.

Palbociclib unexpectedly activates the PI3K-AKT pathway which is associated with the resistance to CDK inhibitor. (A) Top 20 KEGG-enriched pathways of differential genes down-regulated by addition of palbociclib in KYSE30 cell. (B) GO analysis of differential genes down-regulated by addition of palbociclib in KYSE30 cells. (C) RT-qPCR analysis of mRNA levels of CCNE1, CDC25A and CDC6 in negative control and ESCC cells after addition of 20 µM palbociclib. (D) Western blot analysis and statistical plots of CCNE1, CDC25A, CDC6 and GAPDH in negative control and ESCC cells after addition of 20 µM palbociclib. (E) Top 15 KEGG-enriched pathways of differential genes up-regulated by addition of palbociclib in KYSE30 cell. (F) Western blot analysis of PIK3CA, p-AKT, AKT and GAPDH in negative control and ESCC cells after addition of 20 µM palbociclib. The Data shown represent the mean ± SD.

To explore the key factors underlying the insensitivity of ESCC cells to palbociclib treatment, we performed a KEGG enrichment analysis of differentially expressed genes upregulated after palbociclib administration, which revealed that the PI3K‒AKT pathway was aberrantly activated (Fig. 2E). We subsequently examined the protein expression of the upregulated gene PIK3CA identified in the RNA sequencing and p-AKT, an important gene in the pathway (Fig. 2F). The expression of both PIK3CA and p-AKT increased after palbociclib treatment. Therefore, we hypothesized that abnormal activation of the PI3K‒AKT pathway might be a key factor in the insensitivity of ESCC cells to palbociclib.

PIK75 inhibits the activation of the PI3K–AKT pathway and promotes the apoptosis of ESCC cells

Mutations in certain molecules of the PI3K–AKT pathway closely affect the survival and prognosis of ESCC patients^26,27. PIK3CA mutations are the most common, in addition to mutations in AKT, AKT2, and PTEN, that can affect ESCC²⁸. However, current research indicates that in these six ESCC cell lines except for KYSE510 harboring E545K, none of them have mutations in the PIK3CA gene²⁹. Therefore, combined with our findings, PIK3CA overexpression rather than mutation may be the key to palbociclib resistance. Then we used PIK75, a P110α-selective inhibitor that inhibited the expression of PIK3CA and the activation of PI3K–AKT pathway. We performed an MTT proliferation assay and cell colony formation analysis on ESCC cells treated with a PIK75 inhibitor and found that PIK75 inhibited cell proliferation and growth (Fig. 3A and B). We also analyzed cell cycle progression and cell apoptosis. Unlike palbociclib, PIK75 significantly promoted apoptosis in ESCC cells (Fig. 3C). The PI3K inhibitor affected the cell cycle but induced a G2/M phase block, which was different from the mechanism of action of palbociclib (Supplementary Fig. 3). Next, we compared the changes in RNA levels in the PIK75 treatment group and control group by RNA-seq and identified the differentially expressed genes that were downregulated by treatment with PIK75 for KEGG enrichment analysis, which remained enriched in the cell cycle pathway (Fig. 3D). GO analysis revealed that biological processes related to DNA translation and the cell cycle were affected (Fig. 3E). Based on known research, the cell cycle is downstream of the PI3K‒AKT pathway and that inhibition of the PI3K‒AKT pathway inevitably causes changes in the cell cycle^30,31. We examined the protein expression levels of CCNE1, CDC6, CDC25A, PIK3CA and p-AKT. All of them were downregulated upon PIK75 treatment (Fig. 3G and H). The mRNA levels of cell cycle-related genes were also suppressed (Fig. 3F). These findings suggest that PIK75 has therapeutic potential for ESCC by promoting apoptosis and inhibiting G2/M phase progression in ESCC cells, with a mode of action distinct from the G0/G1 phase blockade of palbociclib.

Fig. 3.

PIK75 inhibits the activation of the PI3K-AKT pathway and promotes cell apoptosis in ESCC cells. (A) Representative images of colony growth in different ESCC cells with the addition of PIK75, n = 3. (B) Cell proliferation assay after addition of PIK75 to in different ESCC cell lines, n = 3 (C) Representative images for the detection of apoptosis by flow technology, n = 3. (D) Top 15 KEGG-enriched pathways of differential genes by addition of PIK75 in KYSE30 cell. (E) GO analysis of differential genes by addition of PIK75 in KYSE30 cell. (F) RT-qPCR analysis of mRNA levels of CCNE1, CDC25A and CDC6 in negative control and ESCC cells after addition of 5 µM PIK75. (G-H) Western blot analysis of PIK3CA, AKT, p-AKT, CCNE1, CDC25A, CDC6 and GAPDH in negative control and ESCC cells after addition of 5 µM PIK75. The Data shown represent the mean ± SD.

The combination of Palbociclib and PIK75 overcomes cellular resistance, synergistically inhibits cell cycle progression and promotes cell apoptosis

On the basis of these above findings, we combined PIK75 with palbociclib. The addition of PIK75 increased the sensitivity of cells to palbociclib compared to that of cells treated with palbociclib alone at the same concentration. The number of cell colonies was significantly reduced, and proliferation was significantly inhibited after treatment with the combination of drugs compared with those of cells treated with the drugs alone (Fig. 4A and B). To further investigate the combined effect of the two drugs, we evaluated their interaction using the Combination Index (CDI) in two palbociclib-resistant and one sensitive cell line. As shown in Supplementary Tables 2 and 3, the CDI values for palbociclib and PIK75 ranged between 0.73 and 0.84 in the resistant KYSE30 and KYSE150 cells, respectively, indicating a strong synergistic effect. In contrast, the CDI value was approximately 1 in the sensitive KYSE450 cells, suggesting a merely additive effect. This highlights the pronounced sensitizing effect of PIK75 specifically in the context of palbociclib resistance. Furthermore, PIK75 affected the G2/M phase of cells, palbociclib affected the G1/S phase of cells, and the combination of the two drugs triggered disruption of the cell cycle, which more significantly promoted apoptosis (Fig. 4C and D). Overall, these results indicate that the combination of palbociclib and PIK75 resulted in a variety of cellular manifestations that were superior to those of the single agents.

Fig. 4.

The combination of palbociclib and PIK75 overcomes cellular resistance and synergistically inhibited the cell cycle progression and promotes cell apoptosis. (A) Cell proliferation assay after addition of palbociclib and PIK75 to in different ESCC cell lines, n = 3 (B) Representative images and statistical plots of colony growth in different ESCC cells with the addition of palbociclib and PIK75, n = 3. (C-D) Representative images and statistical plots for the detection of cell cycle (C) and apoptosis (D) by flow technology, n = 3. The Data shown represent the mean ± SD.

Abnormal activation of PIK3CA and AKT phosphorylation is responsible for resistance to CDK inhibitor

To further reveal the molecular mechanism of the combination of palbociclib and PIK75 in ESCC cells, RNA sequencing was performed on KYSE30 cells treated with the combination of drugs to compare the changes in RNA levels between the combination group and the single drug groups (Supplementary Tables 4 and 5). We screened for differential genes that were upregulated with palbociclib, downregulated with PIK75, and downregulated with the combination of the two drugs. The intersection of these three gene sets revealed a total of 67 intersecting genes (Fig. 5A), and the PI3K–AKT pathway was significantly enriched in the KEGG pathway enrichment analysis (Fig. 5B). Therefore, the phosphorylation of AKT may be the reason for the resistance of ESCC cells to palbociclib. The mRNA and protein levels of the cell cycle-related genes CCNE1, CDC6 and CDC25A were downregulated after either two-drug combination therapy or monotherapy (Fig. 5C and D). However, the palbociclib-induced activation of the PI3K–AKT pathway was reversed after the addition of PIK75, and p-AKT and PIK3CA were downregulated (Fig. 5D). PIK75 inhibited palbociclib-induced aberrant phosphorylation of AKT and improved the sensitivity of ESCC cells to palbociclib. The combination of the two drugs synergistically inhibited tumor cell growth in vitro.

Fig. 5.

Phosphorylation of AKT is responsible for resistance to CDK inhibitor. (A) Vene plots of the three gene sets for genes up-regulated with palbociclib, genes down-regulated with PIK75, and genes down-regulated with the combination of drugs in KYSE30 cell. (B) Top 15 KEGG-enriched pathways of intersecting differential genes screened by Vene plots in KYSE30 cell. (C) RT-qPCR analysis of mRNA levels of CCNE1, CDC25A and CDC6 in negative control and ESCC cells after addition of PIK75 or/and Palbociclib. (D) Western blot analysis of PIK3CA, AKT, p-AKT, CCNE1, CDC25A, CDC6 and GAPDH in negative control and ESCC cells after addition of palbociclib or/and PIK75. # p < 0.05, ## p < 0.01, ### p < 0.001 vs. NC group. * p < 0.05, ** p < 0.01, *** p < 0.001 vs. Combine group. The Data shown represent the mean ± SD.

PIK75 synergizes with Palbociclib to inhibit ESCC tumor progression in vivo

On the basis of the above findings, we performed in vivo experiments with the combination of palbociclib and PIK75 to evaluate their potential antitumor therapeutic effects in vivo. We injected 4 × 10⁶ KYSE30 cells subcutaneously into the axilla of nude mice. After the xenograft volume was about 100 mm³, the mice were divided into a control group and experimental groups, which were treated with the drugs palbociclib or PIK75 alone or a combination of the two. The growth inhibition of xenografts was more pronounced with the combination of the two drugs than with palbociclib or PIK75 alone (Fig. 6A-C). H&E staining of tumor sections revealed less cellular heterogeneity and fewer nuclear divisions in the administered groups (Fig. 6E). Ki-67 and TUNEL staining of paraffin sections revealed that the combination drug group had the lowest percentage of Ki-67-positive cells and the highest percentage of TUNEL-positive cells (Fig. 6E-G). These findings indicate that the drug-treated groups inhibited proliferation and increased apoptosis of tumor cells and that the combination of the two drugs had a more significant inhibitory effect on tumor cells in vivo. Similarly, we extracted mouse tumor tissues to detect the levels of cell cycle proteins and PI3K–AKT pathway proteins. The combination of the two drugs reduced the mRNA and protein levels of CCNE1, CDC6, and CDC25A and reversed the elevated levels of p-AKT and PIK3CA proteins observed upon palbociclib treatment, which was consistent with the results of previous in vitro experiments (Fig. 6H-J). Furthermore, the body weights of the mice treated with the drug combination were lower than those of the control group, but there was no difference compared with those of the palbociclib group (Fig. 6D). There were no obvious changes in the morphology or weight of the liver or lung tissue of the mice after treatment with either drug alone or in combination (Supplementary Fig. 4).

Fig. 6.

PIK75 synergizes with palbociclib to inhibit ESCC tumor progression. (A) Representative images of the tumor, n = 7. (B) Tumor volume growth curves for different groups, n = 7. (C) Tumor weights of different groups, n = 7. (D) Percentage change in body weight of mice during tumor growth, n = 7. (E) Representative images of H&E staining, KI67-positive cell staining, and Tunel staining of paraffin sections from different groups of mouse tumors, n = 3. (F) Statistical chart of staining of Ki-67 positive cells, n = 3. (G) Staining statistics of TUNEL-positive cells, n = 3. (H-I) Western blot analysis of PIK3CA, AKT, p-AKT, CCNE1, CDC25A, CDC6 and GAPDH in tumor tissues of different groups of mice, n = 4–7. (J) RT-qPCR analysis of mRNA levels of CCNE1, CDC25A and CDC6 in tumor tissues of different groups of mice, n = 4–7. # p < 0.05, ## p < 0.01, ### p < 0.001 vs. NC group mice. * p < 0.05, ** p < 0.01, *** p < 0.001 vs. Combine group mice. The Data shown represent the mean ± SD.

Taken together, these findings suggest that aberrant activation of the PI3K–AKT pathway was a potential factor in palbociclib resistance, which could be reversed by the PI3K inhibitor PIK75. The combination of palbociclib and PIK75 has great potential for the treatment of ESCC.

Discussion

Palbociclib is a cell cycle CDK4/6 inhibitor that blocks cell cycle progression. It is currently the first-line treatment for metastatic ER-positive breast cancer³². Since ESCC exhibits alterations in cell cycle regulatory genes, CDK4/6 inhibitors may serve as promising agents³³. However, a phase II clinical trial of palbociclib in advanced esophageal cancer conducted by Abramson Cancer Center revealed that palbociclib alone has limited therapeutic activity, indicating that the role of CDK4/6 inhibitors in esophageal cancer needs to be studied in detail³⁴.

ESCC is characterized by large-scale genomic rearrangements and copy number amplification deletions, and genomic instability leads to significant heterogeneity among patients^35,36. Some researchers have classified ESCC into four molecular subtypes: cell cycle pathway activated (CCA), NRF2 pathway activated (NRFA), immunosuppressed (IS), and immunomodulated (IM), based on the analysis of multi-omics data. A study of ESCC organoids constructed for CCA subtypes revealed that patients whose cell cycle was altered were more sensitive to palbociclib. These findings suggest that ESCC patients with the CCA subtype could benefit from treatment with CDK4/6 inhibitors³⁷. Wang Jiayuan et al. reported that the CDK4/6 inhibitor SHR6390 had potential inhibitory effects on ESCC cell lines and xenograft tumors and that the expression of CDK6 and cyclin D1 was related to the sensitivity of SHR6390³⁸. This suggests that although CDK4/6 inhibitors can inhibit ESCC cell proliferation and exert antitumor effects, due to the diversity of ESCC gene mutations and subtypes, only some populations of specific subtypes respond well to CDK4/6 inhibitors³⁹. Therefore, pairing the subtype specificity of drugs to the mutational profile of cancer and capturing the optimal drug combination dose are challenges in the targeted treatment of ESCC.

Our experimental results revealed that some types of ESCC cancer cells KYSE410, KYSE450 and KYSE510, were sensitive to palbociclib, whereas KYSE30, KYSE150 and TE1 cells were insensitive to palbociclib. To better clarify the effect of palbociclib in different ESCC cell lines, we examined the expression of relevant proteins. The results revealed that in both the sensitive cell line KYSE450 and the insensitive cell lines KYSE30 or KYSE150, the G0/G1 phase of the cell cycle and the cell cycle-related proteins CCND1, CCNE1, CDC6, CDC25 and E2F1 were inhibited. This suggested that even in drug-resistant cells, palbociclib successfully induced G1/S cycle arrest, and the expression of downstream E2F1 was also significantly inhibited, but the cells still survived. We further analyzed the phenotypes of sensitive cells and resistant cells and found that palbociclib could significantly induce apoptosis in sensitive cells, while resistant cells exhibited resistance to apoptosis through G1/S phase arrest.

To determine the possible reasons, we sequenced the cells after adding the inhibitor and found that the key reason was the aberrant activation of the PI3K–AKT pathway, which affects cell growth, migration, and proliferation and is critical in the progression of ESCC. The PI3K–AKT pathway plays a significant role in apoptosis resistance, particularly in cancer. Activation of this pathway can lead to reduced cell death, promoting cancer cell survival and contributing to drug resistance⁴⁰. In this study, we found the expression of both PIK3CA and p-AKT increased after palbociclib treatment, which resulted in the resistance to drug induced apoptosis. Our previous study and that of others have both shown that there is a high frequency of PIK3CA mutations in ESCC^41,42. However, all the six ESCC cell lines that we used were wildtype except KYSE510 harboring the E545K mutation²⁹. For other genes involved in PI3K/AKT pathway, Zhang et al. had analyzed the mutations in these cell lines and found mutations in the PI3K pathways were present in all of the cell lines⁴³. These results suggest that the mutant states of PI3K pathway may not be the main cause of palbociclib resistance.

However, the PI3K pathway, including the PIK3CA gene, is indeed crucial for normal cellular functions and is widely expressed and active in healthy tissues. How to select the appropriate PI3K inhibitor is of great significance. In general, single PI3K inhibitors have limited effects in ESCC^44,45. The widespread toxicity of the drugs used in clinical trials also limits the dosage that can be used as a single agent. Studies have shown that CYH33, a novel p110 inhibitor, could inhibit ESCC cells by G1/S arrest. CYH33 significantly arrested sensitive cells at G1 phase, which was associated with accumulation of p21 and suppression of Rb phosphorylation by CDK4/6 and CDK2. However, ESCC cells have adaptive resistance to the PI3K inhibitor CYH33 when used alone. Based on these findings, the combined use of CDK4/6 inhibitor palbociclib can significantly enhance the therapeutic effect of CYH33 in drug-resistant cell lines⁴⁶. Other strategies including combining CYH33 with MEK inhibitor (MEK162) or mTORC1 inhibitor (RAD001) synergistically inhibits the growth of CYH33-resistant cells⁴⁷. In addition, the combination of a PI3K inhibitor with either a histone deacetylase inhibitor or a JNK inhibitor has a superior growth inhibitory effect on ESCC tumor cells compared with the use of a PI3K inhibitor alone^45,48. These findings further indicate that targeted drugs alone have poor efficacy in treating ESCC and that the combination of multiple drugs is a potential strategy to improve ESCC.

Because of the limitations of using CDK inhibitors and PI3K inhibitors alone in ESCC, we combined palbociclib with a PI3K inhibitor which could reduce the expression of PIKC3A and the activation of PI3K pathway to inhibit ESCC cells. CDI analysis confirmed a strong synergistic effect between the two drugs in palbociclib-resistant models, whereas only an additive effect was observed in sensitive cell line, suggesting that this combination strategy is particularly advantageous in the resistance cells. Notably, we found that the combination, at concentrations far below the IC50 of each single agent, could achieve 50% inhibition rate, highlighting a strong synergistic effect in palbociclib-resistant KYSE30 and KYSE450 cells. Subsequent studies indicate that the strong synergistic effect is mechanistically driven by the induction of apoptosis via enhanced cell cycle arrest. The percentage of cells in the G2 phase increased after palbociclib treatment combined with PIK75. This response may be related to the fact that blocking PI3K activity prevents proliferating cells from transitioning to the G2/M phase⁴⁹. Overall, palbociclib combined with PIK75 synergistically inhibited tumor cell proliferation and promoted apoptosis. After treatment with palbociclib and PIK75, the mice presented much better tumor suppression compared to that after treatment with either drug alone, even when the concentration of the two drugs was reduced, which was also consistent with the results of in vitro studies. The side effects of the combination were not greater than those of either drug alone. Moreover, combined use can lower the dosage and further reduce drug side effects⁵⁰.

There are several studies on palbociclib’s induction of PI3K pathway activation. In triple negative breast cancer, palbociclib treatment upregulated the expression of PI3K, p-AKT and p-mTOR, suggesting compensatory activation of the PI3K-AKT-mTOR signaling pathway⁵¹. In fact, this signaling cascade exhibits significant crosstalk with cyclin D1 activation in palbociclib resistance. Cyclin D1 is also protected from proteolytic degradation via AKT-mediated phosphorylation of glycogen synthase kinase-3β⁵². Another gene TMEM45A could enhance palbociclib resistance and cellular glycolysis by activating AKT/mTOR signaling pathway in HR + breast cancer⁵³. In B-cell lymphoma PLK1 may be the key molecule that enables palbociclib to activate the PI3K pathway⁵⁴. These will provide important clues for our research. We will establish drug-resistant cell lines to clarify the mechanism by which palbociclib induces the PI3K pathway in the future.

In conclusion, our study provides meaningful insights into the interaction between PI3K and CDK inhibitors in ESCC. We found that the combination of PI3K and CDK inhibitors could significantly enhance the therapeutic effects. In future research, we will further explore the role and mechanisms of combination therapy with PI3K and CDK inhibitors in ESCC and identify characteristics of patients who are more effective on this therapy.

Conclusions

The CDK4/6 inhibitor palbociclib had a limited effect on ESCC cells because of the abnormal activation of the PI3K‒AKT pathway. Palbociclib in combination with the novel PI3K inhibitor PIK75 inhibited the expression of cell cycle proteins and AKT phosphorylation, synergistically inhibited tumor cell cycle progression and promoted cell apoptosis in vitro and in vivo, which provides a promising idea for the treatment of ESCC in the future.

Materials and methods

Animal experiments

Seven-week-old female nude mice were purchased from HangZhou ZiYuan Experimental Animal Technology Co., Ltd., and after one week of adaptive feeding, 4× 10⁶ KYSE30 cells were subcutaneously injected. After one week, the mice were divided into four groups (n = 8) based on the average tumor volume: the control group, Pal group (100 mg/kg palbociclib, HY-50767, MCE), PIK group (10 mg/kg PIK75, HY-107834, MCE), and two-drug combination group (75 mg/kg palbociclib and 7.5 mg/kg PIK75 combined), with daily intraperitoneal injections. The weights and tumor volumes (length × width ² × 0.5) of the mice were measured every three days. After the dosing cycle, the mice were anesthetized by inhalation of 3–5% isoflurane (R510-22-10, RWD Life Science) and then euthanized with carbon dioxide. All experiments were performed in accordance with the ARRIVE guidelines.

Cell culture

The human ESCC cell lines KYSE30, KYSE150, KYSE410, KYSE450, KYSE510, and TE1 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All the ESCC cell lines were cultured in RPMI 1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (Biosharp, China) and 1% penicillin‒streptomycin (Beyotime Biotechnology, China) in a 37 °C incubator supplemented with 5% CO₂.

MTT cell viability and proliferation assays

For the MTT cell viability assay, cells were seeded in a 96-well plate with 5 × 10³ cells per well and treated with or without palbociclib. Then, 10 µL of MTT buffer (5 mg/mL) (Sigma‒Aldrich, USA) was added, the mixture was replaced with DMSO after 4 h, and the absorbance was measured at 570 nm. For the cell proliferation experiment, cells were seeded in a 96-well plate with 3 × 10³ cells per well and 3 replicates. After cell adhesion, a certain concentration of palbociclib or PIK75 was added. MTT was added at 1, 3 and 5 days, and DMSO was added after 4 h. The absorbance value was measured at 570 nm to assess cell proliferation.

Drug interaction between palbociclib and PIK75 was analyzed using the coefficient of drug interaction (CDI) which is calculated as follows: CDI = AB/(A×B). According to the absorbance of each group, AB is the ratio of the combination groups to control group; A or B is the ratio of the single agent group to control group. Thus, CDI < 1 synergy, CDI = 1 additive, CDI > 1 antagonistic, respectively⁵⁵.

Colony formation

3 × 10³ cells were seeded in 24-well plates, and after the cells were allowed to adhere, a specific concentration of palbociclib or PIK75 was added. The plate was removed after approximately one week, and the cells were fixed with 4% paraformaldehyde. The cells were stained with crystal violet and photographed for analysis.

Cell cycle progression and apoptosis

For cell apoptosis, the cells were digested and collected, after which the corresponding antibodies, FITC annexin V and propidium iodide (PI) were added for staining following the instructions of the FITC Annexin V Apoptosis Detection Kit I (556547, BD Biosciences). For the cell cycle, the cells were digested, collected, and then fixed overnight with 75% ethanol. The next day, PI (BS147, Biosharp) and RNase A (BL1271A, Biosharp) were added, followed by incubation. The cells were assessed with BD FACSCanto II (BD Biosciences, USA), and the data were analyzed with FlowJo 10 software (BD Biosciences).

RNA-seq analysis

RNA was extracted and accurately assessed for integrity and total amount with the RNApure Tissue and Cell Kit and sequenced by the 150 bp pairwise method. HISAT2 v2.0.5 was used to align the sequences to the reference genome, and featureCounts was used to quantify the gene expression levels. Finally, P values and log2 fold change values were used to identify differentially expressed genes for subsequent KEGG^56–58 and GO analyses.

RT‒qPCR

Total RNA from cells and tumor tissues was extracted with the RNApure Tissue and Cell Kit (Beijing Kangwei Century Biotechnology Co., Ltd.), and the RNA concentration was measured and adjusted. The PrimerScript™ RT Master Mix Kit (RR036A, TaKaRa) was used for reverse transcription in a 10 µL system, followed by real-time fluorescence quantitative PCR with TB Green Premix Ex Taq II (RR820A, TaKaRa). The CT values were normalized with the 2^−△△CT method, with the mRNA level of the reference gene GAPDH used as a control. The primers were synthesized by Tsingke Biotechnology (Beijing, China). The RNA primer sequence information is shown in Table 1.

Table 1.

Primers used for RT-PCR.

Target gene	primer sequence (5’ – 3′)
GAPDH	Forward: GATTCCACCCATGGCAAATTC Reverse: CTGGAAGATGGTGATGGGATT
CDC6	Forward: GCGAGGCCTGAGCTGTG Reverse: GCTTTGTTCAATGCCCGAGA
CDC25A	Forward: ATACATTCCCTACCTCAGAAGC Reverse: ATCTGGGTCGATGAGCTGAAA
CCNE1	Forward: AGAGGAAGGCAAACGTGACC Reverse: TATTGTCCCAAGGCTGGCTC
E2F1	Forward: GCCATCCAGGAAAAGGTGTG Reverse: AAACATCGATCGGGCCTTGT
CCND1	Forward: ATCAAGTGTGACCCGGACTG Reverse: CTTGGGGTCCATGTTCTGCT

Western blot analysis

The cells were exposed to palbociclib and/or PIK75, and the cells were collected after 48 h. Total protein was extracted from cells or tumor tissues with RIPA lysis buffer (P0013D, Beyotime Biotechnology), and concentration quantification was performed with BCA kits (P0012S, Beyotime Biotechnology). Western blotting was performed with overnight incubation with primary antibodies against GAPDH (CST, USA), p-AKT (CST, USA), AKT (CST, USA), CDC25A (Proteintech), CCNE1 (Proteintech), CDC6 (Proteintech), and PIK3CA (Proteintech). The protein expression signal was observed with an enhanced chemiluminescence detection reagent (Tanon, China), and statistical analysis was performed via ImageJ.

H&E staining

Fresh mouse tumors and liver tissues were fixed, paraffin-sectioned, stained with an H&E dye kit (Servicebio, G1003), dehydrated and sealed with ethanol and xylene, and images were acquired under a microscope.

Ki-67 immunohistochemical staining and TUNEL staining assays

Antigen repair was performed on the paraffin sections, and endogenous peroxidase was blocked; the sections were incubated with an anti-Ki-67 antibody (1:5000, Servicebio, GB121499) overnight at 4 °C and then processed according to the DAB Chromogenic Reagent Kit (Servicebio, G1212). For TUNEL staining, paraffin sections were paraffinized and repaired with proteinase K working solution (Servicebio, G1205), followed by subsequent manipulations according to the instructions of the TUNEL kit (Servicebio, G1507) and the DAB chromogenic kit. The final images were acquired under a microscope and processed with ImageJ.

Statistical analysis

All the experimental results were statistically analyzed with the SPSS statistical program (version 26.0; IBM, Armonk, USA). The results of two groups of experiments were analyzed by Student’s t test, and three or more groups were analyzed by one-way ANOVA, with a p value of less than 0.05 considered statistically significant. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

ESCC

Esophageal squamous cell carcinoma

EAC

Esophageal adenocarcinoma

qPCR

Quantitative polymerase chain reaction

CDKs

Cyclin-dependent kinases

CCNE1

Cyclin E1

CDC6

Cell division cycle 6

CDC25A

Cell division cycle 25 A

PI3K

Phosphoinositide 3-kinase

PIK3CA

Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha

AKT

protein kinase B

Author contributions

YNZ and LXL performed the experiments and analyzed the data. YNZ analyzed and interpreted the data. YJ, YJS, YX, and XYY provided the necessary materials. YNZ, YZP and SM conceived and designed the study and drafted the manuscript. FMZ, FXZ, YZP and SM secured financing for the study. All the authors read and approved the final manuscript.

Funding

This study was supported by the National Science Foundation of China (82372708 and 82302936), the Suzhou Key Medical Center, Science and Technology Project of Suzhou (SLT2021010), and the Basic Research on Medical and Health Application of the People’s Livelihood Science and Technology Project of Suzhou (SKJY2021139 and SKY2022208).

Data availability

The datasets generated during and analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

The Animal Ethics Committee of the Affiliated Hospital of Nanjing University of Traditional Chinese Medicine for Integrative Medicine approved all the animal experiments (AEWC-20180727-43). All experiments were performed in accordance with relevant guidelines and regulations.