Comparative effects of antimalarial drugs on oxidative phosphorylation, mitochondrial dynamics and mitophagy in Plasmodium berghei-infected mice

Abstract

Mitochondria occupy prominent position in cell metabolism. Information on changes in host mitochondrial capacity in electron transport system, dynamics and mitophagy in mice infected with resistant Plasmodium berghei and thereafter treated with some orthodox drugs, is critical to the survival and the organelles’ metabolism. In this study, the effects of some antimalarial drugs were investigated on mitochondrial permeability transition (mPT) pore opening, F_oF₁ ATPase and lipid peroxidation, oxidative phosphorylation and mitochondrial dynamics in mice infected with chloroquine resistant (ANKA) strain of Plasmodium berghei. Thirty-five Swiss-mice (18 ± 3 g) were infected intraperitoneally with chloroquine resistant (ANKA) strain of Plasmodium berghei and treated orally and once daily with (10 mg/kg) dose of Amodiaquine artesunate (AA), Artemether-Lemefantrine (AL), Sulfadoxine- pyrimethamine (SP) and Artesunate (ART), On day 6, animals were sacrificed and livers were removed. Liver mitochondria were isolated and mitochondrial permeability transition (mPT) pore opening, F₀F₁ ATPase (mATPase) and lipid peroxidation (mLPO) were determined spectrophotometrically. Gene expressions on liver mitochondrial complexes I, II, III, IV and V, DNM1L, DRP1, OPA 1 Mitofusin 1 and 2, PINK 1, FUNDC1, PGC-1α and prohibitins 1 and 2 were determined using gel electrophoresis. AA, AL and SP did not significantly open the mPT pore while ART caused its opening (7 fold) and enhance mitochondrial F_oF₁ ATPase (P < 0.01), SP and AA induced peroxidation of mitochondrial membrane phospholipids (P < 0.01) when compared to the infected control. SP and AA significantly silenced the expressions of mitochondrial complexes. The effects of these drugs on mitochondrial fission and fusion vary significantly: AA down-regulated the expressions of DRP1, OPA 1 while AA, AL and ART decreased the expression of Mitofusin 2 as observed in the infected control. Significant down-regulation in the expressions of PINK 1 by SP, FUNDC1 by AA and AL, DNM1L by ART, PGC-1α by AA, AL, and ART, and prohibitins 1 and 2 by AA and AL similar to the infected control were observed. This study showed that host mitochondria respond differently to antimalarial drugs.

Highlights

• •Different antimalarial drugs initiate varying effects on host mitochondrial oxidative phosphorylation.
• •Mitofusins 1 and 2 and OPA 1 genes may not be expressed simultaneously for mitochondrial fusion.
• •FUNDC1 expression elicited mitophagy via hypoxia in Plasmodium-infected mice.
• •Different antimalarial drugs may influence varying effects on host mitochondrial biogenesis.

1. Introduction

Malaria is a potentially fatal disease transmitted to humans by some species of mosquitoes. It is predominantly located in tropical nations. It is both avoidable and treatable. The infection is attributable to a parasite and is not transmissible between individuals. Symptoms may range from minor to life-threatening. Fever, chills, and headache are mild symptoms. Acute symptoms encompass exhaustion, disorientation, convulsions, and respiratory distress. Infants, children under five years, pregnant women and girls, travelers, and anyone with HIV or AIDS are at an elevated risk of serious infection. Interventions can prevent mild instances from deteriorating. Malaria mostly transmits to humans via the bites of infected female Anopheles mosquitoes. Blood transfusions and infected needles can also spread malaria [49]. The initial symptoms may be subtle, resembling many febrile infections, making them challenging to identify as malaria. If not addressed, P. falciparum malaria may advance to critical illness and mortality within 24 h. Five kinds of Plasmodium parasites are responsible for malaria in humans, with P. falciparum and P. vivax representing the most significant threats. Plasmodium falciparum is the most lethal malaria parasite and the most widespread in Africa [50]. Plasmodium vivax is the predominant malaria parasite in the majority of nations beyond sub-Saharan Africa. Other malaria species capable of infecting humans include P. malariae, P. ovale, and P. knowlesi [51]. Various measures have been implemented to address malaria, including the administration of antimalarial medications. The primary categories of pharmaceuticals employed in malaria treatment consist of quinoline-related chemicals, antimicrobials, artemisinin derivatives, and antifolates. No singular pharmaceutical agent capable of eliminating all stages of the parasite's life cycle has been identified or produced; hence, many classes of medications are frequently administered concurrently to synergistically address malarial infections [48]. Malaria infection and therapy may impact host mitochondrial function, which might result in mitochondrial malfunction and cellular apoptosis.

Mitochondria regulate cellular metabolism and regulate homeostasis coupled with their principal function of the generation of ATP in eukaryotic cells. Mitochondria are capable of generating ATP by oxidizing the high energy compounds (NADH and FADH₂) and transport of electrons as reducing equivalent through the inner mitochondrial membrane complexes adapted for this purpose [1]. This procedure of ATP generation is believed to be affected in mouse malaria. Although, ATP synthesis is one of the principal roles of mitochondria, these organelles participate in determining the fate of the cell through mitochondrial-mediated cell death. The induction of the mitochondrial permeability transition (mPT) initiates cell death via the loss of some inner mitochondria membrane proteins such as cytochrome c, a protein that is principally involved in ATP synthesis. This event takes place via the transition of the physiological roles of the pores opening to a pathological one via an irreversible opening of the pores in malaria disease and when this disease is treated with some drugs [2], [3]. The opening of these pores cannot independently lead to cell death. It is accompanied by ATP hydrolysis via a reversal of the ATP-synthetic role of complex V to F_oF₁ ATPase [2]. Several types of cell death may occur especially in a diseased state. Peroxidation of membrane lipids occur in malaria. Lipid peroxidation products such as hydroperoxides and peroxyl radical cause ferroptosis form of cell death via membrane rupture [4]. Mitochondrial homeostasis occurs via the organelles’ fusion, fission and mitophagy [5]. In fission, initiated by dynamin-related protein 1 (DRP 1), mitochondria splits into two which may thus increase their copy number in which the dysfunctional daughter mitochondria is eliminated via mitophagy. Mitochondrial fusion, caused by the upregulation of optic atrophy 1 (OPA 1), mitofusin 1 and 2, occurs in which the matrix milieu of two mitochondria fuse together as one. Mitochondrial dynamics has previously been described in cancer and some neurodegenerative diseases [6], [7]. The infection of the liver tissue by Plasmodium parasite affects the liver and this physiological alteration affects liver mitochondrial calcium concentration thus distorting its homeostasis and causing endoplasmic reticulum stress and hypoxia. While an event such as redox activity can distort mitochondrial homeostasis, this distortion can be restored via mitochondrial dynamics and mitophagy [8]. Hypoxia can initiate mitophagy via the expression of the FUN14 domain-containing protein (FUNDC1) gene [9] Mitochondrial fission, fusion and mitophagy are interconnected processes that ensure healthy mitochondrial turnover that ensures the delivery of depolarized, and irreversibly-damaged mitochondria to the lysosome for degradation [10], [11], Attempts are made by the cell to salvage damaged mitochondria via the restoration of the membrane potential. However, mitophagy is the only option left when this is impossible [12], [13]. Autophagy is a catabolic and non-selective process while mitophagy is a specific variant of this type of event. This may occur via the PINK 1 dependent or independent pathway. In the former, damaged mitochondria are tagged with ubiquitin for removal [14]. Mitochondrial fusion occurs when the matrix constituents of two mitochondria are mixed via the merging of the inner and outer membranes of the two involved mitochondria. It has become evidently clear from the foregoing that mitochondrial dynamics and mitophagy constitute the two main pathways through which mitochondrial quality control and cellular homeostasis are regulated. Aberrations in these pathways will have metabolic and physiological consequences on mitochondria. We have previously reported the effect of mouse malaria treatment with some drugs on mPT pore opening in Plasmodium-infected mice using susceptible models. However, scientific reports on other drugs such as amodiaquine-artesunate in resistant malaria on mPT are lacking. Moreover, there is no evidence yet that the effects of these drugs on mPT may be strain-dependent [3], [15], [16]. This study focuses on the molecular mechanisms of oxidative phosphorylation and mitochondrial dynamics in the liver of Plasmodium berghei-infected mice, as well as the impact of specific antimalarial drugs on cellular survival and the restoration of mitochondrial morphology, function, and homeostasis.

2. Materials and methods

2.1. Experimental animals: grouping and treatment

Male Swiss mice (18 ± 3 g), obtained from the Institute of Advanced Medical Research and Training, College of Medicine University of Ibadan, Nigeria, were acclimatized for one week and later infected with chloroquine-resistant strain (ANKA) of Plasmodium berghei. Infection of the erythrocytes by the parasite was confirmed after 72 h when blood was obtained from the tail snip, smeared on the slide, fixed in methanol and stained with Giemsa stain. Infected experimental mice were grouped and treated for 5 days once daily through oral gavage as follows: group I negative control (Parasitized Untreated (NC), was treated with vehicle while groups II to IV were treated with 10 mg/kg each of Amodiaquine-artesunate, Artemether-Lemefantrine, Sulfadoxine-pyrimethamine and Artesunate of drug preparations in distilled water. Uninfected control (normal control) was treated with the vehicle (distilled water) only. Slides were collected daily for 5 days, percentage parasitemia and parasite clearances were assessed by microscopy.

2.2. Ethical consideration

The experimental procedures followed in this study complied with the ARRIVE guidelines and they were also carried out according to the U.K. animals act of 1986 and National Research Council’s guide for the care and use of laboratory animals. This study was approved by the University of Ibadan Animal Care and Use Research and Ethical Committee and an approval number; UI-ACUREC/020–0125/20 was assigned to the study.

2.3. Mitochondria preparation

Mouse liver mitochondria were isolated from mice using an approved procedure [17]. They were at first, sacrificed using cervical dislocation. The liver was then excised from the thoracic cavity, washed, weighed and thereafter, minced in the isolation buffer (210 mM mannitol, 70 mM sucrose, 5 mM HEPES-KOH (pH 7.4) and 1 mM EGTA) on ice. A 9 % suspension of the liver sample was homogenized evenly on ice. The homogenate was spun in a refrigerated (4⁰C) centrifuge (Sigma 3–30 K, Germany) twice at 2, 300 rpm for 5 min and the sediment was discarded each time. The supernatant was thereafter, spun at 13,000 rpm for 10 min to obtain the mitochondria. Mitochondria pellets were then washed twice at 12,000 rpm with washing buffer (210 mM mannitol, 70 mM sucrose, 5 mM HEPES KOH (pH7.4) and 0.5 % BSA). The washed mitochondria were suspended in suspension buffer (210 mM mannitol, 70 mM sucrose and 5 mM HEPES-KOH (pH7.4) and dispensed in stocks into Eppendoff tubes and kept on ice. Mitochondria used for ATPase activity were isolated essentially by this method but the buffers were substituted with 0.25 M sucrose.

2.4. Protein determination

The determination of mitochondrial protein was done by using the method of Lowry et al. [18], and the actual mitochondrial protein content was determined from a standard curve prepared by using Bovine Serum Albumin (BSA). Mitochondria (10 μL) were mixed with distilled water to a total volume of 1 mL to which was added 3 mL of a 100:1:1 mixture of 2 %Na₂CO₃, 2 % Na-K tartrate and 2 % CuSO₄.5H₂O, respectively. This was left at room temperature for 10 min and thereafter, Folin-Ciocalteau (0.3 mL), prepared by diluting 2 N stock in five-fold was added and the whole mixture was further left at room temperature for additional 30 min, and finally vortexed. The absorbance was read against reagent blank at 750 nm and the protein concentration determined from a standard curve.

2.5. Assessment of hepatic mitochondrial permeability transition

The permeabilization of mitochondria was determined via the opening of the mPT pore, kinetically measured using a previously described method [19]. Mitochondrial volume, containing 0.4 mg/mL from the baseline control was incubated in a cuvette at room temperature in suspension buffer after adding 8 mM rotenone for 210 s. Thereafter, 5 mM sodium succinate was added, and the change in absorbance at 540 nm was recorded every 30 s for 12 min. Later, in another experimental setup, 3 mM CaCl₂ was added to another similar mitochondrial volume from the baseline incubated in a mixture of suspension buffer and rotenone after 3 min; succinate was added 30 s later, and the absorbance was recorded as previously, to assess the susceptibility of mitochondria to pore induction by calcium. To assess the reversal of pore opening by spermine, 5 mM spermine was added to incubated mitochondria immediately after adding CaCl_2. The setup was energized by succinate and the absorbance read. In the first experiment, a good mitochondrion will have a negligible change in absorbance. In the second experiment, calcium will cause a significant change in absorbance, showing the responsiveness of mitochondria to calcium as a pore inducer. In the third experiment, spermine will reverse the pore-inducing effect of calcium. Mitochondria that fulfill these conditions are considered intact, uncoupled, and, therefore, suitable for further use. Liver mitochondria isolated from the test groups under similar conditions were then subjected to mPT pore opening to determine the effects of the drugs. A representative profile of changes in absorbance of three separate replicates with similar kinetic trends of each sample was used.

2.6. Assay of mitochondrial ATPase activity Mitochondrial

Mitochondrial F_oF₁ ATPase activity was assessed using the previously described method [20]. In triplicate, sucrose (0.25 M), KCl (5 mM), and Tris-HCl (0.1 M) were dispensed into test tubes, and the entire volume was made up to 1 mL. Mitochondria from the baseline were added to its designated tubes to show that its enzyme (FoF1 ATPase) had not been previously activated. Adenosine triphosphate (0.01 M) was added to all the tubes, including the ‘ATP’ only tubes, except the mitochondria-only (from the normal control) tubes. This was done to show that the substrate had not undergone hydrolysis. Mitochondria (0.5 mg/mL protein) from the test groups were added to designated tubes. Uncoupler (25 mM 2,4-dinitrophenol) was added to the designated tubes, while sodium dodecyl sulfate (SDS) was added to the zero-time tubes. This was done to show that inorganic phosphate release is time-dependent. The tubes were thereafter transferred into the shaker water bath at 27 ⁰C and incubated for 30 min. Thereafter, to 1 mL of deproteinized supernatant taken from each test tube was added 1 mL of acidified 1.25 % ammonium molybdate (prepared in 6.5 % H₂SO₄) and 1 mL of 9 % freshly prepared ascorbate solution. After vortexing, the tubes were allowed to stand for 30 min. A standard potassium dihydrogen phosphate (1 mM) solution was similarly treated for a standard curve plot. The intensity of the blue colour was read at 660 nm.

2.7. Mitochondrial lipid peroxidation

Varshney and Kale [21], Adam-Vizi, and Seregi methods [22] were used to determine the extent of mitochondrial lipid peroxidation. Liver mitochondria (0.4 mL) were added to Tris-KCl (1.6 mL), and the protein was digested using 30 % TCA (0.5 mL). Thereafter, 0.75 % TBA (0.5 mL) was added, and the contents in the test tubes were heated at 80 ºC for 45 min, cooled to room temperature, and centrifuged at 3000 rpm for 10 min. The absorbance of the coloured supernatant was read at 532 nm in a spectrophotometer. The thiobarbituric acid reactive substances (TBARS) level was calculated using its extinction coefficient of 0.156 µM cm⁻¹.

2.8. Total RNA isolation

Total RNA was isolated from samples following a method described by Omotuyi et al. [23]. Liver tissues stored in trizol were homogenized in cold (4 °C) TRI reagent and the RNA isolated. The total RNA isolated was further partitioned in chloroform and centrifuged at 15,000 rpm for 15 min. Isopropanol was used to precipitate RNA from the clear supernatant. The RNA pellet was washed twice in 70 % ethanol and the pellets were air-dried for 5 min and later dissolved in RNA buffer.

2.9. cDNA conversion

Before cDNA conversion, Total RNA quantity and quality were determined using a spectrophotometer by using the absorbance ratio at 260 and 280 nm. The RNA thus obtained was made DNA-free by treating it with DNase I as specified by the kit manufacturer. Thereafter, a 2 µL solution containing 100 ng DNA-free RNA was converted to cDNA using an M-MuLV Reverse transcriptase Kit in 20 µl final volume. The reaction proceeded at room temperature. Reverse transcriptase was performed at 65 °Cfor 20 min.

2.10. PCR amplification and agarose gel electrophoresis

The PCR amplification for the determination of genes whose primers (Primer3 software) are listed below (Table 1.0) was done using the following protocol: The PCR amplification was performed in a total of 25 µl volume reaction mixture that contained 2 µl cDNA (10 ng), 2 µl primer (100 pmol) 12.5 µl Ready Mix Taq PCR master mix and 8.5 µl nuclease-free water. Initial denaturation at 95 °C for 5 min was followed by 20 cycles of amplification (denaturation at 95 °C for 30 s, annealing for 30 s, and extension at 72 °C for 60 s), and a final extension at 72 °C for 10 min was performed. Negative controls were included in all experiments where the reaction mixture had no cDNA. The amplicons were resolved on a 1.5 % agarose gel.

Table 1.

Primers used for the electron transport system, mitochondrial dynamics, and mitophagy.

S/N	Name	Forward Sequence	Reverse Sequence	References
1	Complex-I	GTACTCGCATCCTGGCGTTT	GGATGTGCTCAACAACCTGGA	[54]
2	Complex-II	AGA CAT CAG GTT TAC GGG GC	CTC TCG GTC CTT ACA GGT GC	[55]
3	Complex-III	TGCTTCTGCTGACGTACTGG	TATGGCGCACAAACAGAGGT	[56]
4	Complex-IV	CCT TGG ACG GCG GAA TG	TTC ACA ACA CTC CCA TGT GCT	[53]
5	Complex- V	GCCATTTTGTGCCAGTCGTC	CATTTTTGGAGACCAGTCCCG	-
6	OPA1	CTGCAGGTCCCAAATTGGTT	TCTTTGTCTGACACCTTCCTGT	[57]
7	Mitofusin−1	CCGGGGTGACCTTCGAGC	TCCAACACAAGGTTGACAAGA	[62]
8	Mitofusin−2	GGGAAGGTGAAGAAGCTTGG	CTTCACAGGTTGGGCATCGT	[62]
9	DRP1	CCAGAGGAACTGGTGTGGTC	CCATTCTTCTGCTTCAACTCCATT	[52]
s10	DNM1L	CCAGAGGAACTGGTGTGGTC	CCATTCTTCTGCTTCAACTCCATT	[58]
11	PGC −1α	AACCCCTTCCAACCAGTGTG	TCCGATTGGTCGCTACACC	[59]
12	Prohibin−1	GGTCAGAGTGAAAGCAGGTG	TCTGTGTCCAGCATCCACATT	-
13	Proinibin-II	ATCCGTGTTCACCGTGGAAG	GGGGATCCTGAAGTGAAGGC	-
14	PINK−1	GAGGAGCAGACTCCCAGTTC	TTTCTGCCATTATGCACCTGGAC	[60]
15	FUNDC1	ACCATAGACTTCCAACTCGGC	TCGCTTTCATAGTCTTGGGGA	[61]

2.11. Amplicon image processing

In-gel amplicon bands images captured on camera were processed on the Keynote platform, as previously reported [24] and quantified using image-J software.

2.12. Statistical analysis

Representative profile of changes in absorbance of mitochondria of similar kinetic readings repeated three times was used to measure mitochondrial permeability transition pore opening In-gel amplicon band images were transformed and quantified using image J. Graphs for these molecular studies were plotted as mean + /- SD using graph-pad prism (version 8.0).

3. Results

3.1. Antimalaria drugs open mitochondrial pore with associated membrane lipid peroxidation and, enhancement of F_oF₁ ATPase activity

Opening of mitochondrial membrane permeability transition (mPT) pore is a characteristic feature of malarial infection. One of the physiological inducers of this pore is Calcium. In this study, liver mitochondria isolated from the normal mouse in the absence of Calcium did not undergo significant decrease in absorbance. However, when Calcium was added, a significant amplitude swelling, characterized by large decreases in absorbance, was noticed. These changes were reversed when mitochondria were incubated with spermine in the presence of Calcium. This indicated that isolated mitochondria were intact, uncoupled, and suitable for further use. When similar mitochondrial proteins from animals infected with ANKA strain of P. berghei and subsequently treated with different antimalarial drugs were investigated, the treatment effects were noticed with varying pore opening effects. Although other antimalaria drugs (amodiaquine-artesunate, artemether -Lumefantrine, sulfadoxine-pyrimethamine) used in this study opened the mPT pore, artesunate maximally opened the mPT pore, Calcium and parasite infection opened the mPT pore by 4 and 6 folds. (Fig. 1A). Results represented in Fig. 2B show that antimalarial drugs used in this study uncouples mitochondria with a corresponding enhancement of mitochondrial FoF1 ATPase activity. Although there is no comparable significant difference in the effect of these drugs among themselves and with the standard uncoupler (2, 4-dinitrophenol), it is evident that the drugs used for the treatment of mouse malaria significantly (P < 0.01) enhanced ATPase activity compared with the normal control. There was no significant difference between the effects of these drugs on this enzyme compared with parasite infection. These drugs also increased the peroxidation of mitochondrial membrane lipids compared to the normal control. Maximum peroxidation of mitochondrial lipids was observed in the infected control (P < 0.01) compared to the normal control. It was also observed that sulfadoxine-pyrimethamine maximally caused peroxidation of mitochondrial lipids among all the drugs used in this study (Fig. 1C).

Fig. 1.

Representative profile of changes in absorbance of mitochondria (A); enhancement of mitochondrial F_oF₁ ATPase activity (B) and peroxidation of membrane lipids (c) isolated from mice infected with the chloroquine-resistant strain of Plasmodium berghei and treated with amodiaquine-artesunate, artemether -lumefantrine, sulfadoxine-pyrimethamine and artesunate NTA = Mitochondria without triggering agent; TA ₌ Mitochondria with triggering agent; AL = Artemether Lumefantrine; AA = Amodiaquine-artesunate; SP = sulfadoxine-pyrimethamine; ART = Artesunate.

Fig. 2.

Effects of selected antimalarial drugs on the expression of genes that code for mitochondrial complex I (A) II (B), III (C), IV (D) and V (E) in Plasmodium berghei infected mice NO= Normal Control (Baseline), NC= Negative (Infected) Control, AA= Amodiaquine-Artesunate, AL= Artemether-Lumefantrine, SP= Sulfadoxine-Pyrimethamine, ART= Artesunate. * = P < 0.05; ** = P < 0.01; *** = P < 0.001; **** = P < 0.0001 infected control vs treated groups.

3.2. Plasmodium infection affects oxidative phosphorylation and treatment with antimalarial drugs differentially modulate these effects

Generally, AL and ART were found to up-regulate the expression of complexes I, II, III, IV and V, AA down-regulated the expression of complex 1, and did not upregulate the expression of complex II, but up-regulated the expression of complexes III, IV and V. SP down-regulated the expression of complexes I-IV and up-regulated the expression of complex V gene coupled with a down-regulation in the expression of these genes in the malaria untreated control (NC). Specifically, the transport of electrons and protons from complex I was observed to be reduced in infected control. Further to this, treatment with Amodiaquine-Artesunate (AA) and Sulfadoxine-Pyrimethamine (SP) was found to down-regulate the expression of the gene that codes for this protein (P < 0.0001 in each case, relative to the infected control) as observed in Fig. 2A. Similar results were observed in complex II where Plasmodium infection was observed to down-regulate the expression of the gene that codes for this protein. Also, the effect of treatment of resistant mouse malaria with AA and SP was similar to what was observed in complex I. Although, Plasmodium infection down-regulated the expression of complex III, treatment of resistant mouse malaria with SP could not save the situation. However, treatment with AA, Artemether-Lumefantrine (AL) and Artesunate (ART) further up-regulated the expression of the gene that codes for this complex (Fig. 2C). Similar results were obtained in complex IV, which finally receives the electron and reduces oxygen to water (Fig. 2D). It was also observed that Plasmodium infection significantly down-regulated the expression of the gene that codes for the protein that translocates proton from the inter-membrane space to the matrix side as a coupled reaction with ATP synthesis. All these genes were found to be maximally up-regulated (Fig. 2E).

3.3. Some antimalaria drugs mediate mitochondrial biogenesis and functional integrity of mitochondria in addition to Plasmodium parasite clearance in the host

Host genes for restoring mitochondrial production, repair, and functionality were assessed. In Fig. 3A, the extent of expression of the gene that codes for the multipurpose Peroxisome proliferator-activated receptor gamma co-activator 1-alpha (PGC-1α) for mitochondrial biogenesis, dynamics, and mitophagy was determined. Plasmodium infection silenced the expression of this gene while SP significantly (P < 0.0001) upregulated its expression. However, prohibitin 1 was significantly (P < 0.0001) expressed in the infected control when compared to AA and AL. Both SP and ART significantly up-regulated prohibitin 1 compared with AA and AL (Fig. 3B). In Fig. 3C, prohibitin 2 was down-regulated in the negative (infected) control but was up-regulated by treatment with SP and ART.

Fig. 3.

Effects of selected antimalarial drugs on the expression of PGC-1 alpha (A), Prohibitin 1 (B) and 2 (C) in Plasmodium berghei infected mice NO= Normal Control (Baseline), NC= Negative (Infected) Control, AA= Amodiaquine-Artesunate, AL= Artemether-Lumefantrine, SP= Sulfadoxine-Pyrimethamine, ART= Artesunate. * = P < 0.05; ** = P < 0.01; *** = P < 0.001; **** = P < 0.0001 infected control vs treated groups.

3.4. Treatment of mouse malaria with some drugs initiates mitochondrial dynamics

In this study, Plasmodium infection initiated the down-regulation of the dynamin-like gene, a member of the dynamin superfamily of GTPases that code for mitochondrial fission protein. Treatment of mouse malaria with AA, AL, and SP significantly (P < 0.0001) increased the expression of DNM1L when compared with the negative (infected) control (Fig. 4A). Although, Plasmodium infection up-regulated the expression of DRP1, SP and ART significantly (P < 0.001) up-regulated the expression of DRP1 gene when compared with the negative control (Fig. 4B). Marker genes for mitochondrial fusion determined were Optic atrophy 1 (OPA 1), mitofusin 1 (Mifus 1), and mitofusin 2 (Mifus 2). Plasmodium infection up-regulates OPA 1, and SP and ART to the extent that there was no significant difference between the effect of infection and treatment with these two drugs (Fig. 4C). In addition to this, Plasmodium infection down-regulated mitofusin 1 and 2 while all the drugs significantly up-regulated mitofusin 1 (Fig. 4D). While determining the extent of expression of mitofusin 2, SP significantly up-regulated mitofusin 2 while other drugs caused the silencing of the mitofusin 2 gene (Fig. 4E).

Fig. 4.

Modulatory roles of Plasmodium infection and antimalaria drugs on mitochondrial dynamics both on mitochondrial fission via DNM1L (A), DRP 1 (B), and mitochondrial fusion by assaying for OPA 1 (C), mitofusin 1 (D) and mitofusin 2 (E). NO= Normal Control (Baseline), NC= Negative (Infected) Control, AA= Amodiaquine-Artesunate, AL= Artemether-Lumefantrine, SP= Sulfadoxine-Pyrimethamine, ART= Artesunate. * = P < 0.05; ** = P < 0.01; *** = P < 0.001; **** = P < 0.0001 infected control vs treated groups.

3.5. Some antimalaria drugs initiate mitophagy

Genes associated with mitophagy, such as the PTEN-induced putative kinase 1 (PINK 1) and FUN14 domain containing 1 (FUNDC1), were assayed to determine how badly damaged mitochondria are mopped up from the system and how fission, fusion, and mitophagy are regulated. From this result, it was observed that Plasmodium infection silenced the expression of PINK 1 and FUNDC1, whereas AA, AL, and ART significantly up-regulated PINK 1 (Fig. 5A). All the drugs up-regulated FUNDC1 in infected mice. While there was no significant difference between the effects of SP and ART on this gene when compared with the normal control, AA and AL could not enhance the expression of this gene as much as SP and ART (Fig. 5B).

Fig. 5.

Mitophagic influence of different antimalaria drugs and the role of Plasmodium infection using PINK 1 (A) and FUNDC1 genes. NO= Normal Control (Baseline), NC= Negative (Infected) Control, AA= Amodiaquine-Artesunate, AL= Artemether-Lumefantrine, SP= Sulfadoxine-Pyrimethamine, ART= Artesunate. * = P < 0.05; ** = P < 0.01; *** = P < 0.001; **** = P < 0.0001 infected control vs treated groups.

4. Discussion

This study pays close attention to the host mitochondrial status, especially in malaria treatment. Mitochondrial dynamics influences cellular homeostasis, signaling, and metabolism [25] . Therefore, this study provides information on mitochondrial fission, fusion autophagy, and oxidative phosphorylation in animal models where resistant malaria is treated with some orthodox antimalarial drugs.

In this study, we have shown that treatment of mice infected with chloroquine-resistant (ANKA) strain of P. berghei with Arthemeter-lumefantrine (AL), Amodiaquine (AA), and Sulfadoxine- pyrimethamine (SP) specifically caused mPT pore opening. We have previously provided information on the treatment of chloroquine-susceptible malaria in animal models with some orthodox drugs and that there is a large amplitude opening of the mPT pore in mice mitochondria infected with chloroquine susceptible strain of P. berghei treated with some of these drugs [3], [26]. We discovered that the extent of the opening of the host mitochondrial pore is parasite strain-dependent. Although different antimalarial drugs were used, the pore opening was more severe in susceptible malaria treated with antimalarial drugs than resistant ones (Fig. 1). It is likely that mitochondria isolated from infected mice treated with orthodox drugs respond differently to pore opening effects when compared with the ones isolated from mice infected with resistant strain and treated with orthodox drugs. Bissinger et al. [27] have previously linked eryptosis, a form of cell death, to the effectiveness of the drug in programming infected erythrocytes to death. It could be that these drugs have more antiplasmodial effects in treating malaria caused by the chloroquine-sensitive strain than the resistant one. The variability in responsiveness could be strain-dependent, as observed in this study; although there had been no previous study that compares the effect of different Plasmodium species on mPT and other mitochondrial dysfunction, there is variation in hemozoin content in P. chabaudi (AS) and P. berghei (NK65) [28]. This study observed that AL, AA, and SP enhanced mPT pore opening in vivo in chloroquine-resistant P. berghe-infected mice but not as much as ART as previously reported in the chloroquine-susceptible model [26]. Malaria and ischemia-reperfusion damage are two clinical diseases that have been related to irreversible mPT pore opening. Ischemia-reperfusion damage has an underlying etiology that involves mitochondrial dysfunction. In particular, ischemia injury increases the mPT pore's opening, which triggers several processes that result in necrotic or apoptotic cell death [29]. Something similar was observed in the enhancement of FoF1 ATPase activity and peroxidation of mitochondrial membrane phospholipids. It was observed that some of the antimalarial drugs used in this study enhanced ATPase activity, hydrolyzing ATP though at different rates. ATP hydrolysis with commensurate synthesis may not lead to bioenergetic stress in the host. However, in a situation where excessive ATP hydrolysis to ATP synthesis ratio is high, there may be an energy crisis, which may be classified as the secondary adverse effect of the drug [30]. Although malaria causes oxidative stress and peroxidation of membrane lipids, which is evident in the untreated host, some drugs may still cause peroxidation of membrane lipids. This is because the mechanism of action of some drugs is via the generation of reactive oxygen species, which may un-selectively lead to the destruction of both infected and uninfected erythrocytes and hepatocytes in the host [31]

A previous study has shown that in vitro, mitochondrial gene expression can be silenced by some chemical agents [32]. In this study, the comparative effects of the antimalarial drugs Amodiaquine-Artesunate (AA), Arthemter-lumefantrine (AL), Sulfadoxine-pyrimethamine (SP), and Artesunate (ART) on the expression of mitochondrial complexes I-V in Plasmodium berghei infected mice were investigated. The outcome of the experiment showed that the expressions of mitochondrial complexes I-V were upregulated in the groups administered with AL and ART. A significant down-regulation in the relative mRNA expression of these complexes was noticed in the group that received AA, SP and the malaria untreated group. The increase in the expression of mitochondrial complexes in the AL and ART treatment groups suggests that the process of oxidative phosphorylation was not suppressed, thereby making ATP available for the proper functioning of the host cell.

The observation that AA and SP silenced the expression of mitochondrial complexes, similar to the effect of pioglitazone, may directly affect the mitochondrial ATP output [33]. Silencing the genes that are involved in oxidative phosphorylation may lead to an energy crisis in the host, especially when this process is coupled with ATP hydrolysis. Because complex I is involved in the production of superoxide anions, inactivation of this complex may lead to a distortion in its iron-sulphur centers, thus supporting the free radical theory of aging [34]. Inactivation of complex II is found lethal in the nematode and sensitivity of the organism to oxidative stress [35]. Silencing the gene that codes for complex III actually causes the reprogramming of the ATP synthetic pathway through oxidative phosphorylation. This is because it is the meeting point for the transfer of reducing equivalents from complexes I and II. In addition to defective ATP synthesis, there are different ways by which silencing of this gene can take place; including the prevention of the assembly of different subunits of the enzyme. Decreased activity of complexes I and III may further lead to neurological diseases [36]. Complex IV is a large protein with 14 subunits. In addition to a crisis in energy metabolism, a defect in the expression of the gene that codes for this protein can cause encephalocardiomyopathy [37].

The ATP synthetic capacity of mitochondria is adequately regulated to cope with the dynamic requirement of the cell, and the PGC-1α gene is one of the numerous macromolecules required for this purpose. The observation that PGC-1α was downregulated in the infected control and AA-treated groups correlates with the downregulation of some genes that control the synthesis of mitochondrial complexes, showing that, indeed, PGC-1α is involved in ATP synthesis. A previous study has shown that this is possible because PGC-1α may serve as a transcriptional co-activator of both nuclear and non-nuclear receptor transcription factors that are critically involved in cellular energy metabolism [38]. The levels of specific lipids are increased in the liver during malaria [39]. To prevent steatosis and enhance lipid metabolism, treatment of malaria with SP and ART could alleviate derangement in lipid metabolism via mitochondrial biogenesis, mediated by PGC-1α. Prohibitins (PHBs) are ubiquitous in nature but are mostly found in the mitochondria. They stabilize mitochondrial membrane structure and regulate mitochondrial dynamics, biogenesis, and mitophagy processes. In this study, expression of PHB1 was found to decrease in P. berghei-infected mice treated with AA and AL but increased in the baseline, SP, and ART-treated mice and, surprisingly, in the infected control (Fig. 3B). This shows that treatment of malaria with these drugs will mediate angiogenesis for liver tissue regeneration, as previously observed in a study [40]. An increase in angiogenesis in the infected control could be attributed to natural adaptation, especially in the liver, for tissue regeneration. Defects in cristae have been traced to the silencing of PHB2, which remodels the cristae and thus leads to apoptosis [41]. This may be responsible for a significant amplitude swelling in mitochondria isolated in infected control and infected mice treated with AA.

Mitochondrial dynamics regulates mitochondrial copy number, repair, and removal of damaged ones depending on the extent of the insults. AL and SP initiate mitochondrial fission through the up-regulation of DNM1L and DRP1. It could be that these drugs enhance the upregulation of the required genes. This procedure is essential for growing and dividing cells to increase their mitochondria number [42]. There is a loss of appetite and decreased dietary intake of nutrients by the host during malaria infection, thus decreasing ATP output. In this case, cAMP level increased, activating protein kinase A (PKA). Activated PKA, in turn, phosphorylates DRP1, thus restricting the latter to the cytoplasm and making mitochondrial fusion inevitable. Further to this, mitochondrial fusion is stimulated by energy demand and stress [43]. In this study, it was observed that OPA1 upregulation occurs more readily than mitofusins1 and 2. This indicates that OPA1 upregulation is more critical in mitochondrial fusion, and the fusion of outer and inner mitochondria may not occur simultaneously for fusion to take place; it may be a sequential event [44].

Here, we investigated the effects of these antimalarial drugs on PINK1 and FUNDC1. PINK 1 protects cells against oxidative stress-induced apoptosis. It could be that extensive cell death that occurs in mouse infected but not treated could result from oxidative stress because Plasmodium infection is associated with oxidative stress [45] and a decrease in the expression of the PINK1 gene [46]. As observed in this study, an increase in mitochondrial respiration that could abrogate bio-energetic stress could have been caused by increased PINK1 gene expression because PINK1 associates with mitochondrial complexes to facilitate their function [47]. It is interesting, therefore, to note that an increase in the up-regulation of complexes I to V genes in the basal control and ART corroborates the up-regulation of PINK1 in the basal control and infected mice treated with ART (Fig. 2, Fig. 5). FUNDC1 is mainly involved in hypoxia-driven mitophagy. Therefore, a decrease in the expression of this gene means that mitophagy occurs less in Plasmodium infection. Still, mitochondrial outer membrane permeabilization, mitochondrial permeability transition pore, and several other cell death pathways are essential ways by which damaged mitochondria are removed from the system. An increase in the expression of FUNDC1 in infected mice treated with SP and ART, in a way, shows that more mitochondria are rescued, and those damaged beyond repair are removed from the system via the selective mitophagy pathway

4.1. Conclusion

This study has shown that the choice of drugs in the treatment of malaria is critical to the outcome of the disease and may have secondary effects on mitochondrial homeostasis. The maintenance of host mitochondrial dynamics is essential for the survival of the host, mitochondrial metabolism, and energy generation. It further shows that the choice of drugs can either mitigate the effects of the infection on mitochondria or worsen it. It also shows that more than parasite clearance, more functions are conferred on antimalarial agents so as to ensure that the post-infection stage depends essentially on the drug of choice, which could affect the outcome of the disease and the recovery period. It means that more attention should be paid to the result of malarial treatment rather than parasite clearance. It is very necessary to choose a drug that will clear the parasite and, at the same time, support profitable mitochondrial dynamics in the host.

Author statement

The authors appreciate the efforts of the reviewers and the Editors. We have looked at the comments, critically and have attended to all of them. We believe that your comments have increased the quality of this manuscript. Thank you.

CRediT authorship contribution statement

Steenkamp Paul Anton: Writing – review & editing, Investigation, Funding acquisition. Gerhard Prinsloo: Writing – review & editing, Supervision, Funding acquisition. Cecilia Opeyemi Babarinde: Visualization, Software, Resources, Project administration, Methodology, Investigation, Funding acquisition. Oluwakemi Marvellous Oloke: Resources, Project administration, Methodology, Investigation, Conceptualization. Oluseye Osovehe Yahaya: Visualization, Validation, Software, Resources, Conceptualization. olanlokun oludele John: Writing – review & editing, Writing – original draft, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Handling Editor: Sutharani Thankavel

Data availability

The data that has been used is confidential.