Terpine-4-ol alleviates lipopolysaccharide-induced intestinal injury in weaned piglets by regulating intestinal epithelial cell homeostasis via the Wnt/β-catenin signaling pathway

Abstract

This study aims to elucidate intestinal injury from the perspective of intestinal epithelial cell homeostasis and to explore the modulatory roles of terpine-4-ol (a major bioactive component of tea tree oil). Forty 28-day-old piglets (7.82 ± 0.43 kg) were randomly divided into 5 groups with 8 pigs per group. Piglets in the control (CON) and lipopolysaccharide (LPS) groups were fed a basal diet, while those in the remaining 3 groups were fed the basal diet supplemented with 30 (LTP), 60 (MTP), or 90 mg/kg terpine-4-ol (HTP), respectively. Piglets in the LPS and terpine-4-ol supplementation groups were intraperitoneally injected with 100 μg/kg BW of LPS at the end of the 21-day growth period. Six hours after injection, 6 piglets from each group were randomly selected and slaughtered to detect intestinal cell homeostasis. The results showed that the average daily weight gain (ADG) and average daily feed intake (ADFI) of piglets in MTP and HTP groups were higher than those in the CON group (P < 0.05), whereas the feed conversion ratio (FCR) of piglets in LTP group was lower as compared to the CON group (P = 0.007). Terpine-4-ol supplementation also decreased the diarrhea rate of piglets. Lipopolysaccharide challenge decreased the villus length and the ratio of villus length to crypt depth (V/C) in the jejunum (P < 0.05), decreased the V/C ratio and increased the crypt depth in the ileum (P < 0.05). In contrast, terpine-4-ol supplementation led to increased villus length and V/C ratio in the jejunum, raised the V/C ratio in the HTP group, and decreased crypt depth in the LTP and MTP groups in the ileum (P < 0.05). Lipopolysaccharide reduced the number of antigen Ki-67 positive (Ki67⁺) cells and increased the number of caspase 3⁺ cells (P < 0.05) in both the jejunum and ileum, whereas terpine-4-ol increased the number of Ki67⁺ cells in the crypts of the jejunum and ileum, while decreasing the number of caspase 3⁺ cells of the ileum and in the jejunum of MTP and HTP groups (P < 0.05). Lipopolysaccharide down-regulated the expression of the intestinal stem cell marker leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5) (P < 0.05, except for Lgr5 gene in the jejunum), while terpine-4-ol supplementation alleviated the effect. Lipopolysaccharide decreased the number of goblet cells and mucin 2 (Muc2) secretion (P < 0.05), whereas the number of goblet cells and Muc2 secretion in the small intestine of MTP group were increased (P < 0.05). In addition, LPS injection led to a reduction in the expression of endocrine cell marker chromogranin A and absorption cell marker villin (P < 0.05). Conversely, terpine-4-ol increased the abundance of endocrine cells and absorption cells in the small intestine (P < 0.05). Moreover, LPS inhibited the expression of genes and proteins of wingless-type MMTV integration site family (Wnt)/β-catenin signaling pathway (P < 0.05), whereas terpine-4-ol reversed this effect. In conclusion, terpine-4-ol supplementation improved growth performance, decreased diarrhea in piglets and alleviated the damage to the intestinal epithelial cell homeostasis under LPS challenge, probably via Wnt/β-catenin signaling activation. A dose of 60 mg terpine-4-ol per kilogram diet was recommended based on the present study.

1. Introduction

Weaning-induced diarrhea continues to pose a significant challenge in piglet production, contributing to elevated mortality rates and lifelong growth retardation, with substantial economic consequences for the industry (Sun and Kim, 2017). The global restrictions on antibiotic use in livestock feed have further exacerbated this problem (O'Neill et al., 2020), highlighting the urgent need for effective alternatives to improve intestinal health and identify precise nutritional targets for diarrhea management in weaned piglets. Plant-derived bioactive compounds, including terpenes (e.g., thymol, limonene, carvacrol) and phenylpropanoids (e.g., cinnamaldehyde, eugenol, safrole), have shown promise in mitigating intestinal inflammatory injury (Mo et al., 2022).

Our previous research demonstrated that tea tree oil (TTO) enhances intestinal barrier function, reduces post-weaning diarrhea, and promotes growth in weaned piglets, with effects even more pronounced than those of antibiotics (Wang et al., 2018; Dong et al., 2019). However, the specific bioactive components of TTO and their underlying mechanisms remain unclear. Terpine-4-ol, a major constituent comprising 60% of TTO, exhibits anti-inflammatory properties by downregulating proinflammatory cytokines (Aslam et al., 2022; Ning et al., 2018). We hypothesized that terpine-4-ol is the key functional component responsible for alleviating intestinal inflammatory injury. Therefore, in this study, weaned piglets were supplemented with 3 concentrations of terpine-4-ol to assess its effects on growth performance and determine the optimal dosage.

Intestinal homeostasis relies on the coordinated functions of intestinal epithelial cells (IECs), which differentiate from intestinal stem cells into 4 specialized types: goblet, enteroendocrine, Paneth, and absorptive cells (Van Der Flier and Clevers, 2009). These IECs play a critical role in maintaining host-microbiota symbiosis by secreting bacterial antigens, delivering immunological mediators, and reinforcing the intestinal mucosal barrier (Peterson and Artis, 2014). Dysfunctional IECs are implicated in inflammatory bowel disease (Okumura and Takeda, 2017), and our unpublished data suggest that TTO mitigates weaning-induced reductions in goblet cell numbers. Furthermore, the wingless-type MMTV integration site family (Wnt)/β-catenin signaling pathway is essential for IEC homeostasis, regulating stemness and proliferation of intestinal stem cells (Fevr et al., 2007). It was thus hypothesized that terpine-4-ol alleviates intestinal inflammatory injury by modulating IEC homeostasis, potentially via Wnt/β-catenin signaling pathway.

In this study, we established an LPS-challenged intestinal inflammatory injury model in weaned piglets and evaluated changes in the number and function of intestinal stem, goblet, enteroendocrine, Paneth, and absorptive cells. This study aims to uncover novel mechanisms for mitigating intestinal inflammatory injury in piglets and provide evidence supporting terpine-4-ol as a viable feed additive in piglet production.

2. Materials and methods

2.1. Animal ethics statement

All animal procedures were approved by the Ethics Committee of Yangzhou University (No. 202202086).

2.2. Animals and experimental design

Forty 28-day-old healthy piglets (7.82 ± 0.43 kg) weaned at 21 days of age (Duroc × Landrace × Large White pigs) were randomly allocated into 5 groups. Piglets in the control (CON) and lipopolysaccharide (LPS) groups were fed a basal diet, while those in the remaining 3 groups were fed the basal diet supplemented with 30 (LTP), 60 (MTP), or 90 mg/kg (HTP) terpine-4-ol, respectively.

Piglets in the LPS and terpine-4-ol supplementation groups were intraperitoneally injected with 100 μg/kg BW of LPS at the end of the 21-day formal trial.

Terpine-4-ol (≥95% purity, CAS No.: 20,126–76-5) was purchased from Shanghai Aladdin Chemical Reagents Co., Ltd., China. To prevent clumping of liquid terpine-4-ol in the feed, the compound was first adsorbed onto SiO₂ at a 1:1 mass ratio, and then incorporated into the feed using a stepwise premixing method.

Eight piglets (4 male and 4 female) for each group were raised in 8 pens (one piglet per pen). The preliminary trial lasted for 3 days, and the formal trial lasted for 21 days. On the 21st day (6 h before sampling), piglets in the LPS, LTP, MTP and HTP groups were intra-peritoneally injected with LPS of 100 μg/kg BW, and piglets in CON group were intraperitoneally injected with 0.9% sterile saline. The diets of the piglets meet the requirement of weaned piglets in the Chinese National Standard of the Nutrient Requirement of Swine (GB/T 39235-2020) and the composition of the diet is presented in Table 1. The content of crude protein of the diets was analyzed by using Kjeldahl Nitrogen Determination Method according to GB/T 6432-2018; the contents of total calcium and total phosphorus in the diets were analyzed according to the methods of GB/T 6436-2018 and GB/T 6437-2018. Nutrient levels of net energy and amino acids were calculated according to the net energy or amino acids of each ingredient multiplied by the proportion of the ingredient in the diet, the sum of the net energy or amino acids provided by all the ingredients were finally added. The net energy or amino acids of each ingredient were based on the tables of feed composition and nutritive values in China (China Feed Database, 2020).

Table 1.

Composition and nutritional level of the basal diet (air-dry basis, %).

Ingredients	Content	Nutrition levels2	Content
Corn	10.44	Net energy, MJ/kg	10.99
Fish meal	5.87	Crude protein	18.94
Expanded corn	28.61	Total Ca	0.76
Soybean oil	1.43	Total P	0.45
Soybean meal	10.44	Lys	1.25
Full-fat soybeans	6.44	Met	0.43
Whey powder	14.31	Thr	0.71
Flour	10.01	Trp	0.21
Glucose	2.43
Sucrose	4.86
Powdered rice hulls	0.16
Premix1	5.00
Total	100.00

¹Premix provides the content of nutrients in diets (per kg premix): Val 1.83 g, Met 2.9 g, Ser 1.5 g, Arg 4 g, Fe 53 mg, Gu 5 mg, Mn 13 mg, Zn 40 mg, Co 0.06 mg, Se 0.23 mg, I 0.33 mg, vitamin A 13,500 IU, vitamin D₃ 2750 IU, vitamin E 6.25 mg, vitamin K₃ 1.25 mg, vitamin B₁ vitamin 0.5 mg, riboflavin 3.75 mg, pantothenicacid 6.25 mg, nicotinic acid 8.75 mg, adermin 0.5 mg, vitamin B₁₂ 0.01 mg, biotin 0.013 mg, folic acid 0.125 mg, phytase 500 mg, sweetener 200 mg, sodium glutamate 1000 mg, mold adsorbent 500 mg, antioxidants 200 mg.

²Nutrient levels of net energy and amino acids were calculated values, which were calculated according to the net energy or amino acids of each ingredient multiplied by the proportion of the ingredient in the diet, the sum of the net energy or amino acids provided by all the ingredients were finally added. The net energy or amino acids of each ingredient were based on the tables of feed composition and nutritive values in China (China Feed Database, 2020).

2.3. Growth performance

At the beginning of the formal experiment, the initial body weight of each piglet was recorded, and the final body weight of each piglet was weighed before LPS injection (fasting for 12 h, but had free access to water) at the end of the experiment. The feed intake was recorded daily, and the total feed intake was summarized weekly. The average daily body weight gain (ADG), average daily feed intake (ADFI) and FCR (FCR = ADFI/ADG) of piglets for the whole experiment period in each group were calculated using the data of body weight and feed consumption. The diarrhea status of each piglet was observed and recorded at a fixed time (09:00 and 16:00) daily. The diarrhea rate of piglets in each group was calculated according to the formula in Qiao et al. (2023).

2.4. Sample collections

After the experiment, 6 piglets in each group were randomly selected and were intraperitoneally injected 50 mg/kg pentobarbital sodium, and then the abdominal cavity was quickly opened, the small intestine was removed from the pylorus to the ileocecal valve, and divided into the duodenum (about first 10 cm segment after the stomach, which is attached to the pancreas), jejunum (about half of the small intestine below the duodenum) and ileum (the remaining part of the small intestine). A 2-cm section from the middle of the jejunum and ileum was gently washed of the chyme with phosphate buffer saline (PBS), and put into 4% paraformaldehyde for further histological study and immunohistochemistry analysis. In addition, intestinal segments were cut from the middle section of the jejunum and ileum, respectively. The intestinal contents were cleaned with pre-cooled PBS, the moisture was dried with filter paper, and the mucosa was gently scraped with a slide and put into a 2-mL frozen tube. The tubes were then quickly frozen in liquid nitrogen and transferred into a −80 °C refrigerator.

2.5. Histological study

The intestine samples collected in 4% paraformaldehyde were dehydrated and then embedded in paraffin. Slides made from tissue sections were stained with hematoxylin and eosin (HE) and pictured with a microscope (BX5; Olympus Corporation; Tokyo; Japan) coupled with a camera (H5500 L; Nikon Corporation; Tokyo; Japan). Villus length, crypt depth and the ratio of villus length to crypt depth (V/C) were measured. The histological procedures followed established protocols (Suvarna et al., 2018).

2.6. Alcian blue staining

The slides were made from the paraffin embedded tissues. Staining was completed according to the procedure of Standard Alcian Blue staining kits (Solaibao Biotechnology Co., Ltd., Guangzhou, China).

2.7. Immunohistochemistry analysis

The paraffin sections were dried, antigen retrieval conducted, and blocking completed; all details of this procedure have been described in a previous study (Suvarna et al., 2018). The sections were incubated with the first primary antibodies of antigen Ki-67 (Ki-67) polyclonal antibody (1:400, PA5-19462, Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), chromogranin A antibody (1:2, ab53464, Abcam, Cambridge, UK), mucin 2 (Muc2) polyclonal antibody (1:1500, 27675-1-AP, Proteintech Group, Rosemont, IL, USA), villin polyclonal antibody (1:100, ab233155, Abcam, Cambridge, UK), cleaved caspase 3 antibody (1:2200, 9664S, Cell Signaling Technology, Danvers, MA, USA) for 1 h at room temperature, respectively. Thereafter, the slides were incubated with second antibodies for 30 min at room temperature, and then the slides were visualized by 3,3′-diaminobenzidin (DAB) to detect the target protein expression. The nuclei were further enhanced by using hematoxylin. Pictures were taken and Image-J 2.1.0 software was used to assess the tissue profiles and positive cell profiles. The expression of Muc2 and villin was calculated by immunoreactive scoring system (IRS) scores (Schneider et al., 2010).

2.8. mRNA expression analysis by real-time PCR

The gene expression of leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5), B lymphoma Mo-MLV insertion region 1 (Bmi1), Muc2, antigen Ki-67 positive (Ki67), villin, chromogranin A, lysozyme (Lyz), wingless-type MMTV integration site family, member 1 (Wnt1), β-catenin, T-cell factor 4 (TCF4), cyclin D1 and cellular myelocytomatosis viral oncogene homolog (c-Myc) in the jejunum and ileum of piglets were analyzed. β-Actin was chosen as a housekeeping gene. The primers for these genes are shown in Table 2 and were synthesized by Solaibao Biotechnology Co., Ltd. (Beijing, China). RNA isolation and real-time PCR method were the same as a previous study (Bustin et al., 2009). The relative gene expression was calculated using the 2^−ΔΔCT method.

Table 2.

Primer sequences of the tested genes.

Gene	Accession No.	Primer sequence (5＇ to 3＇)		Amplicon size, bp
Lgr5	NM_001315762.1	F	CCACTGCAATCAGGACACTCT	100
		R	AGAGAAGGGTTGCCTACAAAGG
Bmi1	NM_001285971.1	F	GCCGCTTGGCTCACATTCAT	103
		R	AAAGATCCCGGAAAAAGCAGC
Muc2	XM_021082584.1	F	CTGTGCGACTACAACTTCGC	139
		R	AGATGGTGTCGTCCTTGACC
Ki67	M_001101827.1	F	CCTTACACAGATGCAGGGCT	92
		R	CTGAACGCTGCAGACAAAGC
Villin	XM_003358368.5	F	AGTGGACCAACAACCAGTCC	123
		R	TACCGGTGCTGGGACATTTG
Chromogranin A	NM_001164005.2	F	AGTGCATCGTCGAGGTCATC	148
		R	GCGAGGTCTTGGAGCTCTTT
Lyz	NM_214392.2	F	AGGTCTATGATCGGTGCGAG	99
		R	ACTTGGCCAAACACACCCAG
Wnt1	XM_003123621.4	F	ACACCCGCGTACCCC	262
		R	GATACTGGCGCAGAGGATGG
TCF4	NM_001243230.2	F	AAACCAGCAGCCAGCACTTTCC	121
		R	AATTGCCCAACATTCCTCCGTAGC
Cyclin D1	XM_021082686.1	F	TTTGCCAGAGGGACCCAATC	83
		R	AACAGGATGGGGTCAGAACG
c-Myc	NM_001005154.1	F	AAAAGGTCGGAATCGGGGTC	108
		R	TGCATAATTGTGCTGGTGCG
Axin2	XM_021066738.1	F	CAAACCCATGCCTGTCTCCT	150
		R	CGGAAGAGATAAGCCCCGTC
β-Actin	XM_003357928.4	F	AGGCCAACCGTGAGAAGATG	122
		R	CATGACAATGCCAGTGGTGC

F = forward; R = reverse; Lgr5 = leucine-rich repeat-containing G-protein coupled receptor 5; Bmi1 = B lymphoma Mo-MLV insertion region 1; Muc2 = mucin 2; Ki67 = antigen Ki-67; Lyz = lysozyme; Wnt1 = wingless-type MMTV integration site family, member 1; TCF4 = T-cell factor 4; c-Myc = cellular myelocytomatosis viral oncogene homolog; Axin2 = axis inhibition protein 2.

2.9. Western-blot analysis

The total protein was extracted from the frozen samples of the jejunum and ileum for the detection of the protein expression of Lgr5, Lyz, Wnt1, β-catenin, TCF4, cyclin D1, and c-Myc. The nuclear protein was extracted from the jejunum and ileum for the detection of protein expression of β-catenin. The protein content was detected by bicinchoninic acid (BCA) protein assay kits bought from Beyotime Biotech Inc. (Nantong, Jiangsu, China). The procedure of protein extraction, protein denaturation, the transferring of the protein to the nitrocellulose membranes and the protein blocking were conducted as a previous study (Towbin et al., 1979). The membranes were incubated by first antibodies overnight at 4 °C, including: anti-Lgr5 (1:800, NBP1-28904, Novus Biologicals, Littleton, CO, USA), anti-Lyz (1:500, PA5-16668, Thermo Fisher Scientific, Waltham, MA, USA), anti-Wnt1 (1:800, CPA2232, Cohesion Biosciences, Shanghai, China), anti-β-catenin (1:10,000, 51067-2-AP, Proteintech Group, Rosemont, IL, USA), anti-TCF4 (1:800, av100776, Sigma–Aldrich, St. Louis, MO, USA), anti-cyclin D1 (1:6000, 26939-1-AP, Proteintech Group, Rosemont, IL, USA), and anti-c-Myc (1:12,000, 10828-1-AP, Proteintech Group, Rosemont, IL, USA). Then, the membranes were washed with 1 × PBS with 0.1% Tween 20 for 3 times. The corresponding second antibodies were next incubated for 1 h at room temperature. Upon completion, the hypersensitive chemiluminescence (ECL) kit (32,106, Thermo Fisher Scientific, Waltham, MA, USA) was used for the development of the protein incubated in membranes, the film scanned and the pictures analyzed by Image J software. The details for this procedure are presented in a previous study (Schneider et al., 2012).

2.10. Statistical analysis

Statistical Package for the Social Sciences (SPSS) 19.0 software was used for data analysis. One-way ANOVA was used for the analysis of the data. The results were presented as the mean and standard error of the mean. The model for the data was as the follow:

$$Y_{ij}=\mu +T_i+{\mathrm{\epsilon }}_{ij}\text{,}$$

where Y_ij is the dependent variable, μ is the overall mean, T_i is the fixed effect of treatment and ε_ij is the random error.

To evaluate the differences between the CON and LPS groups, as well as among the LPS and terpine-4-ol supplementation groups, multiple comparisons were performed using Duncan's test. In addition, linear and quadratic contrasts were used to determine the effects for different doses (0, 30, 60, 90 mg/kg) of terpine-4-ol. All graphs were drawn using Graphpad Prism 7.

3. Results

3.1. Growth performance

The effect of different doses of terpine-4-ol on the growth performance of weaned piglets is shown in Table 3. Compared with those of the CON piglets, the ADG and ADFI of the MT and HT piglets were both greater (P < 0.05). The FCR of the piglets in LTP group was significantly lower than that in the CON group (P < 0.05). In addition, the diarrhea rates of the piglets in the terpine-4-ol groups were lower than those in the CON group. The ADFI and ADG showed linear and quadratic increases (P < 0.05), and FCR showed a quadratic increase with the increase of terpine-4-ol level (P < 0.001).

Table 3.

Effects of different doses of terpine-4-ol on the growth performance of weaned piglets¹.

Item	Groups				P-value2
	CON	LTP	MTP	HTP	One-way ANOVA	Linear	Quadratic
ADG, g/d	354.47 ± 19.610b	393.09 ± 13.101ab	427.24 ± 10.631a	409.76 ± 9.962a	0.003	<0.001	<0.001
ADFI, g/d	491.46 ± 36.211b	479.88 ± 21.691b	591.07 ± 4.912a	576.59 ± 4.451a	0.006	<0.001	<0.001
FCR	1.46 ± 0.051a	1.28 ± 0.062b	1.34 ± 0.041ab	1.43 ± 0.043a	0.007	0.748	<0.001
Diarrhea rate, %	13.49	4.76	7.14	7.94

ADG = average daily weight gain; ADFI = average daily feed intake; FCR = feed conversion ration.

¹CON, control group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group.

²Different letter superscripts in the same row mean significant differences among different groups (P < 0.05). P < 0.05 of one-way ANOVA, indicates significant difference among different groups. P < 0.05 of linear indicates linear effects existed among CON, LTP, MTP, and HTP, groups. P < 0.05 of quadratic indicates quadratic effects existed among CON, LTP, MTP, and HTP, groups.

3.2. Intestinal morphology

The effects of terpine-4-ol on the intestinal morphology of the small intestine in immune-stressed piglets are shown in Table 4 and Fig. 1. Compared with CON, LPS challenge decreased the villus length and V/C in the jejunum (P < 0.05), and decreased the V/C in the ileum (P < 0.001). Moreover, the villus length and V/C in the jejunum of the piglets in the terpine-4-ol supplementation groups increased (P < 0.05), and the V/C in HTP group in the ileum increased (P < 0.05) compared with those in the LPS group. The villus length and V/C in the jejunum and ileum showed linear and quadratic increases with the increasing terpine-4-ol level (P < 0.05). The crypt depth in the jejunum showed a quadratic decrease with decreasing of terpine-4-ol level (P < 0.001).

Table 4.

Effects of terpine-4-ol on the villus morphology of small intestine in immune-stressed piglets¹.

Site	Item	Groups					P-value2
		CON	LPS	LTP	MTP	HTP	One-way ANOVA	Linear	Quadratic
Jejunum	Villus length, μm	481.06 ± 21.251a	265.25 ± 15.052c	423.73 ± 13.792ab	432.32 ± 16.951b	389.98 ± 25.853ab	0.020	0.006	<0.001
	Crypt depth, μm	253.32 ± 14.352ab	318.41 ± 15.881a	265.00 ± 12.772ab	243.96 ± 12.353b	287.41 ± 27.101ab	<0.001	0.080	<0.001
	V/C ratio	1.85 ± 0.091a	0.91 ± 0.062b	1.70 ± 0.081a	1.96 ± 0.111a	1.62 ± 0.132a	<0.001	<0.001	<0.001
Ileum	Villus length, μm	266.43 ± 8.901b	253.13 ± 11.692b	275.51 ± 11.413b	265.81 ± 8.142b	325.49 ± 9.184a	<0.001	<0.001	0.002
	Crypt depth, μm	223.38 ± 10.791	280.74 ± 13.783	247.22 ± 8.982	245.51 ± 11.202	256.4 ± 11.044	0.089	0.143	0.039
	V/C ratio	1.35 ± 0.092a	1.03 ± 0.073c	1.15 ± 0.062bc	1.18 ± 0.061bc	1.41 ± 0.091ab	<0.001	<0.001	<0.001

V/C ratio = the ratio of villus length to crypt depth.

¹CON, control groups; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group.

²Different letter superscripts in the same row mean significant differences among different groups (P < 0.05). One-way ANOVA P-value indicate significant difference among different groups (P < 0.05). Linear and quadratic P-values indicate effects among the LPS, LTP, MTP, and HTP, groups (P < 0.05).

Fig. 1.

Effects of terpine-4-ol on the intestinal morphology and intestinal epithelial cell proliferation of small intestine in immune-stressed piglets. The intestinal morphology of the jejunum and ileum (A). The immunohistochemical staining of antigen Ki-67 (Ki67) of the jejunum and ileum (B). The gene expression of Ki67 in the jejunum and ileum (C and D). The immunohistochemical staining of caspase 3 of the jejunum and ileum (E). The gene expression of caspase 3 in the jejunum and ileum (F and G). CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups (P < 0.05).

3.3. Intestinal epithelial cell proliferation and apoptosis

The effects of terpine-4-ol on IEC proliferation and apoptosis in the small intestine of immune-stressed piglets are shown in Table 5 and Fig. 1. The gene expression of Ki67 in the jejunum and ileum was down-regulated (P < 0.05), and the number of Ki67⁺ cells in the crypts of the jejunum and ileum was decreased in the LPS-challenged group compared with those in the CON group (P < 0.05). In addition, the gene expression of Ki67 in the jejunum and ileum, the number of Ki67⁺ cells in the crypts of the ileum of terpine-4-ol groups were increased (P < 0.05), and the number of Ki67⁺ cells in the jejunum of MTP and HTP groups were increased (P < 0.05) compared with those in the LPS group. The gene expression of caspase 3 and the number of caspase 3⁺ cells in the jejunum and ileum were up-regulated in the LPS-challenged group compared with those in the CON group (P < 0.05). In addition, the gene expression of caspase 3 and the number of caspase 3⁺ cells in the jejunum and ileum in the terpine-4-ol groups were down-regulated (P < 0.05) compared with those in the LPS group. The number of Ki67⁺ cells in the jejunum (per villus and per crypt) and ileum (per crypt) increased linearly and quadratically (P < 0.05), while the number of caspase 3⁺ cells decreased linearly and quadratically (P < 0.05) with the increase of the terpine-4-ol level.

Table 5.

Effects of terpine-4-ol on the intestinal epithelial cell proliferation and apoptosis in the small intestine of immune-stressed piglets¹.

Site	Item	Groups					P-value2
		CON	LPS	LTP	MTP	HTP	One-way ANOVA	Linear	Quadratic
Jejunum	Number of Ki67+ cells per villus	22.51 ± 0.952b	22.68 ± 1.351b	21.55 ± 0.911b	27.63 ± 1.011a	26.62 ± 1.323a	<0.001	<0.001	0.004
	Number of Ki67+ cells per crypt	12.05 ± 0.743a	8.6 ± 0.551b	10.07 ± 0.461b	12.84 ± 0.652a	12.41 ± 0.783a	0.006	<0.001	0.004
	Number of caspase 3+ cells per villus and crypt	2.81 ± 0.311b	7.89 ± 0.582a	2.89 ± 0.301b	2.25 ± 0.311b	3.57 ± 0.434b	<0.001	0.016	0.009
Ileum	Number of Ki67+ cells per villus	19.54 ± 0.871	21.09 ± 1.021	18.77 ± 0.930	18.78 ± 0.790	21.43 ± 1.101	0.127	0.839	0.054
	Number of Ki67+ cells per crypt	14.00 ± 1.283a	6.65 ± 0.791c	10.46 ± 0.441b	14.03 ± 0.681a	15.03 ± 0.841a	<0.001	<0.001	<0.001
	Number of caspase 3+ cells per villus and crypt	3.58 ± 0.242b	9.58 ± 0.442a	3.25 ± 0.533b	2.08 ± 0.301b	2.33 ± 0.384b	<0.001	0.006	0.007

¹CON, control groups; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group.

²Different letter superscripts in the same rowmean significant differences among different groups (P < 0.05). One-way ANOVA P-value indicate significant difference among different groups (P < 0.05). Linear and quadratic P-values indicate effects among the LPS, LTP, MTP, and HTP, groups (P < 0.05).

3.4. Intestinal stem cells

The effects of terpine-4-ol on the expression of intestinal stem cell markers in immune-stressed piglets are shown in Fig. 2. Compared with that in the CON group, the gene expression of Lgr5 in the ileum was down-regulated in the LPS-challenged group (P < 0.05). However, the gene expression of Bmi1 in the jejunum and ileum of LTP group was up-regulated compared with that in the LPS stimulation group (P < 0.05). Moreover, the gene expression of Lgr5 in the jejunum of LTP and MTP groups, and Lgr5 in the ileum of MTP and HTP groups, were up-regulated (P < 0.05). Similar results for the protein expression of Lgr5 were observed in the intestine. Compared with those in the CON group, the protein expression levels of Lgr5 in the jejunum and ileum in the LPS stimulation group were lower (P < 0.05), whereas the protein expression levels of Lgr5 in the jejunum in the terpine-4-ol groups and of Lgr5 in the ileum in MTP group were greater (P < 0.05) than those in the LPS stimulation group. The gene expression of Bmi1 in the jejunum and ileum showed linear and quadratic relationships with the increase of terpine-4-ol level (P < 0.05). With the increase of terpine-4-ol level, the gene expression of Lgr5 showed a quadratic increase in the jejunum (P < 0.001), and linear and quadratic increases in the ileum (P < 0.05). The protein expression of Lgr5 was linearly and quadratically increased in the jejunum (P < 0.05), and quadratically increased in the ileum (P < 0.001).

Fig. 2.

Effects of terpine-4-ol on the expression of intestinal stem cell marker in immune-stressed piglets. Gene expression of B lymphoma Mo-MLV insertion region 1 (Bmi1) and leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5) and protein expression of Lgr5 in the jejunum (A, B, C). Gene expression of Bmi1 and Lgr5 and protein expression of Lgr5 in the ileum (D, E, F). CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups (P < 0.05).

3.5. Number of goblet cells and expression of Muc2

The effects of terpine-4-ol on the number of goblet cells and the expression of Muc2 in the small intestine of immune-stressed piglets are shown in Table 6, Table 7 and Fig. 3. Compared with those in the CON group, the number of goblet cells in the villi and crypts and the number of goblet cells in the jejunum were lower in the LPS group (P < 0.05). Moreover, the number of goblet cells in the villi and crypts and the number of goblet cells in the jejunum and ileum were greater in MTP group (P < 0.05) than in the LPS stimulation group. With the increase of terpine-4-ol level, the number of goblet cells in the jejunum showed linear and quadratic increases (P < 0.05), and the number of goblet cells in the ileum showed a quadratic increase (P = 0.012).

Table 6.

Effects of terpine-4-ol on the number of goblet cells in the small intestine of immune-stressed piglets¹.

Site	Item	Groups					P-value2
		CON	LPS	LTP	MTP	HTP	One-way ANOVA	Linear	Quadratic
Jejunum	Number of goblet cells in 3 villus	55.71 ± 7.261a	27.69 ± 4.622c	33.28 ± 3.843bc	46.00 ± 5.153ab	39.00 ± 4.023bc	<0.001	<0.001	<0.001
	Number of goblet cells in 3 crypts	62.00 ± 6.091a	39.94 ± 4.432b	36.33 ± 3.211b	56.67 ± 5.872a	42.17 ± 3.820b	<0.001	0.146	0.142
	Total goblet cells in 3 villus and 3 crypts	117.71 ± 11.491a	67.63 ± 8.473c	69.61 ± 5.852c	102.67 ± 9.572ab	81.17 ± 6.231bc	<0.001	0.012	0.006
Ileum	Number of goblet cells in 3 villus	35.44 ± 5.851ab	27.72 ± 2.921bc	28.39 ± 2.072bc	44.17 ± 6.453a	18.39 ± 2.744c	<0.001	0.529	0.002
	Number of goblet cells in 3 crypts	39.11 ± 3.084b	38.94 ± 3.411b	39.33 ± 2.983b	57.06 ± 4.000a	46.78 ± 4.151b	0.003	0.022	0.036
	Total goblet cells 3 villus and 3 crypts	74.56 ± 6.772b	66.67 ± 5.151b	67.72 ± 3.632b	101.22 ± 8.264a	65.17 ± 4.752b	<0.001	0.365	0.012

¹CON, control groups; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group.

²Different letter superscripts in the same rowmean significant differences among different groups (P < 0.05). One-way ANOVA P-value indicate significant difference among different groups (P < 0.05). Linear and quadratic P-values indicate effects among the LPS, LTP, MTP, and HTP, groups (P < 0.05).

Table 7.

Effects of terpine-4-ol on the expression of Muc2 in the small intestine of immune-stressed piglets¹.

Item	Groups					P-value2
	CON	LPS	LTP	MTP	HTP	One-way ANOVA	Linear	Quadratic
Muc2 expression in the jejunum (IRS score3)	7.75 ± 0.272c	4.79 ± 0.353d	8.69 ± 0.274b	7.87 ± 0.261c	11.52 ± 0.154a	<0.001	<0.001	<0.001
Muc2 expression in the ileum (IRS score)	7.34 ± 0.312b	1.69 ± 0.124d	5.13 ± 0.242c	6.86 ± 0.233b	9.80 ± 0.241a	<0.001	<0.001	<0.001

Muc2 = mucin 2; IRS = immunoreactive score.

¹CON, control groups; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group.

²Different letter superscripts in the same rowmean significant differences among different groups (P < 0.05). One-way ANOVA P-value indicate significant difference among different groups (P < 0.05). Linear and quadratic P-values indicate effects among the LPS, LTP, MTP, and HTP, groups (P < 0.05).

³Staining intensity scored as follows: 1, weak, 2, moderate, 3, strong. Percentage of cells scored as follows: 1, 1% to 10%; 2, 11% to 50%; 3, 51% to 80%; 4, >80%. Intensity and percentage scores are multiplied yielding an IRS: 0 to 2 = no staining; 3 to 4 = weak staining; 6 to 8 = moderate staining; 9 to 12 = strong staining.

Fig. 3.

Effects of terpine-4-ol on the number of goblet cells, the protein expression of mucin 2 (Muc2) and chromogranin A (ChgA) in the small intestine of immune-stressed piglets. The goblet cells in the jejunum and ileum (A, B). The immunohistochemical staining of Muc2 in the jejunum and ileum (C). The immunohistochemical staining of ChgA in the jejunum and ileum (D). CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups (P < 0.05).

The gene expression of Muc2 in the jejunum and protein expression in the jejunum and ileum were down-regulated (P < 0.05, Table 7 and Fig. 3) in the LPS stimulation group compared with those in the CON group. However, the protein expression of Muc2 in the jejunum and ileum of the terpine-4-ol groups and the gene expression compared with those in the LPS stimulation group. Muc2 protein expression demonstrated significant linear and quadratic dose-dependent increases with elevating terpine-4-ol levels (P < 0.05).

3.6. Intestinal endocrine cells

The effect of terpine-4-ol on the expression of chromogranin A (ChgA) in the small intestine of immune-stressed piglets is shown in Table 8 and Fig. 3. Compared with those in the CON group, the gene expression of ChgA, and the number of ChgA⁺ cells in both the crypts and villi of the jejunum, and the number of ChgA⁺ cells in the ileum, were decreased in the LPS group (P < 0.05). Moreover, the number of ChgA⁺ cells in both the crypts and villi of the jejunum and ileum increased in the terpine-4-ol groups, and the gene expression of ChgA in the jejunum of LTP and MTP groups and the gene expression of ChgA in the ileum of terpine-4-ol groups were increased (P < 0.05) compared with that in the LPS-challenged group. The number of ChgA ⁺ cells and the gene expression of ChgA in the small intestine showed linear and quadratic increases with the increase of terpine-4-ol level (P < 0.05).

Table 8.

Effects of terpine-4-ol on the gene expression of ChgA and the number of ChgA ⁺ cells in the small intestine of immune-stressed piglets¹.

Site	Item	Groups					P-value2
		CON	LPS	LTP	MTP	HTP	One-way ANOVA	Linear	Quadratic
Jejunum	Gene expression of ChgA	1.00 ± 0.044a	0.48 ± 0.008c	0.76 ± 0.010b	0.71 ± 0.009b	0.44 ± 0.005c	<0.001	0.004	0.016
	Number of ChgA+ cells in per villus	2.28 ± 0.163a	0.92 ± 0.121c	1.41 ± 0.152b	2.31 ± 0.191a	1.53 ± 0.150b	<0.001	0.005	<0.001
	Number of ChgA+ cells in per crypt	2.88 ± 0.162a	1.34 ± 0.123c	1.97 ± 0.201b	2.50 ± 0.162a	1.81 ± 0.151b	<0.001	0.026	<0.001
Ileum	Gene expression of ChgA	1.01 ± 0.091bc	0.71 ± 0.121c	10.86 ± 0.393a	1.93 ± 0.026a	1.46 ± 0.209ab	0.006	0.035	0.032
	Number of ChgA+ cells in per villus	1.44 ± 0.131a	0.93 ± 0.110b	1.39 ± 0.201a	1.56 ± 0.150a	1.48 ± 0.142a	<0.001	<0.001	<0.001
	Number of ChgA+ cells in per crypt	2.62 ± 0.161a	1.09 ± 0.112b	2.65 ± 0.210a	2.26 ± 0.121a	2.41 ± 0.161a	<0.001	<0.001	<0.001

ChgA = chromogranin A.

¹CON, control groups; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group.

²Different letter superscripts in the same rowmean significant differences among different groups (P < 0.05). One-way ANOVA P-value indicate significant difference among different groups (P < 0.05). Linear and quadratic P-values indicate effects among the LPS, LTP, MTP, and HTP, groups (P < 0.05).

3.7. Intestinal paneth cells

The effect of terpine-4-ol on the expression of Lyz in the small intestine of immune-stressed piglets is shown in Fig. 4. Compared with those in the CON group, the gene and protein expression of Lyz in the jejunum were up-regulated, while the gene expression of Lyz in the ileum were down-regulated (P < 0.05) in the LPS group. In addition, the gene and protein expression of Lyz in the jejunum of LTP and MTP groups was up-regulated (P < 0.05), the gene expression of Lyz in the ileum of LTP and MTP groups was up-regulated (P < 0.05), and the protein expression of Lyz in the small intestine of HTP group was down-regulated (P < 0.05) compared with that in the LPS-challenged group. With the increase of terpine-4-ol level, the gene expression of Lyz in the small intestine showed quadratic increases (P < 0.05), and the protein expression of Lyz in the small intestine showed linear and quadratic increases (P < 0.05).

Fig. 4.

Effects of terpine-4-ol on the expression of lysozyme (Lyz) in the small intestine of immune-stressed piglets. The gene expression of Lyz in the jejunum (A). The protein expression of Lyz in the jejunum (B). The gene expression of Lyz in the ileum (C). The protein expression of Lyz in the ileum (D). CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups (P < 0.05).

3.8. Intestinal absorption cell

The effects of terpine-4-ol on the expression of villin in the small intestine of immune-stressed piglets are shown in Fig. 5. Compared with that in the CON group, the gene expression of villin in the ileum was down-regulated, and the protein expression of villin sharply decreased in the small intestine of the LPS group (P < 0.05). However, the gene expression of villin in the jejunum of LTP and MTP groups, the gene expression of villin in the ileum of MTP group, and the protein expression of villin in the small intestine were up-regulated (P < 0.05) compared with those in the LPS-challenged group. With the increase of terpine-4-ol level, the gene and protein expression of villin in the small intestine showed quadratic increases (P < 0.05).

Fig. 5.

Effects of terpine-4-ol on the expression of villin in the small intestine of immune-stressed piglets. The immunohistochemical staining of villin in the jejunum and ileum (A). The gene expression of villin in the jejunum and ileum (B and C). The protein expression of villin in the jejunum and ileum (D and E). CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups (P < 0.05).

3.9. Gene and protein expression of Wnt/β-catenin signaling pathway

The effects of terpine-4-ol on the gene and protein expression of Wnt/β-catenin signaling pathway in the small intestine of immune-stressed piglets are shown in Fig. 6, Fig. 7. Compared with those in the CON group, the gene expression of Wnt1 and cyclin D1 in the jejunum, and the gene expression of Wnt1, β-catenin and TCF4 in the ileum of the LPS group were down-regulated (P < 0.05), whereas the gene expression of C-Myc in the jejunum was up-regulated (P < 0.05) in the LPS group. Moreover, compared with those in the LPS group, the gene expression of Wnt1, β-catenin and cyclin D1 in the jejunum of the terpine-4-ol groups and of TCF4 and C-Myc in the jejunum of LTP and MTP groups, and that of Wnt1, β-catenin, TCF4 and C-Myc in the ileum of the terpine-4-ol groups, and cyclin D1 in the ileum of LTP and MTP groups, were up-regulated (P < 0.05). Gene expression of axis inhibition protein 2 (Axin2) in the jejunum of MTP and HTP groups, and the gene expression of Axin2 in the ileum of HTP group, were higher than those in the LPS group. With the increase of terpine-4-ol level, the gene expression of Wnt/β-catenin signaling pathway in the small intestine showed quadratic increases (P < 0.05), and the gene expression of Wnt1, β-catenin and Axin2 in the jejunum, and the gene expression of Wnt1, β-catenin, TCF4, C-Myc and Axin2 in the ileum, showed linear increases (P < 0.05).

Fig. 6.

Effects of terpine-4-ol on the gene expression of wingless-type MMTV integration site family (Wnt)/β-catenin in the small intestine of immune-stressed piglets. The gene expression of Wnt, β-catenin, T-cell factor 4 (TCF4), cyclin D1 and cellular myelocytomatosis viral oncogene homolog (c-Myc) and axis inhibition protein 2 (Axin2) in the jejunum (A, B, C, D, E and F). The gene expression of Wnt, β-catenin, TCF4, cyclin D1, c-Myc and Axin2 in the ileum (G, H, I, J, K and L). CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups (P < 0.05).

Fig. 7.

Effects of terpine-4-ol on the protein expression of wingless-type MMTV integration site family (Wnt)/β-catenin in the small intestine of immune-stressed piglets. Western blots result for proteins in the jejunum and ileum (A, B and C). The protein expression of Wnt1 (D, H), β-catenin (E, I), T-cell factor 4 (TCF4) (F, J), cyclin D1 (G, K), nuclear β-catenin protein expression in the jejunum and ileum (L, M) and cellular myelocytomatosis viral oncogene homolog (c-Myc) (N, O) in the jejunum and ileum, respectively. PCNA = proliferating cell nuclear antigen. CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups (P < 0.05).

The protein expression of Wnt/β-catenin signaling pathway exhibited a similar trend to that of the gene expression. Compared with those in the CON group, the protein expression levels of β-catenin, TCF4 and cyclin D1 in the jejunum, and Wnt1, β-catenin, cyclin D1 and C-Myc in the ileum of the LPS group were down-regulated (P < 0.05). Compared with those in the LPS group, the protein expression levels of Wnt1 in MTP group, cyclin D1 in LTP group in the jejunum, Wnt1, β-catenin and TCF4 in the ileum of LTP and MTP groups, cyclin D1 in the ileum of terpine-4-ol groups, were all increased (P < 0.05). Similar results for the protein expression of nuclear β-catenin were observed in the intestine. Compared with that in the CON group, nuclear β-catenin expression in the small intestine of the LPS group was down-regulated (P < 0.05), whereas the nuclear β-catenin expression in the jejunum of MTP and HTP groups and in the ileum of LTP and MTP groups were up-regulated (P < 0.05) compared with that in the LPS-challenged group. With the increase of terpine-4-ol level, the protein expression of Wnt/β-catenin signaling pathway and the nuclear β-catenin in the small intestine showed quadratic increases (P < 0.05), the protein expression of TCF4, cyclin D1, C-Myc and the nuclear β-catenin in the jejunum and the protein expression of Wnt1, cyclin D1 in the ileum showed linear increases (P < 0.05).

4. Discussion

Previous studies suggested that TTO could improve intestinal barrier function, decrease weaning diarrhea, facilitate the growth of weaned piglets, and the effects were even greater than those of antibiotics (Wang et al., 2018; Dong et al., 2019). Terpinen-4-ol, which accounts for 60% of TTO, is one of the main active components of TTO. The effects of terpine-4-ol on the growth performance of weaned piglets and the underlying mechanisms are not clear at present. We hypothesized that terpine-4-ol improved the growth performance of piglets through the regulation of the homeostasis of IECs and that terpine-4-ol could be used as a feed additive for weaned piglets in the future.

Growth performance is the most important factor that may reflect the effects of new additives. The results of this study revealed that 60 and 90 mg/kg terpine-4-ol supplementation increased the ADG and ADFI and that 30 mg/kg terpine-4-ol supplementation decreased FCR. These results were in accordance with the previous study of TTO (containing 60% terpine-4-ol), which revealed that 100 mg/kg TTO increased the ADG and ADFI of weaned piglets (Dong et al., 2019). Zhang (2021) also confirmed the growth-promoting effects of TTO in weaned piglets. In this study, terpine-4-ol supplementation also decreased the diarrhea rate of piglets. Terpine-4-ol has an antiarthritic effect, which may be attributed to the down-regulation of proinflammatory cytokines (Aslam et al., 2022). Terpine-4-ol can also inhibit LPS-induced acute lung injury through attenuating LPS-induced nuclear factor κB (NF-κB) activation and the inflammatory response (Ning et al., 2018). Our previous study also suggested that terpine-4-ol supplementation inhibited the secretion of proinflammatory cytokines in immune-stressed piglets (data not published), which might explain the reduced diarrhea of piglets to some extent. In summary, a proper concentration of terpine-4-ol in the diet improved the growth performance of weaned piglets.

As the first line of defense against intestinal bacteria and toxins, IECs expose to bacteria or LPS, whereas pathogenic bacteria or LPS can cause IEC damage. The expression of Ki67 indicates cell proliferation, whereas the expression of caspase 3 indicates cell apoptosis in the IECs. In this study, LPS decreased the number of Ki67⁺ cells and increased the number of caspase 3⁺ cells, whereas terpine-4-ol increased the number of Ki67⁺ cells and decreased the number of caspase 3⁺ cells in the small intestine. A previous study also demonstrated that Escherichia coli LPS challenge decreased crypt cell proliferation in piglets (Liu et al., 2008), and LPS induced cell apoptosis in the intestine of rat (Li et al., 2018). Lipopolysaccharide also decreased the number of Ki67⁺ taste progenitor cells (Cohn et al., 2010). However, other studies reported that LPS induced IEC cyclooxygenase-2 in vitro (Hsu et al., 2010). Hence, LPS decreased IEC proliferation in piglets, and the effects might be dose-dependent in vitro. Terpine-4-ol, a constituent of tea-tree oil, is known to inhibit the growth of a broad range of bacteria (Bazaka et al., 2011). Terpine-4-ol also inhibits cancer growth (Nakayama et al., 2017). It has also been demonstrated that terpine-4-ol inhibits the proliferation and induce the apoptosis of pancreatic cancer cells (Cao et al., 2022). However, the effects of terpine-4-ol on the growth of IECs have not been investigated. We found that terpine-4-ol could facilitate the growth of IECs in piglets in vitro, in a dose-dependent manner (data not published). Our results suggested that terpine-4-ol may attenuate LPS-induced cell apoptosis and reduce the decrease in cell proliferation induced by LPS, thus improving the intestinal cell homeostasis.

Leucine-rich repeat-containing G-protein coupled receptor 5 is a marker of stem cells in multiple adult tissues and cancers (Barker et al., 2007). A decrease in intestinal stem cells impairs of intestinal regeneration (Rodríguez-Colman et al., 2017). In this study, LPS decreased the expression of the stem cell marker Lgr5, whereas terpine-4-ol increased Lgr5 expression in the small intestine of weaned piglets. Lipopolysaccharide also caused reduced expression of Lgr5 in the duodenal crypt of chickens (Yu et al., 2021). However, LPS enhanced the expression of Lgr5 in the primary astrocytes in an in vitro mouse model and in endometrial epithelial cells obtained from bovine uteri (Chen et al., 2016; Zhang et al., 2022). Hence, LPS decreased the number of stem cells in the small intestine in vivo; however, the results were quite different in vitro. Terpine-4-ol can induce cell death in cancer cell lines (Banjerdpongchai and Khaw-On, 2013). However, in this study, the results showed that terpine-4-ol increased the number of stem cells in the small intestine. These results are somewhat contradictory, but the nutritional and toxic effects of terpine-4-ol on cells are both cell dependent and dose dependent.

Small intestinal epithelium homeostasis involves 4 principal cell types: enterocytes, goblet, enteroendocrine and Paneth cells (Kulkarni and Newberry, 2019). Specialized secretory epithelial cell types such as Paneth cells and goblet cells limit bacterial adhesion and infiltration by secreting antibacterial peptides and mucins, respectively (Günther et al., 2011). The goblet cells in the small intestine function as passages that deliver luminal antigens to the underlying lamina propria dendritic cells in the steady state (McDole et al., 2012). The intestinal mucus layer plays a key role in the maintaining of host-microbiota homeostasis (VanDussen et al., 2012).

In this study, LPS decreased the number of goblet cells and Muc2 secretion, while 60 mg/kg terpine-4-ol increased the number of goblet cells and Muc2 secretion in the small intestine. The decreased levels of goblet cell mucins in the small intestine may lead to an impaired mucus layer and increased susceptibility to enteric bacterial infection (Jung and Saif, 2017). Our results are in accordance with those of previous studies, which revealed that LPS stimulation also decreased the number of goblet cells in the intestines of zebrafish and tended to reduce the number of goblet cells in the intestines of fattening pigs (Lu et al., 2021; Kvidera et al., 2016). A previous study in mice revealed that a low dose of LPS cannot be stuck to the mucus layer or cause loss of function of the goblet cells. However, a high dose of LPS can be stuck to the mucus and cause loss of function of goblet cells, thus directly increasing the severity of the immunosuppression in the body (Li et al., 2020). However, LPS from the crypt-specific core microbiota enhances intestinal epithelium cell differentiation, especially that of the goblet cell lineage (Naito et al., 2017). Although the effects of LPS on the number and function of goblet cells are quite different in animals, resources or the doses differ, the decreased goblet cell number and Muc2 secretion indicated impaired IEC homeostasis in this study. The effects of terpine-4-ol on the number or function of goblet cells could not be determined at present, nor could the effects of TTO. This study is the first to demonstrate that terpine-4-ol can increase the number and function of goblet cells in the small intestine, which may provide a new explanation for how terpine-4-ol can reduce the diarrhea in weaned piglets.

Chromogranin A is a marker of enteroendocrine cells. The main function of endocrine cells is to secrete functional peptides and steroid hormones, including gastrin, glucagon-like peptides, neuropeptides, and calcitonin gene-related peptides (Pereira et al., 2017). These intestinal hormones regulate the growth of the intestinal mucosa, intestinal motility and inflammation (Gribble and Reimann, 2019). In this study, LPS decreased the expression of ChgA, whereas terpine-4-ol increased the number of enteroendocrine cell markers in the small intestine. A previous study demonstrated that LPS decreased the viability of GLUTag enteroendocrine cells (a murine intestinal L-cell model that secretes glucagon-like peptide-1) by inducing their apoptosis (Wang et al., 2019). Another study demonstrated that LPS induced the pyroptosis in enteroendocrine L cells in the ileum by increasing the expression of NOD-like receptor protein 3 (NLRP3) and gasdermin D (GSDMD), which might result in hyperglycemia in piglets (Zong et al., 2022). The glucose level was not tested in the present study; however, the results shed new light on the relationship between nutrient metabolism and inflammation.

Lysozyme, a key antimicrobial protein produced by Paneth cells, exhibits broad-spectrum microbicidal activity against viruses, bacteria, fungi, and protozoa (Vaishnava and Hooper, 2020). In Crohn's disease, impaired Lyz expression in Paneth cells has been linked to compromised intestinal barrier function and dysregulated host–microbe interactions (Cadwell et al., 2009). Our findings align with previous reports that LPS suppresses Lyz expression, as observed in macrophages (Singh and Lin, 2017) and, in this study, in the ileum of piglets. Notably, we also demonstrated that LPS upregulated Lyz gene and protein expression in the jejunum and ileum of weaned piglets, which may reflect a compensatory antimicrobial response to bacterial challenge (Zhang et al., 2021). Intriguingly, dietary supplementation with terpine-4-ol not only counteracted LPS-induced suppression of Lyz in the ileum but further enhanced its expression in both the jejunum and ileum, suggesting a potential synergistic role in reinforcing intestinal immunity. The dual regulatory effects of LPS on Lyz, both inhibitory and stimulatory, may depend on tissue specificity, exposure duration, or immune context. The chronic LPS exposure likely disrupts Paneth cell function (Singh and Lin, 2017), acute challenge could transiently upregulate Lyz as part of innate defense (Zhang et al., 2021). Terpine-4-ol's ability to amplify Lyz expression under inflammatory conditions highlights its therapeutic potential, possibly via autophagy induction (Singh and Lin, 2017) or modulation of pathogen-sensing pathways (Chen et al., 2023). This is the first study to report terpine-4-ol's role in Lyz regulation, offering novel insights for managing Crohn's disease and other intestinal disorders characterized by Paneth cell dysfunction. Future research should explore the mechanisms underlying terpine-4-ol's effects, including its interplay with autophagy and gut microbiota.

Villin, the brush border transporter, is a marker of intestinal absorptive cells (Yeruva et al., 2010). Villin regulates signal transduction, cell morphology, cell migration, and cell apoptosis (Khurana and George, 2008). Villin is an antiapoptotic protein since it maintains actin dynamics in the small intestine. The deletion of villin inhibits cell extrusion from the villus tips, but the genetic deletion of villin induces apoptosis, which may be associated with a weaker ability to clear dead cells (Wang et al., 2016). In this study, LPS decreased the expression of villin, whereas terpine-4-ol up-regulated the expression of villin in the small intestine of weaned piglets. Lipopolysaccharide also induced decreased gene expression of villin in the intestine of chickens (Bott et al., 2023). The decreased expression of villin in LPS-treated piglets indicates impaired intestinal cell homeostasis and decreased absorptive function, whereas terpine-4-ol has positive effects on cell homeostasis in the intestines of weaned piglets.

Wnt/β-catenin signaling pathway plays a key role in the homeostasis of IECs, including maintaining stemness and inducing the proliferation of stem cells (Fevr et al., 2007). The Wnt/β-catenin signaling pathway includes 4 parts: the extracellular signal (mediated by Wnt proteins), membrane segment (containing the Wnt receptor Frizzled protein), the cytoplasmic segment (β-catenin, glycogen synthase kinase-3β, dishevelled, axin, adenomatous polyposis coli and casein kinase 1), and the nuclear segment (β-catenin translocates to the nucleus) (Nusse and Clevers, 2017). Once Wnt is activated, the stability of β-catenin is induced, and β-catenin is transferred into the nucleus, facilitating the expression of the genes encoding cyclin D1 and C-Myc, which are involved in cell proliferation, survival, differentiation, and migration (Cruciat and Niehrs, 2013). Axin2 functions as negatively regulating the Wnt signaling (Garrett, 2022). In this study, terpine-4-ol up-regulated gene expression of Axin2 and alleviated the LPS-induced inactivation of Wnt/β-catenin signaling pathway. A previous study suggested that LPS led to down-regulation of the Wnt/β-catenin signaling pathway in necrotizing enterocolitis (Gomart et al., 2021). The regulatory effects of terpine-4-ol on the Wnt/β-catenin signaling pathway in inflammation-related diseases have not been investigated. Our study is the first to demonstrate that terpine-4-ol might improve the LPS-induced impaired IEC homeostasis and intestinal injury through the activation of Wnt/β-catenin signaling pathway.

5. Conclusion

Terpine-4-ol supplementation improved growth performance and decreased the diarrhea rate of piglets, and 60 mg/kg supplementation in the diets of weaned piglets was recommended. Lipopolysaccharide inhibited IEC proliferation and decreased the number of intestinal stem cells, goblet cells, endocrine cells, Paneth cells and absorption cells, whereas terpine-4-ol alleviated these impairments. Overall, terpine-4-ol alleviated the LPS-induced intestinal injury in piglets by regulating the homeostasis of IECs, which might be associated with Wnt/β-catenin signaling pathway. The results of this study illustrate a new direction for the nutritional regulation of intestinal inflammatory injury.

Credit Author Statement

Li Dong: Conceptualization, Funding acquisition, Investigation, Methodology, Writing - original draft. Lihuai Yu: Conceptualization, Project administration, Supervision, Writing - review & editing. Daiwen Chen: Conceptualization, Funding acquisition, Supervision, Writing - review & editing. Mengxuan Wang: Data curation, Formal analysis, Investigation. Yangshu Zhou: Data curation, Formal analysis, Investigation. Guangzhi Qiu: Data curation, Formal analysis, Investigation. Jun Liu: Data curation, Formal analysis, Investigation. Hongrong Wang: Validation, Writing - review & editing. Aimin Wu: Validation, Writing - review & editing.

Declaration of Competing Interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.