Skip to main content
Tree Physiology logoLink to Tree Physiology
. 2025 Aug 11;45(13):100–113. doi: 10.1093/treephys/tpaf099

Unraveling nitrogen uptake and metabolism: gene families, expression dynamics and functional insights in aspen (Populus tremula)

Yupeng Zhang 1, Shruti Choudhary 2, Anna Renström 3, Mikko Luomaranta 4, Maxime Chantreau 5, Verena Fleig 6, Ioana Gaboreanu 7, Carolin Grones 8,9, Ove Nilsson 10, Kathryn M Robinson 11, Hannele Tuominen 12,
Editor: Gary Coleman
PMCID: PMC12666385  PMID: 40795931

Abstract

The influence of nitrogen on wood formation is well established. To gain insight into the underlying molecular mechanism, we first identified genes in 14 gene families that are involved in nitrogen uptake and metabolism in European aspen (Populus tremula L.) genome annotation. Gene expression data from a de novo RNA sequencing (RNA-seq) analysis and data available from the AspWood database (plantgenie.org) provided putative candidate genes for the uptake of nitrate, ammonium and amino acids from the xylem sap as well as their further assimilation in the secondary xylem tissues of the stem. For a population-wide analysis of the nitrogen-related genes, we utilized RNA-seq data from the cambial region of the stems of 5-year-old aspen trees, representing 99 natural aspen accessions, and compared the expression of the nitrogen-related genes to stem diameter. Novel regulatory interactions were identified in expression quantitative loci and co-expression network analyses in these data. The expression of certain nitrate and amino acid transporters correlated negatively with stem diameter, suggesting that excessive nitrogen retrieval from the xylem sap suppresses radial growth of the stem. The expression of a glutamine synthetase correlated with the expression of these transporters, a link further supported by increased plant growth in transgenic glutamine synthetase overexpressing trees. This study provides insight into the genetic basis of nitrogen uptake and assimilation and its connection to wood formation, providing interesting targets for improving nitrogen-use efficiency and growth of aspen trees.

Keywords: genetic variation, nitrogen assimilation, nitrogen reallocation, wood development

Introduction

Nitrogen is an essential macronutrient for plant growth and development, playing a critical role in a variety of physiological and biochemical processes, including photosynthesis, amino acid and protein synthesis, metabolic regulation, growth and biomass production. Nitrogen availability also influences wood formation, either directly or indirectly, in many ways (for a recent review, see Lu et al. 2024). In Populus trees, high nitrogen availability has been reported to increase vessel and fiber lumen area and to reduce secondary cell wall thickness, lignin content and wood density (Luo et al. 2005, Pitre et al. 2007, Novaes et al. 2009, Cao et al. 2024, Renström et al. 2024).

Nitrogen-use efficiency, which refers to the ability of a plant to acquire and utilize nitrogen to maximize growth and yield, is a key aspect of modern agriculture and forestry (Congreves et al. 2021, Q.Liu et al. 2022). Increased understanding of the molecular mechanisms that underpin nitrogen uptake, transport and metabolism can provide candidate genes to increase nitrogen-use efficiency of plants and to improve sustainability and minimize environmental impacts caused by excessive use of nitrogen fertilizers (Cánovas et al. 2018, Stevens 2019, Waqas et al. 2023). While significant progress has been made in studying nitrogen-related pathways in model plants like Arabidopsis thaliana (Arabidopsis), there is still much to learn about how these mechanisms operate in long-lived woody species. Recent advances in genomics and transcriptomics have enabled investigation of the genes and pathways involved in nitrogen metabolism in various plant species, including woody species. In black cottonwood (P. trichocarpa), nitrogen-related gene families, such as amino acid permeases (AAPs), nitrate transporters (NRTs), nitrite reductases (NIRs) and NIN-like proteins (NLPs) have been identified (Couturier et al. 2010, Bai et al. 2013, Léran et al. 2014, von Wittgenstein et al. 2014, Wu et al. 2015, Xu et al. 2017, Du et al. 2022, Han et al. 2022, Cao et al. 2023, Yu et al. 2023, Li et al. 2024, Guan et al. 2025). These gene families often exhibit substantial variation in gene number, structure and function across plant species, reflecting evolutionary pressures and ecological adaptations. However, the extent of this variation remains poorly characterized in other Populus species.

In this study, we investigated nitrogen-related gene families in European aspen (aspen, Populus tremula), which is the only native Populus species in Sweden and extensively used as a deciduous tree model for population genetics and molecular studies (Escamez et al. 2023, Luomaranta et al. 2024, Robinson et al. 2024). We identified the members of the following gene families: amino acid transporters (AAT), ammonium transporters (AMT), asparagine synthetases (ASN), asparaginases (ASPG), alanine aminotransferases (AlaAT), aspartate aminotransferases (AspAT), cationic amino acid transporters (CAT), glutamate dehydrogenases (GDH), glutamate synthases, glutamine synthetases (GS), NIR, nitrate reductases (NR), NLP and NRT in aspen, and constructed phylogenetic trees including genes from aspen and Arabidopsis. We also revealed tissue specific expression patterns and specific responses to nitrate vs ammonium in developing xylem tissues of hybrid aspen trees. Additionally, expression quantitative trait loci (eQTL) mapping and gene co-expression networks highlighted links between nitrogen metabolism and radial growth of the stem.

Materials and methods

Gene family identification in aspen

Arabidopsis thaliana (Arabidopsis) genes from 14 gene families encoding AAT, AMT, ASN, ASPG, AlaAT, AspAT, CAT, GDH, glutamate synthases (GOGAT), GS, NIR, NR, NIN-like transcription factors (NLP) and NRT were extracted from The Arabidopsis Information Resource (TAIR; https://www.arabidopsis.org). These sequences were utilized as queries for a BLASTP search against the Populus tremula v2.2 genome annotation on plantgenie.org by using default settings (Sundell et al. 2015, Robinson et al. 2024). As a second step, the nitrogen-related genes from Arabidopsis were analyzed for conserved functional motifs searching the Pfam database via the HMMER v3.4 tool (hmmscan, Potter et al. 2018). The identified motifs served as seed motifs for HMMER (hmmsearch, Potter et al. 2018) against the annotated peptide sequences in Populus tremula v2.2, resulting in an initial gene list. Genes from the first BLASTP output that, on the basis of the second screening, lacked the conserved functional motifs were excluded from the final list of nitrogen-related genes in aspen. The aspen genes were named after Arabidopsis genes with the highest sequence similarity according to BLASTP.

Phylogenetic tree construction and the analyses of the gene structures and conserved domains

The peptide sequences of identified genes were aligned using default settings of MAFFT v7.526 (Katoh and Standley 2013). The aligned sequences were trimmed by trimal v 1.5.rev0 with default settings (Capella-Gutiérrez et al. 2009). The aligned sequences were then employed to construct a maximum likelihood phylogenetic tree with 1000 bootstrap replicates using IQ-TREE2 v2.3.6 (Minh et al. 2020). The resulting phylogenetic trees were visualized with MEGA11 (Tamura et al. 2021). The identified motifs from hmmerscan and the structure of the genes were visualized by TBTOOL2 (Chen et al. 2023).

Gene expression in the AspWood database

The Aspen Wood (AspWood) resource of high-resolution gene expression data from the developing wood of aspen trees (Sundell et al. 2017) were downloaded from PlantGenIE (https://plantgenie.org, Sundell et al. 2015). The expression data were presented as log2(TPM + 1) values and visualized as heatmap using ComplexHeatmap v2.20.0 (Sundell et al. 2017, Gu 2022).

RNA-sequencing of ammonium treated hybrid aspen trees

The experiment is described in full in Renström et al. (2024). Briefly, hybrid aspen (P. tremula L. × P. tremuloides Michx, clone ‘T89’) trees were cultivated in greenhouse conditions for 10 weeks under controlled nutrient additions. Trees were fertilized with ammonium-based nutrient solution at three different addition levels: limited, sub-optimal and optimal, corresponding to total nitrogen amounts of 0.16, 0.56 and 1.06 g, respectively. At the end of the experiment, 10-cm-long stem pieces were collected from the base of the plant and immediately frozen in liquid nitrogen. The developing xylem part of the stem piece was then scraped off and homogenized using a mortar and pestle in liquid nitrogen. RNA was extracted from the homogenized material using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich Co. LLC). RNA was quantified with a Nanodrop 1000 Spectrophotometer (Thermo Scientific), and the quality was assessed with an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Following sequencing library generation and paired-end (2 × 150 bp) sequencing using Illumina NovaSeq 6000, the raw reads were pre-processed to remove sequencing adapters using Trimmomatic (v0.39). The trimmed read pairs were quantified with Salmon (v1.9) using the transcriptome index based on aspen genome annotation (Robinson et al. 2024). For exploratory analysis, including sample clustering and principle component analysis (PCA) visualization, we applied variance stabilizing transformation (VST) to the normalized counts using DESeq2’s vst() function. Formal differential expression testing was subsequently performed on raw counts using DESeq2 (v1.46.0 in R 4.4.2), which internally handles count normalization via median-of-ratios scaling (Love et al. 2014). Statistical significance between the RNA-Seq results for the ammonium-treated (analyzed here) and nitrate-treated trees (published in Renström et al. 2024) was tested using Tukey’s Honestly Significant Difference (HSD) post-hoc tests on the normalized expression values. The cld() function (multcompView v0.1–10) generated the compact letter display, indicating significant differences (adjusted P < 0.01) between all treatment combinations (3 concentrations × 2 nitrogen treatments).

Expression quantitative trait loci analysis in the Swedish aspen collection

The eQTL data for the Swedish aspen (SwAsp) trees were retrieved from Luomaranta et al. (2024). Briefly, the eQTL analysis was based on RNA-seq analysis of developing xylem tissue collected from 5-year-old stems, representing 99 SwAsp genotypes. The eQTL analysis was based on 6,806,717 bi-allelic SNPs (Robinson et al. 2024). Mean normalized gene expression values were used for each genotype. The false discovery rate threshold of 0.05 was applied to exclude non-significant eQTLs. eQTLs were categorized as local (within 1 Mbp) or distant.

The subnetwork of nitrogen-related genes

The whole-transcriptome co-expression network from Luomaranta et al. (2024) was used to extract a sub-network of nitrogen-related genes using Cytoscape v3.10.2 (Shannon et al. 2003). The sub-network was clustered by using INFOMAP (v.1.8.0; Rosvall and Bergstrom 2008). Stem diameter of the 99 different SwAsp genotypes (Luomaranta et al. 2024) was added as a node in the sub-network. Correlation of stem diameter to each gene in the sub-network was then represented according to the calculated Spearman rank correlation (R > 0.3) with only edges.

Overexpression of the Populus glutamine synthetase GLN1.2a and the growth of the transgenic lines

A DNA fragment corresponding to the coding sequence of Populus tremula PotraGLN1.2a (Potra2n12c24087), flanked by the Gateway attL1 and attL2 cloning sequences, was synthesized and inserted into pUC57 by the GenScript company. The resulting vector was recombined in an LR reaction with the destination vector pK2GW7. The destination vector, directing the expression of PotraGLN1.2a under the control of the 35S promoter, was transformed into hybrid aspen (Populus tremula × P. tremuloides), as described in Nilsson et al. (1992).

The transgenic trees were grown in an automated phenotyping platform (WIWAM Conveyor, Eeklo, Belgium) for 7.5 weeks under long-day conditions (18 h/6 h day/night) with 160–230 μmol m−2 s−1 light intensity from white light (FL300 LED Sunlight v1.1) and far red light (FL100 LED custom-made, 725–735 nm) lamps (Senmatic A/S, Søndersø, Denmark), 22 °C/18 °C temperature regime, and 60% relative humidity, as described in Wang et al. (2022). The expression of the transgene was analyzed in in vitro material (whole shoots) from tissue culture by quantitative reverse transcription polymerase chain reaction (qPCR). Briefly, 1 μg RNA of at least three biological replicates was taken for cDNA synthesis using the iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Primers were designed using the Primer3 web server (v.4.1.0; Untergasser et al. 2012). Forward and reverse sequences, for the PotraGLN1.2a (Potra2n12c24087) were GTCTGACTGGTCGCCATGAA and AGCTTTCTCTGTGTCCCTGC, respectively, with ubiquitin (Potra2n1c3635; 5′-AGATGTGCTGTTCATGTTGTCC-3′, 5′-ACAGCCACTCCAAACAGTACC-3′) as a reference. qPCR was performed in 10 μL reaction volume, comprising of 1 μL of 5× diluted cDNA, 1× PowerTrack™ SYBR Green Master Mix (Thermo Fisher Scientific), 100–200 nmol each of forward and reverse primer. All reactions were performed in 96-well plates on a C1000Touch™ Thermal Cycler (Bio-Rad) with an initial denaturation at 95 °C for 3 min, followed by 40 cycles, each of denaturation at 95 °C for 10s, and annealing at 60 °C for 10 s. The Cq values were acquired from the CFX96™ Maestro software (Bio-Rad) and average dCq shown for each sample were calculated relative to ubiquitin.

Results

Identification, phylogeny and expression analysis of nitrogen uptake and metabolism related gene families in aspen

In order to facilitate molecular analyses underlying nitrogen-mediated responses in wood formation, we first identified the aspen members of 14 gene families related to nitrogen uptake and metabolism (Figure 1, Table S1 available as Supplementary Data at Tree Physiology Online). Phylogenetic trees containing aspen and Arabidopsis were constructed to provide insight into the evolutionary relationship (Figure 1). In addition, the overall gene structure was analyzed for all genes (Figure 2).

Figure 1.

Figure 1

Identification of nitrogen uptake and metabolism-related genes in aspen (P. tremula). Phylogenetic trees include genes encoding members of the nitrate transporter families, NIN-like transcription factors, AAT, AMT, glutamate synthases, glutamine synthetases, NIR and NR in aspen and Arabidopsis. The peptide sequences of genes in corresponding gene families were aligned by MAFFT. The maximum likelihood tree with 1000 bootstraps was constructed by IQTREE2 and visualized by MEGA11.

Figure 2.

Figure 2

Gene structure and conserved protein motifs of nitrogen uptake and metabolism-related gene families in aspen. Distribution and the relative genomic positions of conserved motifs, identified by hmmscan, are shown for nitrate transporter (A, B, C), NIN-like protein (D), amino acid transporter (E), ammonium transporter (F), nitrite reductase (G), nitrate reductase (H), glutamine synthetase (I) and glutamate synthase (J) gene families. Exons are shown as yellow boxes, introns as black lines and untranslated regions as green boxes. Gene lengths are indicated at the x axis relative to the transcription start site (0 bp).

We also used the publicly available AspWood dataset to extract information of gene expression in the woody tissues of aspen for the nitrogen-related genes identified in this study. AspWood is a high-resolution gene expression database in the woody tissues of aspen stems (Sundell et al. 2017), including data from the phloem/cambium region, and the different phases of xylem expansion, xylem maturation and xylem cell death (plantgenie.org; Sundell et al. 2015). Several members of the nitrogen-related gene families were according to the AspWood database expressed in a biphasic manner in aspen, with a first peak in the phloem/cambium and a second peak in the phase of xylem cell death (Figure 3). The expression in the phloem/cambium is likely related to the transport and sensing of nitrogen that is being transported in the phloem, while the expression in the phase of cell death is most likely related to the transport and sensing of nitrogen compounds that have been taken up from the xylem sap to ray parenchyma (van Bel 1984, Tegeder 2014, Cánovas et al. 2018).

Figure 3.

Figure 3

The expression of the nitrogen uptake and metabolism-related genes in aspen. The heatmap represents log(TPM + 1) values for the different genes in the AspWood database (plantgenie.org). Horizonal axis indicates the identity of the samples (in the AspWood tree 1) and the different zones of the cambial region (the phloem, the phase of xylem expansion, the phase of secondary cell wall formation and cell death) in aspen stem. The cambium (˃85% of the cell population) is in samples 3–6 and the expanding xylem (>85% of the cells) is in samples 7–11. According to Sundell et al. (2017), the vessels die and autolyze around the sample number 18 while the fibers are dead only in the last sample where the only living cells are the rays in tree 1 of the AspWood database. The colors indicate relative expression levels according to the scale on the right.

NIN-like proteins

The NIN-like transcription factors (NLPs) initiate nitrate signaling and coordinate gene expression related to nitrate transport and metabolism, and plant development (Vidal et al. 2020). Arabidopsis has nine NLP genes, and the AtNLP7 has been shown to both directly bind nitrate and act as a transcription factor (K.H.Liu et al. 2022). We identified 12 NLP genes in aspen (Figures 1 and 2, Table S1A available as Supplementary Data at Tree Physiology Online), most of them having the biphasic expression pattern in woody tissues (Figure 3). The aspen PotraNLP7a, homologous to the Arabidopsis AtNLP7, was expressed in phloem/cambial tissues and during xylem expansion. The highest expressed gene was PotraNLP8b, which has the highest sequence similarity to the Arabidopsis AtNLP8 and AtNLP9 (Figure 1).

Nitrate transporters

Nitrate transporters are vital for the uptake and partitioning of nitrate in plants. They can be found in several different families, including the Nitrate transporter 1/Peptide transporter Family (NRT1/NPF) (Léran et al. 2014), the Nitrate Transporter 2 (NRT2) (von Wittgenstein et al. 2014) and Nitrate Transporter 3 (NRT3) (Wang et al. 2018) families. The NRT1/NPF family members are typically so-called low-affinity transporters (Corratgé-Faillie and Lacombe 2017) that are active at nitrate concentrations exceeding 250 μM, while members of the NRT2 family seem to represent high-affinity transporters that are generally active at nitrate concentrations in the range of 10–250 μM (Xu et al. 2024). The first described nitrate transporter, the Arabidopsis AtNRT1.1 (also called CHL1 or NPF6.3), is an exception in that it can operate as a dual affinity transporter (Liu et al. 1999). NRT3 is necessary for NRT2 stability and targeting to the plasma membrane (Wang et al. 2018).

The NRT1/NPF gene family was one of the largest families in aspen. We found 57 aspen genes corresponding to the 53 Arabidopsis genes (Figures 1 and 2, Table S1B available as Supplementary Data at Tree Physiology Online). The aspen NRT2 gene family contained six aspen genes corresponding to the seven genes in Arabidopsis while the NRT3 family had three aspen genes corresponding to the two Arabidopsis genes (Figures 1 and 2, Table S1B available as Supplementary Data at Tree Physiology Online).

A large proportion of the genes in the aspen nitrate transporter gene families were expressed in the woody tissues (Figure 3). Several of them showed the biphasic expression pattern (Figure 3). Examples of such genes included PotraNPF4.4c and PotraNPF7.3a, homologs of which are well characterized in Arabidopsis, as well as PotraNPF5.4a, PotraNPF5.4b and PotraNPF5.6b, which have not been functionally characterized as nitrate transporters in Arabidopsis. PotraNRT1.1/NPF6.3 had a distinct expression pattern within the family: its expression was not biphasic but peaked in the zone of xylem cell expansion (Figure 3). The two aspen homologs of the high-affinity AtNRT2.1 both had very low expression in the woody tissues (Figure 3).

Ammonium transporters

AMTs mediate the uptake of ammonium from the soil, but also ammonium transport from root to shoot and within leaves, and ammonium acquisition into other organs (Hao et al. 2020). The AMT genes in Arabidopsis are divided in two phylogenetic groups; one containing five genes (AtAMT1;1AtAMT1;5) and the other one containing the single AtAMT2;1. Both AMT1 and AMT2 show high affinity to ammonium (Yuan et al. 2007).

The AMT gene family showed clear clustering into two main clades (Figure 1, Table S1C available as Supplementary Data at Tree Physiology Online). The clade corresponding to Arabidopsis AtAMT1;1–1;5 contained five aspen genes. PotraAMT1.1 showed a strong, biphasic expression in the woody tissues (Figure 3). The second clade, containing the Arabidopsis AtAMT2;1, has undergone copy number expansion with 11 aspen genes (Figure 1, Table S1C available as Supplementary Data at Tree Physiology Online). Several of the aspen AMT2 clade members were expressed at a low level primarily in the cell death zone except for PotraAMT2.8 that had a constant, low expression in the woody tissues (Figure 3).

Amino acid transporters

Transport of amino acids and other nitrogenous compounds in plants is primarily mediated by two major superfamilies: the amino acid-polyamine-organocation (APC) superfamily and the amino acid/auxin permease (AAAP) superfamily (Pratelli and Pilot 2014). We focused on four functionally characterized subfamilies within these superfamilies: the AAP and the lysine/histidine transporters (LHT) from the AAAP superfamily, and the proline transporters (ProT) and the aromatic and neutral amino acid transporters (ANT) from the APC superfamily (Tegeder and Hammes 2018, Yang et al. 2020). Aspen contained 15 AAP, 9 LHT, 2 ProT and 4 ANT family members (Figures 1 and 2, Table S1D available as Supplementary Data at Tree Physiology Online). They were expressed primarily in the phloem/cambium (PotraANT1, PotraAAP3.2, PotraAAP3.3, PotraAAP6.1, PotraAAP7.3b), the expansion zone (PotraPROT1b), secondary cell wall formation (PotraAAP7.2, PotraAAP7.3a) and the cell death zone (PotraProT1a, PotraAAP7.1b) (Figure 3).

Nitrogen assimilation and metabolism

Nitrate is reduced to nitrite by the cytoplasmic enzyme nitrate reductase (NR). Two NR genes, clustering together with the Arabidopsis AtNR1 (also known as NIA1) and AtNR2 (also known as NIA2), were annotated in the aspen genome (Figures 1 and 2, Table S1F available as Supplementary Data at Tree Physiology Online). PotraNR2a and PotraNR2b had a low expression in the woody tissues (Figure 3).

Nitrite is subsequently imported into plastids, where nitrite reductase (NIR) reduces it to ammonium. One aspen homolog was found for the Arabidopsis nitrite reductase AtNIR1 while two homologs were found for a sulfite reductase (AtSIR, AT5G04590) which both contained a Nitrite/Sulfite reductase ferredoxin-like domain (Figures 1 and 2, Table S1E available as Supplementary Data at Tree Physiology Online). PotraNIR1 had a low, biphasic expression in the phloem/cambium and cell death zone while PotraSIR1a and PotraSIR1b had a broader and higher expression, including expression in the xylem expansion zone (Figure 3).

Ammonium is assimilated in both the cytosol and plastids to produce amino acids in a set of interconnected reactions. In the cytosol, ammonium can react with glutamate to produce glutamine by the cytosolic glutamine synthetase (GS) or asparagine by asparagine synthetase (ASN). In the plastids, a plastidic GS catalyses conversion of ammonium to glutamine, which can be then converted to glutamate by glutamate synthase (GOGAT) in the so-called GS/GOGAT cycle. Asparaginase (ASPG), alanine aminotransferase (AlaAT), aspartate aminotransferase (AspAT) and glutamate dehydrogenase (GDH) are additional enzymes involved in nitrogen assimilation.

In the aspen genome, we identified eight glutamine synthetase, four glutamate synthase, three asparagine synthetase, four glutamate dehydrogenase, three asparaginase, two alanine aminotransferase and nine aspartate aminotransferase genes (Figures 1 and 2, Table S1G–N available as Supplementary Data at Tree Physiology Online). Each of these gene families had at least one gene that was highly expressed in the woody tissues (Figure 3). A few members of both the glutamate synthase (PotraGLT1b) and the glutamine synthetase (PotraGLN1.2a and PotraGLN1.2b) families had a constant, high expression throughout wood development (Figure 3).

The expression of the nitrogen uptake and metabolism-related genes under NH₄+ and NO₃ treatment

Populus species can take up nitrogen in the forms of both ammonium (NH₄+) and nitrate (NO₃), but the site of assimilation and hence the transported form of nitrogen in the stem varies depending on the genotype and the environmental conditions (Black et al. 2002). In this study, we aimed to shed light on nitrate assimilation and subsequent nitrogen metabolism by exploring the effect of both NH₄+ and NO₃ on the expression of the nitrogen-related genes in developing xylem tissues of wood. For this purpose, we utilized material and data from our earlier study (Renström et al. 2024) where hybrid aspen trees were grown for 2 months in three different levels (suboptimal, low and optimal) of either NH₄+ or NO₃. The nitrogen levels were defined in Renström et al. (2024) on the basis of known amounts of total nitrogen present in trees reaching maximal growth rates. The RNA-seq data in the nitrate-fertilized trees were retrieved from Renström et al. (2024) while the RNA-seq experiments in the ammonium-fertilized trees were performed in this study (see Table S2 available as Supplementary Data at Tree Physiology Online).

Almost all members of the nitrate transporter gene families were expressed in at least one of the experimental conditions (Figure 4). Half of them were expressed at a higher level when plants were fertilized with nitrate compared with ammonium (see Figure S1 available as Supplementary Data at Tree Physiology Online) even though statistically significant differences were present only for a few of them, including PotraNRT1.1/NPF6.3, PotraNRT2.5c and PotraNRT2.1b (Figure 4). Also nitrate and nitrite reductases as well as the two homologs of the AtNLP7 nitrate sensors (PotraNLP7a and PotraNLP7b) were significantly more expressed in response to nitrate than ammonium (Figure 4). The AMT family members were rather equally expressed even though tendencies toward higher expression of a few of them were observed in response to fertilization with nitrate (Figure 4). The amino acid transporter families contained specifically responding genes but also genes that responded similarly to both nitrogen sources (Figure 4).

Figure 4.

Figure 4

The expression of the members of aspen gene families related to nitrogen uptake, sensing and assimilation in response to fertilization with either nitrate or ammonium. The heatmaps represent VST normalized gene expression data from RNA-sequencing of developing xylem tissues of hybrid aspen after long-term treatment with optimal, sub-optimal and limited doses of ammonia (NH4+, this study) and nitrate (NO3, reported earlier in Renström et al. 2024). Different letters indicate statistically significant differences using two-way ANOVA model and Tukey’s HSD test with adjusted P-value < 0.01. The number of the trees in each condition is three or four.

Expression quantitative trait loci analysis of nitrogen-related gene expression in the Swedish aspen collection

Members of the NLP gene family are interesting since they function in sensing of nitrate but also as transcription factors. We were interested in the regulatory aspects of this gene family, and utilized eQTL data from a population of aspen trees (the SwAsp collection) to investigate variation in the expression and regulation of the NLP genes in woody tissues (Luomaranta et al. 2024). The eQTLs were classified either as local or distant using 1 Mbp as a threshold (Luomaranta et al. 2024). The different members of the NLP gene family contained 333 local eQTLs and 336 distant eQTLs, corresponding to association with 28 and 179 genes, respectively (see Table S3 available as Supplementary Data at Tree Physiology Online). The SNPs in PotraNLP2e showed association with the expression of 34 different genes, including homologs of Arabidopsis GA 20-oxidase and UMAMIT34 as distant eQTLs and PotraGLU1b as a local eQTL (see Table S3 available as Supplementary Data at Tree Physiology Online). Distant eQTLs for PotraNLP7a and PotraNLP7b were found in association with the expression of 12 and 13 genes, respectively, several of them having predicted functions in signaling and transcriptional regulation (see Table S3 available as Supplementary Data at Tree Physiology Online).

To broaden the scope of the expression analysis, we retrieved co-expression data for the nitrogen-related genes from a whole-transcriptome co-expression analysis in woody tissues of young aspen stems from Luomaranta et al. (2024), and constructed a subnetwork with these values together with the Pearson correlation values for the expression of these genes with the stem diameter of the same set of trees that were used for the RNA-Seq analysis.

A large proportion of the genes (91) were not co-expressed at all, a few genes were co-expressed with only one or two genes, and 54 genes were found in four clusters containing more than three co-expressed genes (Figure 5A). The largest cluster contained 26 genes, including the NPF family members PotraNPF5.4a, PotraNPF5.4b and PotraNPF5.6b that were also highly expressed in the woody tissues according to the AspWood database (Figure 3). This cluster also contained several AAP family members, such as PotraAAP2.2, PotraAAP3.2, PotraAAP6.1 and PotraANT1, and the NRT1/NPF family members PotraNPF5.6b and PotraNPF2.13, which all correlated negatively with stem diameter, and glutamine synthetases PotraGLN1.2a and PotraGLN1.2b (Figure 5A).

Figure 5.

Figure 5

Co-expression of the nitrogen uptake and metabolism-related aspen genes in stem tissues of a population of SwAsp trees. (A) A subnetwork was calculated by extracting the co-expression values for the aspen nitrogen-related genes from a whole-transcriptome network, published in Luomaranta et al. (2024), that was based on gene expression in developing xylem tissues of 5-year-old aspen trees representing 99 genotypes of the SwAsp population. Correlation between genes in the Seidr whole-transcriptome network are indicated by orange lines. The Spearman correlation values (R > 0.3) between the diameter data of the stems and gene expression were included as edges, indicated as blue lines in the figure. (B) Phenotypic characterization of glutamine synthetase PotraGLN1.2a overexpression lines in hybrid aspen. Data for stem diameter and height of the trees is shown for the wild type (T89) and three PotraGLN1.2a overexpression lines grown for 2 months in an automated phenotyping platform. (C) Photos of representative trees in each of the wild type (T89) and transgenic PotraGLN1.2a overexpressor lines at the end of the growth period. (D) The relative expression of PotraGLN1.2a in in vitro tissues of wild type (T89) and three transgenic PotraGLN1.2a overexpressing lines (L2, L3, L4). Different letters indicate statistically significant differences using two-way ANOVA model and Tukey’s HSD test with adjusted P-value < 0.01. The number of trees in each condition is three.

To gain more understanding on the significance of the co-expression patterns in the largest cluster, we analyzed the effect of PotraGLN1.2a overexpression on tree growth in greenhouse conditions. PotraGLN1.2a was selected due to its high expression in the secondary xylem tissues (Figure 3). Its expression is also specific to wood (plantgenie.org). Three hybrid aspen (Populus tremula × P. tremuloides) overexpression lines of PotraGLN1.2a were grown in controlled conditions. After 2 months of growth, the PotraGLN1.2a overexpression lines were significantly taller than the wild-type trees (Figure 5B and C). Positive influence of GS overexpression on the growth of Populus trees has also been reported in several earlier studies (Gallardo et al. 1999, Fu et al. 2003, Jing et al. 2004, Castro-Rodríguez et al. 2016). Altogether, these results suggest that while tree growth is positively influenced by the expression of glutamine synthetases, it is counteracted by the expression of AAP and NRT1/NPF family members in the secondary xylem tissues of the stem.

Discussion

Identification of nitrogen uptake and metabolism related gene families in aspen

Here, we performed identification and analysis of 14 nitrogen uptake and metabolism associated gene families in aspen. Even though the function of many of these genes is known in Arabidopsis, little is known about their role in woody tissues of trees. Our analyses did not always identify the best characterized members of the gene families as those that seemed most important in aspen stem based on gene expression. For instance, several NRT1/NPF genes, such as PotraNPF5.4a, PotraNPF5.4b and PotraNPF5.6b which were highly expressed in the woody tissues of aspen stem (Figure 3), have not been established as nitrate transporters in any other species. Their role in nitrate sensing or transport is supported by their co-expression in the population of the SwAsp trees (Figure 5A), and in particular their co-expression with PotraNPF4.4 which is a homolog of the Arabidopsis nitrate-binding protein AtNPF4.4/NRT1.13 (Chen et al. 2021). The protein sequences of PotraNPF5.4a, PotraNPF5.4b and PotraNPF5.6b also contain the proline residue that is required for nitrate transport activity (see Figure S2 available as Supplementary Data at Tree Physiology Online; Ho et al. 2009, Chen et al. 2021). We therefore propose involvement of these aspen NPF genes in nitrate uptake and/or sensing in secondary xylem tissues of the stem. Recently, a cassava homolog of PotraNPF5.4 was shown to be specifically expressed in the stem and decrease the efflux of nitrate in the root when overexpressed in rice, supporting the role of NPF5.4 in nitrate uptake from the xylem sap (Ji et al. 2024).

The highest expressed NLP gene in aspen wood was PotraNLP8b (Figure 3), which is most similar in sequence to Arabidopsis AtNLP8 and AtNLP9. AtNLP8 and AtNLP9 are not very well characterized in Arabidopsis (Konishi et al. 2021). AtNLP8 gene has been reported to be expressed in imbibed seeds and to promote seed germination (Yan et al. 2016). AtNLP9 is expressed, similar to PotraNLP8, in the seeds, but also in procambium of the root (Brady et al. 2007). Two Populus NLP8 homologs were recently mapped to QTL loci associated with tree biomass related traits in P. deltoides × P. simonii F1 population although their direct involvement was not demonstrated (Du et al. 2023). Taken together, the homologs of AtNLP8 and AtNLP9 genes seem to have pivotal roles in nitrate signaling of woody tissues in Populus trees.

Nitrogen uptake and assimilation in the developing xylem tissues of Populus stems

Populus trees, such as aspen, are known to be able to utilize both nitrate (NO3) and ammonium (NH4+) even though nitrate is the predominant source of nitrogen (Rennenberg et al. 2010). We showed earlier that the growth of hybrid aspen trees was comparable when using either ammonium or nitrate as the sole nitrogen source, demonstrating that both sources can be equally utilized (Renström et al. 2024). However, it is not clear where in the tree nitrogen that is taken up in the form of nitrate is being assimilated. Preferential assimilation of nitrate in both the shoots (Black et al. 2002) and the roots (Gessler et al. 2004) have been reported. We observed that fertilization with nitrate activated the so-called primary nitrate response (Krouk et al. 2010), including induction of the expression of both nitrate and nitrite reductases, in developing xylem tissues of the stem (Figure 4). This observation demonstrates that nitrate that is being taken up by the roots is not necessarily assimilated in the roots but transported in the xylem sap of the stem and taken up in the stem where it stimulates the expression of nitrate-assimilating genes. However, nitrate treatment also tended to increase the expression of a few members of the AMT gene family (Figure 4), which could reflect regulation of these AMTs by nitrate or that at least a part of the applied nitrate is assimilated in the roots and transported in the form of ammonium. Furthermore, the expression of amino acid transporters in the secondary xylem tissues in response to nitrate fertilization supports the assimilation of nitrate before reaching the xylem tissues of the stem (Figure 4). It is therefore likely that nitrate can be assimilated in both the roots and the above ground parts of the trees.

The capacity of applied nitrate to induce the expression of NR and NIR in the secondary xylem tissues raises the question of how nitrate is removed from the xylem sap. The tissue-specific expression pattern and nitrate responsiveness indicated on the action of specific NRT1/NPF genes, such as PotraNPF4.4b and PotraNPF7.2, in the lateral transport of nitrate from the xylem sap to the surrounding parenchymatic cells (Figures 3 and 4). PotraNPF4.4b is homologous to the Arabidopsis AtNRT1.13/NPF4.4 which is expressed in the parenchymatic cells next to the xylem elements, but which cannot transport nitrate from the sap since it lacks the proline residue crucial for nitrate transport (Chen et al. 2021). Interestingly, PotraNPF4.4b contains the proline residue (see Figure S2 available as Supplementary Data at Tree Physiology Online), supporting its function in nitrate uptake from the xylem sap. PotraNPF7.2 is a promising candidate for having a role in nitrate retrieval from the sap to the xylem parenchyma on the basis of its strictly ray cell specific expression (Figure 3 and Figure S3 available as Supplementary Data at Tree Physiology Online, Tung et al. 2023) and homology to AtNRT1.8/NPF7.2 which is expressed in xylem parenchyma cells and supposedly removes nitrate from the xylem vessels (Li et al. 2010). Additionally, the aspen homologs of AtNRT1.5/NPF7.3 which participates in nitrate reallocation in Arabidopsis (Lin et al. 2008) could play a role in nitrate reallocation in tree stems.

Assimilation of nitrogen and radial growth of tree stems

Xylem-to-phloem allocation of amino acids has been demonstrated in lupin (Pate et al. 1975) and tomato (van Bel 1984). We identified several members of the amino acid transporter families that were highly expressed in the developing xylem tissues of aspen trees (Figure 3) and that could therefore have a function in the uptake of amino acids from the xylem sap into the parenchymatic ray cells of the secondary xylem. Interestingly, the results from the co-expression analysis in the SwAsp population of aspen trees showed that the expression of three AAPs, PotraAAP2.2, PotraAAP3.2 and PotraAAP6.1, correlated negatively with stem diameter (Figure 5A). PotraAAP2.2 is homologous to AtAAP2 (AT5G09220) which mediates root-derived amino acid transport from xylem to phloem (Zhang et al. 2010) and coordinates partitioning of nitrogen and carbon within the plants (Perchlik and Tegeder 2018). The loss of AtAAP2 function in Arabidopsis resulted in increased allocation of nitrogen into the leaves as well as increased plant growth, which suggests that nitrogen allocation to leaves improves carbon fixation and, vice versa, that nitrogen allocation to other parts of the plant than leaves, such as stem tissues, suppresses carbon fixation and growth of the plants. Based on these results, it seems possible that amino acid permeases, such as PotraAAP2.2, act to divert amino acids from the xylem sap, negatively influencing carbon fixation in the leaves and concomitantly carbon allocation to the stem and the radial growth. However, the expression of PotraAAP2.2 in the xylem parenchyma as well as in the phloem (Figure 3, Figure S3 available as Supplementary Data at Tree Physiology Online) is different from the strictly phloem-specific expression of the Arabidopsis AtAAP2 (Zhang et al. 2010). PotraAAP2.2 expression is actually more similar to AtAAP6 which is expressed in the xylem parenchyma cells (Okumoto et al. 2002). AtAAP6 has been proposed to have a role in xylem-to-phloem transport of amino acids (Okumoto et al. 2002), supporting function of PotraAAP2.2 in amino acid uptake from the sap. Future work is needed to clarify the function of these AAPs in amino acid reallocation in the stem and their effect on tree growth.

Conclusions

We present a comprehensive analysis of nitrogen-related gene families in aspen, highlighting the genetic and functional dynamics essential for nitrogen-use efficiency. High-resolution gene expression analyses, together with co-expression analyses in a population of aspen trees, revealed a set of genes that are not typically associated with nitrogen uptake or assimilation and might therefore encode proteins that have specific functions in nitrogen reallocation and assimilation in the developing xylem tissues of the stem (Figure 6). The expression of these genes provide evidence on nitrate and ammonium uptake from the soil, uptake of nitrate, ammonium and amino acids from xylem sap into the parenchymatic ray cells, and assimilation in the developing xylem tissues of the stem (Figure 6).

Figure 6.

Figure 6

A proposed scheme of nitrogen uptake, reallocation and assimilation in the stem of aspen trees. The scheme is based on data presented on the expression of the aspen genes in AspWood (plantgenie.org) and gene co-expression patterns in the SwAsp population of aspen, presented in Figures 3 and 5. The microscopic image depicts the location of the tangential sections used for the gene expression analysis in the aspen stem in tree 1 in the AspWood data. The majority (>50%) of the cells in each section was estimated to reside in the phloem (sections 1 and 2), in the vascular cambium (sections 3–6), in the expanding xylem (sections 7–10) and in maturing xylem (the rest of the sections) according to Sundell et al. (2017). Vessel cell death was estimated to occur around the section number 18, and sap flow therefore takes place from sections 18–25. Fiber cell death was estimated to occur around section number 24. The only living cell type in section number 25 is therefore the rays. We provide evidence that both nitrate and ammonium is taken up by aspen roots at least in greenhouse conditions, and that each of nitrate, ammonium and amino acids are reallocated from the xylem sap to the parenchymatic ray cells and assimilated in the developing xylem tissues of the stem. Some of the proteins that seem to operate in nitrogen reallocation, nitrate sensing and nitrogen assimilation in the developing xylem, based on gene expression, are listed in the schematic representation.

We suggest on the basis of our gene expression analyses that even though nitrogen assimilation seems to be highly active in the developing xylem tissues of the stem, it needs to be suppressed by limiting the uptake of nitrate and amino acids from the xylem sap for the benefit of the photosynthetic nitrogen-use efficiency in the leaves. The negative correlation between the expression of specific members of the AAP and NRT1/NPF family members with plant diameter emphasizes their potential role in modulating nitrogen allocation, photosynthetic nitrogen-use efficiency and tree growth. Future investigations are warranted to validate these findings, paving the way for sustainable practices that optimize plant productivity in variable environmental conditions.

Supplementary Material

Figure_S1_tpaf099
figure_s1_tpaf099.pdf (577.5KB, pdf)
Figure_S2_tpaf099
figure_s2_tpaf099.pdf (2.1MB, pdf)
Figure_S3_tpaf099
figure_s3_tpaf099.pdf (411KB, pdf)
Table_S1_tpaf099
table_s1_tpaf099.xlsx (66.4KB, xlsx)
Table_S2_tpaf099
table_s2_tpaf099.xlsx (9.8MB, xlsx)
Table_S3_tpaf099
table_s3_tpaf099.xlsx (699.5KB, xlsx)
Supplementary_data_tpaf099

Acknowledgments

The authors thank Nathaniel Street for critical reading and commenting of the manuscript, Nicolas Delhomme at the UPSC Bioinformatic facility, Elin Nordin for qPCR primer design and Daria Chrobok (DC SciArt) for the illustration of the Figure 6. The authors acknowledge support from the National Genomics Infrastructure in Stockholm funded by Science for Life Laboratory, the Knut and Alice Wallenberg Foundation and the Swedish Research Council, and NAISS/Uppsala Multidisciplinary Center for Advanced Computational Science for assistance with massively parallel sequencing.

Contributor Information

Yupeng Zhang, Department of Forest Genetics and Plant Physiology, Umeå Plant Science Centre (UPSC), Swedish University of Agricultural Sciences, 90183 Umeå, Sweden.

Shruti Choudhary, Department of Forest Genetics and Plant Physiology, Umeå Plant Science Centre (UPSC), Swedish University of Agricultural Sciences, 90183 Umeå, Sweden.

Anna Renström, Department of Forest Genetics and Plant Physiology, Umeå Plant Science Centre (UPSC), Swedish University of Agricultural Sciences, 90183 Umeå, Sweden.

Mikko Luomaranta, Department of Plant Physiology, Umeå Plant Science Centre (UPSC), Umeå University, 90187 Umeå, Sweden.

Maxime Chantreau, Department of Forest Genetics and Plant Physiology, Umeå Plant Science Centre (UPSC), Swedish University of Agricultural Sciences, 90183 Umeå, Sweden.

Verena Fleig, Department of Forest Genetics and Plant Physiology, Umeå Plant Science Centre (UPSC), Swedish University of Agricultural Sciences, 90183 Umeå, Sweden.

Ioana Gaboreanu, Department of Forest Genetics and Plant Physiology, Umeå Plant Science Centre (UPSC), Swedish University of Agricultural Sciences, 90183 Umeå, Sweden.

Carolin Grones, Department of Plant Physiology, Umeå Plant Science Centre (UPSC), Umeå University, 90187 Umeå, Sweden; Laboratory of Cell and Developmental Biology, Cluster of Plant Developmental Biology, Department of Plant Sciences, Wageningen University, The Netherlands.

Ove Nilsson, Department of Forest Genetics and Plant Physiology, Umeå Plant Science Centre (UPSC), Swedish University of Agricultural Sciences, 90183 Umeå, Sweden.

Kathryn M Robinson, Department of Plant Physiology, Umeå Plant Science Centre (UPSC), Umeå University, 90187 Umeå, Sweden.

Hannele Tuominen, Department of Forest Genetics and Plant Physiology, Umeå Plant Science Centre (UPSC), Swedish University of Agricultural Sciences, 90183 Umeå, Sweden.

Author contributions

H.T. initiated the project. Y.P.Z. and M.C. performed the phylogenetic analyses, A.R. named genes in the phylogenetic analyses and performed the nitrate and ammonium treatments, M.L. produced the data for the eQTL analyses and the co-expression network, S.C. analyzed the RNA-seq data for the nitrate vs ammonium treatments, C.G., V.F., I.G. and O.N. created and analyzed the PotraGLN1.2a overexpressor lines, K.M.R. provided the data on the diameter of the SwAsp population, Y.P.Z. extracted the data from the AspWood database and the eQTL analysis and wrote the first draft of the manuscript. All authors contributed to the writing of the manuscript.

Conflict of interest

None declared.

Funding

This work was supported by grants from the Knut and Alice Wallenberg Foundation (KAW 2016.0352 and KAW 2020.0240), the Swedish Research Foundation Formas (grant 2021–00992), the Swedish Research Foundation VR (grant 2020–03799), Bio4Energy (www.bio4Energy.se, grant B4E3-FM-2-06) and Trees for the Future post doc program (diarie 2022.3.2.5–426).

Data availability

The raw reads from RNA-Sequencing of ammonia treated hybrid aspen xylem are available under the NCBI project ID# PRJNA1169771. The script for DESeq analysis and heatmaps can be found at https://github.com/shruti281989/nitrogenDESeq.

References

  1. Bai  H, Euring  D, Volmer  K, Janz  D, Polle  A (2013) The nitrate transporter (NRT) gene family in poplar. PloS One  8:e72126. 10.1371/journal.pone.0072126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Black  BL, Fuchigami  LH, Coleman  GD (2002) Partitioning of nitrate assimilation among leaves, stems and roots of poplar. Tree Physiol  22:717–724. 10.1093/treephys/22.10.717. [DOI] [PubMed] [Google Scholar]
  3. Brady  SM, Orlando  DA, Lee  J-Y, Wang  JY, Koch  J, Dinneny  JR, Mace  D, Ohler  U, Benfey  PN (2007) A high-resolution root spatiotemporal map reveals dominant expression patterns. Science  318:801–806. 10.1126/science.1146265. [DOI] [PubMed] [Google Scholar]
  4. Cánovas  FM, Cañas  RA, de la  Torre  FN, Pascual  MB, Castro-Rodríguez  V, Avila  C (2018) Nitrogen metabolism and biomass production in Forest trees. Front Plant Sci  9:1449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cao  L, Xu  C, Sun  Y, Niu  C, Leng  X, Hao  B, Ma  J  et al. (2023) Genome-wide identification of glutamate synthase gene family and expression patterns analysis in response to carbon and nitrogen treatment in Populus. Gene  851:146996. 10.1016/j.gene.2022.146996. [DOI] [PubMed] [Google Scholar]
  6. Cao  L, Zhang  S, Cao  J  et al. (2024) Nitrogen modifies wood composition in poplar seedlings by regulating carbon and nitrogen metabolism. Ind Crops Prod  219:119118. 10.1016/j.indcrop.2024.119118. [DOI] [Google Scholar]
  7. Capella-Gutiérrez  S, Silla-Martínez  JM, Gabaldón  T (2009) trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics  25:1972–1973. 10.1093/bioinformatics/btp348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Castro-Rodríguez  V, García-Gutiérrez  A, Canales  J, Cañas  RA, Kirby  EG, Avila  C, Cánovas  FM (2016) Poplar trees for phytoremediation of high levels of nitrate and applications in bioenergy. Plant Biotechnol J  14:299–312. 10.1111/pbi.12384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen  C, Wu  Y, Li  J, Wang  X, Zeng  Z, Xu  J, Xia  R (2023) TBtools-II: a “one for all, all for one” bioinformatics platform for biological big-data mining. Mol Plant  16:1733–1742. 10.1016/j.molp.2023.09.010. [DOI] [PubMed] [Google Scholar]
  10. Chen  HY, Lin  SH, Cheng  LH, Wu  JJ, Lin  YC, Tsay  YF (2021) Potential transceptor AtNRT1.13 modulates shoot architecture and flowering time in a nitrate-dependent manner. Plant Cell  33:1492–1505. 10.1093/plcell/koab051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Congreves  KA, Otchere  O, Ferland  D, Farzadfar  S, Williams  S, Arcand  MM (2021) Nitrogen use efficiency definitions of today and tomorrow. Front Plant Sci  12:637108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Corratgé-Faillie  C, Lacombe  B (2017) Substrate (un)specificity of Arabidopsis NRT1/PTR FAMILY (NPF) proteins. J Exp Bot  68:3107–3113. 10.1093/jxb/erw499. [DOI] [PubMed] [Google Scholar]
  13. Couturier  J, Doidy  J, Guinet  F, Wipf  D, Blaudez  D, Chalot  M (2010) Glutamine, arginine and the amino acid transporter Pt-CAT11 play important roles during senescence in poplar. Ann Bot  105:1159–1169. 10.1093/aob/mcq047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Du  C, Zhang  M, Zhou  X, Bai  Y, Wang  L, Zhang  L, Hu  J (2023) Revealing the relationship between nitrogen use efficiency-related QTLs and carbon and nitrogen metabolism regulation in poplar. GCB Bioenergy  15:575–592. 10.1111/gcbb.13040. [DOI] [Google Scholar]
  15. Du  J, Du  C, Ge  X, Wen  S, Zhou  X, Zhang  L, Hu  J (2022) Genome-wide analysis of the AAAP gene family in Populus and functional analysis of PsAAAP21 in root growth and amino acid transport. Int J Mol Sci  24:624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Escamez  S, Robinson  KM, Luomaranta  M  et al. (2023) Genetic markers and tree properties predicting wood biorefining potential in aspen (Populus tremula) bioenergy feedstock. Biotechnol Biofuels  16:65. 10.1186/s13068-023-02315-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Fu  J, Sampalo  R, Gallardo  F, Cánovas  FM, Kirby  EG (2003) Assembly of a cytosolic pine glutamine synthetase holoenzyme in leaves of transgenic poplar leads to enhanced vegetative growth in young plants. Plant Cell Environ  26:411–418. 10.1046/j.1365-3040.2003.00972.x. [DOI] [Google Scholar]
  18. Gallardo  F, Fu  J, Cantón  F, Garcia-Gutierrez  A, Canovas  FM, Kirby  EG (1999) Expression of a conifer glutamine synthetase gene in transgenic poplar. Planta  210:19–26. 10.1007/s004250050649. [DOI] [PubMed] [Google Scholar]
  19. Gessler  A, Kopriva  S, Rennenberg  H (2004) Regulation of nitrate uptake at the whole-tree level: interaction between nitrogen compounds, cytokinins, and carbon metabolism. Tree Physiol  24:1313–1321. 10.1093/treephys/24.12.1313. [DOI] [PubMed] [Google Scholar]
  20. Gu  Z (2022) Complex heatmap visualization. iMeta  1:e43. 10.1002/imt2.43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Guan  L, Lu  Y, Wang  H, Li  Z, Li  Q, Luo  J (2025) NIN-like proteins in poplar play roles in responding to abiotic stresses and nitrate availability. Plant Stress  16:100878. 10.1016/j.stress.2025.100878. [DOI] [Google Scholar]
  22. Han  M, Xu  X, Li  X, Xu  M, Hu  M, Xiong  Y  et al. (2022) New insight into aspartate metabolic pathways in Populus. Int J Mol Sci  23:6368. 10.3390/ijms23126368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hao  DL, Zhou  JY, Yang  SY, Qi  W, Yang  KJ, Su  YH (2020) Function and regulation of ammonium transporters in plants. Int J Mol Sci  21:3557. 10.3390/ijms21103557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ho  CH, Lin  SH, Hu  HC, Tsay  YF (2009) CHL1 functions as a nitrate sensor in plants. Cell  138:1184–1194. 10.1016/j.cell.2009.07.004. [DOI] [PubMed] [Google Scholar]
  25. Ji  L, Song  L, Zou  L  et al. (2024) Genome-wide identification of nitrate transporter 1/peptide transporter family (NPF) in cassava and functional analysis of MeNPF5.4 and MeNPF6.2 in response to nitrogen and salinity stresses in rice. Crop Sci  64:211–224. 10.1002/csc2.21138. [DOI] [Google Scholar]
  26. Jing  ZP, Gallardo  F, Pascual  MB, Sampalo  R, Romero  J, De Navarra  AT, Cánovas  FM (2004) Improved growth in a field trial of transgenic hybrid poplar overexpressing glutamine synthetase. New Phytol  164:137–145. 10.1111/j.1469-8137.2004.01173.x. [DOI] [PubMed] [Google Scholar]
  27. Katoh  K, Standley  DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol  30:772–780. 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Konishi  M, Okitsu  T, Yanagisawa  S (2021) Nitrate-responsive NIN-like protein transcription factors perform unique and redundant roles in Arabidopsis. J Exp Bot  72:5735–5750. 10.1093/jxb/erab246. [DOI] [PubMed] [Google Scholar]
  29. Krouk  G, Mirowski  P, LeCun  Y, Shasha  DE, Coruzzi  GM (2010) Predictive network modeling of the high-resolution dynamic plant transcriptome in response to nitrate. Genome Biol  11:R123. 10.1186/gb-2010-11-12-r123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Léran  S, Varala  K, Boyer  JC  et al. (2014) A unified nomenclature of NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER family members in plants. Trends Plant Sci  19:5–9. 10.1016/j.tplants.2013.08.008. [DOI] [PubMed] [Google Scholar]
  31. Li  J-Y, Fu  Y-L, Pike  SM  et al. (2010) The Arabidopsis nitrate transporter NRT1.8 functions in nitrate removal from the xylem sap and mediates cadmium tolerance. Plant Cell  22:1633–1646. 10.1105/tpc.110.075242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Li  Z, Guan  L, Zhang  C, Zhang  S, Liu  Y, Lu  Y, Luo  J (2024) Nitrogen assimilation genes in poplar: potential targets for improving tree nitrogen use efficiency. Ind Crops Prod  216:118705. 10.1016/j.indcrop.2024.118705. [DOI] [Google Scholar]
  33. Lin  S-H, Kuo  H-F, Canivenc  G  et al. (2008) Mutation of the Arabidopsis NRT1.5 nitrate transporter causes defective root-to-shoot nitrate transport. Plant Cell  20:2514–2528. 10.1105/tpc.108.060244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Liu  KH, Huang  CY, Tsay  YF (1999) CHL1 is a dual-affinity nitrate transporter of Arabidopsis involved in multiple phases of nitrate uptake. Plant Cell  11:865–874. 10.1105/tpc.11.5.865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Liu  KH, Liu  M, Lin  Z  et al. (2022) NIN-like protein 7 transcription factor is a plant nitrate sensor. Science  377:1419–1425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Liu  Q, Wu  K, Song  W, Zhong  N, Wu  Y, Fu  X (2022) Improving crop nitrogen use efficiency toward sustainable green revolution. Annu Rev Plant Biol  73:523–551. [DOI] [PubMed] [Google Scholar]
  37. Love  MI, Huber  W, Anders  S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol  15:550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lu  Y, Zheng  B, Zhang  C, Yu  C, Luo  J (2024) Wood formation in trees responding to nitrogen availability. Ind Crops Prod  218:118978. 10.1016/j.indcrop.2024.118978. [DOI] [Google Scholar]
  39. Luo  ZB, Langenfeld-Heyser  R, Calfapietra  C, Polle  A (2005) Influence of free air CO2 enrichment (EUROFACE) and nitrogen fertilisation on the anatomy of juvenile wood of three poplar species after coppicing. Trees  19:109–118. 10.1007/s00468-004-0369-0. [DOI] [Google Scholar]
  40. Luomaranta  M, Grones  C, Choudhary  S, Milhinhos  A, Ahlgren Kalman  T, Nilsson  O, Robinson  KM, Street  NR, Tuominen  H (2024) Systems genetic analysis of lignin biosynthesis in Populus Tremula. New Phytol  243:2157–2174. 10.1111/nph.19993. [DOI] [PubMed] [Google Scholar]
  41. Minh  BQ, Schmidt  HA, Chernomor  O, Schrempf  D, Woodhams  MD, von  Haeseler  A, Lanfear  R (2020) IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Mol Biol Evol  37:1530–1534. 10.1093/molbev/msaa015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Nilsson  O, Aldén  T, Sitbon  F, Anthony Little  CH, Chalupa  V, Sandberg  G, Olsson  O (1992) Spatial pattern of cauliflower mosaic virus 35S promoter-luciferase expression in transgenic hybrid aspen trees monitored by enzymatic assay and non-destructive imaging. Transgenic Res  1:209–220. 10.1007/BF02524751. [DOI] [Google Scholar]
  43. Novaes  E, Osorio  L, Drost  DR  et al. (2009) Quantitative genetic analysis of biomass and wood chemistry of Populus under different nitrogen levels. New Phytol  182:878–890. 10.1111/j.1469-8137.2009.02785.x. [DOI] [PubMed] [Google Scholar]
  44. Okumoto  S, Schmidt  R, Tegeder  M, Fischer  WN, Rentsch  D, Frommer  WB, Koch  W (2002) High affinity amino acid transporters specifically expressed in xylem parenchyma and developing seeds of Arabidopsis. J Biol Chem  277:45338–45346. 10.1074/jbc.M207730200. [DOI] [PubMed] [Google Scholar]
  45. Pate  JS, Sharkey  PJ, Lewis  OAM (1975) Xylem to phloem transfer of solutes in fruiting shoots of legumes, studied by a phloem bleeding technique. Planta  122:11–26. 10.1007/BF00385400. [DOI] [PubMed] [Google Scholar]
  46. Perchlik  M, Tegeder  M (2018) Leaf amino acid supply affects photosynthetic and plant nitrogen use efficiency under nitrogen stress. Plant Physiol  178:174–188. 10.1104/pp.18.00597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Pitre  F, Pollet  B, Lafarguette  F, Cooke  J, MacKay  J, Lapierre  C (2007) Effects of increased nitrogen supply on the lignification of poplar wood. J Agric Food Chem  55:10306–10314. 10.1021/jf071611e. [DOI] [PubMed] [Google Scholar]
  48. Pratelli  R, Pilot  G (2014) Regulation of amino acid metabolic enzymes and transporters in plants. J Exp Bot  65:5535–5556. 10.1093/jxb/eru320. [DOI] [PubMed] [Google Scholar]
  49. Potter  SC, Luciani  A, Eddy  SR, Park  Y, Lopez  R, Finn  RD (2018) HMMER web server: 2018 update. Nucleic Acids Res  46:W200–W204. 10.1093/nar/gky448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Rennenberg  H, Wildhagen  H, Ehlting  B (2010) Nitrogen nutrition of poplar trees. Plant Biol  12:275–291. 10.1111/j.1438-8677.2009.00309.x. [DOI] [PubMed] [Google Scholar]
  51. Renström  A, Choudhary  S, Gandla  ML, Jönsson  LJ, Hedenström  M, Jämtgård  S, Tuominen  H (2024) The effect of nitrogen source and levels on hybrid aspen tree physiology and wood formation. Physiol Plant  176:e14219. [DOI] [PubMed] [Google Scholar]
  52. Robinson  KM, Schiffthaler  B, Liu  H, Rydman  SM, Rendón-Anaya  M, Ahlgren Kalman  T, Kumar  V  et al. (2024) An improved chromosome-scale genome assembly and population genetics resource for Populus Tremula. Physiol Plant  176:e14511. 10.1111/ppl.14511. [DOI] [PubMed] [Google Scholar]
  53. Rosvall  M, Bergstrom  CT (2008) Maps of random walks on complex networks reveal community structure. Proc Natl Acad Sci USA  105:1118–1123. 10.1073/pnas.0706851105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Shannon  P, Markiel  A, Ozier  O, Baliga  NS, Wang  JT, Ramage  D, Amin  N, Schwikowski  B, Ideker  T (2003) Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res  13:2498–2504. 10.1101/gr.1239303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Stevens  CJ (2019) Nitrogen in the environment. Science  363:578–580. 10.1126/science.aav8215. [DOI] [PubMed] [Google Scholar]
  56. Sundell  D, Mannapperuma  C, Netotea  S, Delhomme  N, Lin  YC, Sjödin  A, Street  NR (2015) The plant genome integrative explorer resource: PlantGenIE.org. New Phytol  208:1149–1156. [DOI] [PubMed] [Google Scholar]
  57. Sundell  D, Street  NR, Kumar  M  et al. (2017) AspWood: high-spatial-resolution transcriptome profiles reveal uncharacterized modularity of wood formation in Populus Tremula. Plant Cell  29:1585–1604. 10.1105/tpc.17.00153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Tamura  K, Stecher  G, Kumar  S (2021) MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol  38:3022–3027. 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Tegeder  M (2014) Transporters involved in source to sink partitioning of amino acids and ureides: opportunities for crop improvement. J Exp Bot  65:1865–1878. 10.1093/jxb/eru012. [DOI] [PubMed] [Google Scholar]
  60. Tegeder  M, Hammes  UZ (2018) The way out and in: phloem loading and unloading of amino acids. Curr Opin Plant Biol  43:16–21. 10.1016/j.pbi.2017.12.002. [DOI] [PubMed] [Google Scholar]
  61. Tung  C-C, Kuo  S-C, Yang  C-L  et al. (2023) Single-cell transcriptomics unveils xylem cell development and evolution. Genome Biol  24:3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Untergasser  A, Cutcutache  I, Koressaar  T, Ye  J, Faircloth  BC, Remm  M, Rozen  SG (2012) Primer3—new capabilities and interfaces. Nucl Acids Res  40:e115. 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. van Bel  AJ (1984) Quantification of the xylem-to-phloem transfer of amino acids by use of inulin [14C] carboxylic acid as xylem transport marker. Plant Sci Lett  35:81–85. 10.1016/0304-4211(84)90162-7. [DOI] [Google Scholar]
  64. Vidal  EA, Alvarez  JM, Araus  V  et al. (2020) Nitrate in 2020: thirty years from transport to signaling networks. Plant Cell  32:2094–2119. 10.1105/tpc.19.00748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. von Wittgenstein  N, le  CH, Hawkins  BJ, Ehlting  J (2014) Evolutionary classification of ammonium, nitrate, and peptide transporters in land plants. BMC Evol Biol  14:11. 10.1186/1471-2148-14-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Wang  W, Talide  L, Viljamaa  S, Niittylä  T (2022) Aspen growth is not limited by starch reserves. Curr Biol  32:3619–3627. 10.1016/j.cub.2022.06.056. [DOI] [PubMed] [Google Scholar]
  67. Wang  YY, Cheng  YH, Chen  KE, Tsay  YF (2018) Nitrate transport, signaling, and use efficiency. Annu Rev Plant Biol  69:85–122. 10.1146/annurev-arplant-042817-040056. [DOI] [PubMed] [Google Scholar]
  68. Waqas  M, Hawkesford  MJ, Geilfus  CM (2023) Feeding the world sustainably: efficient nitrogen use. Trends Plant Sci  28:505–508. 10.1016/j.tplants.2023.02.010. [DOI] [PubMed] [Google Scholar]
  69. Wu  X, Yang  H, Qu  C, Xu  Z, Li  W, Hao  B, Yang  C, Sun  G, Liu  G (2015) Sequence and expression analysis of the AMT gene family in poplar. Front Plant Sci  6:337. 10.3389/fpls.2015.00337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Xu  N, Cheng  L, Kong  Y, Chen  G, Zhao  L, Liu  F (2024) Functional analyses of the NRT2 family of nitrate transporters in Arabidopsis. Front Plant Sci  15:1351998. 10.3389/fpls.2024.1351998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Xu  Z, Ma  J, Qu  C  et al. (2017) Identification and expression analyses of the alanine aminotransferase (AlaAT) gene family in poplar seedlings. Sci Rep  7:45933. 10.1038/srep45933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Yan  D, Easwaran  V, Chau  V, Okamoto  M, Ierullo  M, Kimura  M, Nambara  E (2016) NIN-like protein 8 is a master regulator of nitrate-promoted seed germination in Arabidopsis. Nat Commun  7:13179. 10.1038/ncomms13179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Yang  G, Wei  Q, Huang  H, Xia  J (2020) Amino acid transporters in plant cells: a brief review. Plants  9:967. 10.3390/plants9080967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Yu  XQ, Su  W, Zhang  H  et al. (2023) Genome-wide analysis of autophagy-related gene family and PagATG18a enhances salt tolerance by regulating ROS homeostasis in poplar. Int J Biol Macromol  224:1524–1540. 10.1016/j.ijbiomac.2022.10.240. [DOI] [PubMed] [Google Scholar]
  75. Yuan  L, Loqué  D, Kojima  S, Rauch  S, Ishiyama  K, Inoue  E, von  Wirén  N (2007) The organization of high-affinity ammonium uptake in Arabidopsis roots depends on the spatial arrangement and biochemical properties of AMT1-type transporters. Plant Cell  19:2636–2652. 10.1105/tpc.107.052134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Zhang  L, Tan  Q, Lee  R, Trethewy  A, Lee  YH, Tegeder  M (2010) Altered xylem-phloem transfer of amino acids affects metabolism and leads to increased seed yield and oil content in Arabidopsis. Plant Cell  22:3603–3620. 10.1105/tpc.110.073833. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure_S1_tpaf099
figure_s1_tpaf099.pdf (577.5KB, pdf)
Figure_S2_tpaf099
figure_s2_tpaf099.pdf (2.1MB, pdf)
Figure_S3_tpaf099
figure_s3_tpaf099.pdf (411KB, pdf)
Table_S1_tpaf099
table_s1_tpaf099.xlsx (66.4KB, xlsx)
Table_S2_tpaf099
table_s2_tpaf099.xlsx (9.8MB, xlsx)
Table_S3_tpaf099
table_s3_tpaf099.xlsx (699.5KB, xlsx)
Supplementary_data_tpaf099

Data Availability Statement

The raw reads from RNA-Sequencing of ammonia treated hybrid aspen xylem are available under the NCBI project ID# PRJNA1169771. The script for DESeq analysis and heatmaps can be found at https://github.com/shruti281989/nitrogenDESeq.


Articles from Tree Physiology are provided here courtesy of Oxford University Press

RESOURCES