Airway sympathectomy attenuates inflammation, transcriptional ratios of Muc5ac and Muc5b, and airway mechanic deficits in mice delivered intranasal IL-13

Abstract

Excessive mucus in the airways is an underlying pathological feature of many airway diseases, including asthma. Therapeutic options to reduce mucus production in the airways remain limited. One possible therapeutic target is the airway sympathetic nerves. Although lung sympathetic innervation has been considered sparse, sympathetic nerves secrete neurotransmitters that act on adrenergic receptors, including β₂-adrenergic receptor (β₂AR). Interestingly, in experimental models, chronic use β₂AR agonists can augment mucus secretion. Thus, in the present study, we tested the hypothesis that airway sympathetic nerves regulate mucus production in the airway in response to the type 2 cytokine interleukin 13 (IL-13). We performed airway sympathectomy using intranasal instillation of the synthetic neurotoxin 6-hydroxydopamine (6-OHDA). Airway sympathectomy attenuated multiple IL-13-mediated airway deficits, including density of goblet cells containing neutral mucins, transcriptional ratio of mucin 5ac (Muc5ac) to mucin 5b (Muc5b) and airway elastance and tissue damping. Although total Muc5ac and Muc5b transcript levels and Muc5ac and Muc5b protein levels in bronchoalveolar lavage were not significantly altered, these changes suggest that airway sympathectomy modifies goblet cell phenotype and mucin composition. Airway sympathectomy also dampened IL-13 mediated increases in total lung transcripts important for regulating allergic responses, including interleukin 6, complement component 3, and colony stimulating factor. This study reveals that airway sympathetic nerves regulate physiologic, molecular, and inflammatory responses to type 2 (IL-13-mediated) airway inflammation and raises the possibility that they may serve as potential targets for therapeutic intervention.

NEW & NOTEWORTHY

The role of airway sympathetic nerves in regulating airway responses remains largely undefined. We demonstrated that chemical depletion of airway sympathetic nerves attenuates specific IL-13-induced airway deficits at the molecular, cellular and functional level. Our data suggest that airway sympathetic nerves may represent novel therapeutic targets to alleviate some pathologic features due to type 2 (IL-13-mediated) airway inflammation.

Graphical Abstract

INTRODUCTION

Approximately 262 million people were diagnosed with asthma in 2019 (1). One driver of asthma-related mortality is excessive mucus and airway obstruction (2–4). Despite being a major driver of asthma-related morbidity and mortality, therapeutic options for managing mucus hypersecretion remain limited. Steroidal anti-inflammatories remain the most utilized approach to control asthma (5, 6) and are often prescribed in combination with β₂-adrenergic receptor (β₂AR) agonists (7–11). However, neither steroidal anti-inflammatories (12) nor β₂AR adrenergic drugs (7) prevent mucus hypersecretion. Moreover, in some people with severe asthma, they are ineffective in managing the asthma symptoms. Thus, there is a critical need to identify new targets for additional therapeutic intervention.

Interestingly, experimental studies suggest that β₂AR agonists, which are used to manage bronchoconstriction, may augment mucus secretion. For example, studies in experimental mouse models of allergic asthma have shown that chronic administration of β₂AR agonists, such as formoterol, increases airway mucus production (13, 14). In addition, evidence from cat models suggests that adrenergic agonists increase mucus secretion (15–17). Further in vitro studies using human (18), cat (19, 20), and ferret (21, 22) airway tissues support these findings. Conversely, treatment with β₂AR antagonists, such as nadolol, attenuates IL-13-induced mucus production (13, 23, 24). These findings suggest that sympathetic adrenergic nerves, which secrete neurotransmitters that act on β₂AR (25), may regulate mucus production in the airways.

However, one limitation in this interpretation is that sympathetic innervation to the lung has traditionally been considered sparse (26–28). That said, studies suggest that adrenergic nerves are expressed along the pulmonary vascular tree (25, 29–33) and that some sympathetic adrenergic nerves may also be near the airway epithelia (27, 33). In humans, adrenergic fibers are closely associated with bronchial glands, vessels, submucosal glands, and smooth muscles (27, 33–36). Thus, even though sympathetic nerves are considered sparse, their anatomic distribution in the lung suggests that they may regulate lung physiology under normal and inflammatory conditions (37). Consistent with this, previous studies have shown that lung sympathetic nerves modulate pulmonary immune responses to influenza A (38) and LPS-mediated lung inflammation (39). However, their role in regulating airway responses to type II inflammation associated with allergic asthma has not been explored.

In the present study, we tested the hypothesis that airway sympathetic nerves regulate airway physiology and pathophysiology to IL-13, a key mediator of allergic asthma (40–42). We (43, 44) and others (40, 45, 46) have reported that intranasal instillation of IL-13 i) enhances mucin 5ac (Muc5ac) production (43–48); ii) increases the density of goblet cells in the airway epithelium (40, 43–46); and iii) disrupts airway mechanics (43–45). To assess the role of airway sympathetic nerves in regulating inflammatory responses to IL-13, we performed intranasal instillation of the synthetic neurotoxin 6-hydroxydopamine (6-OHDA) to induce a chemical sympathectomy (38, 39, 49). By employing a combinatorial approach of molecular, cellular, and whole organ function (flexiVent) techniques, we sought to investigate whether 6-OHDA-airway sympathectomy mitigates IL-13-induced airway pathology.

MATERIALS AND METHODS

Animals.

The present study used adult (8–10 weeks old) male C57BL/6 mice. All mice were housed under a 12:12 h light/dark cycle, fed ad libitum standard chow diet (2918, Teklad), and provided ad libitum access to water. Animal experiments were approved by and adhered to the University of Florida Institutional Animal Care and Use Committee. Female sex hormones influence respiratory modulation of sympathetic nerve activity (50). Thus, given the potential variability introduced by the estrous cycle, and the fact that our laboratory does not currently have the necessary expertise or collaborative resources to accurately monitor and account for these hormonal fluctuations, we elected to use male mice to ensure consistency and reproducibility in our experimental outcomes.

6-OHDA and IL-13 treatments.

Before treatments, mice were lightly anesthetized under gaseous isoflurane (2–3%) in an induction chamber. Using a pipette, we instilled 50 µl of freshly prepared 6-OHDA (1% dissolved in sterile PBS containing 0.1% ascorbic acid; Tocris Biosciences, catalog number: 2547) or sterile PBS containing 0.1% ascorbic acid (ascorbic acid-vehicle; AA-VEH; Fisher Scientific, catalog number: A61–25) intranasally for three consecutive days (days 0–2)(39, 49). On the fourth day after the last instillation, we intranasally instilled 50µl of sterile IL-13 (50 µg/ml; 2.5 µg per day; R&D systems, catalog number: 413-ML) in 0.9% saline or sterile 0.9% saline (vehicle control; VEH) for four consecutive days (days 6–9) using our established protocol (43). All instilled solutions were sterilized with a 0.22 μm pore size filter (Millex^®-GP, catalog number: SLGPR33RS).

Pulmonary mechanics by flexiVent.

We evaluated pulmonary mechanics 20–24 hours after the last intranasal administration of IL-13 (day 10) as previously described by our lab (43, 44, 51–56). Briefly, we performed tracheotomy in mice anesthetized with ketamine, xylazine, and acepromazine at 100, 15, and 3 mg/kg, respectively. After cannulating the trachea, mice were mechanically ventilated in supine position with a flexiVent® small ventilator (SCIREQ, Montreal, QC, Canada) at 150 breaths/min at a tidal volume of 10 ml/kg of body mass. Intraperitoneal administration of a paralytic (1 mg/kg; rocuronium bromide, Novaplus) was performed before measurements. Using an ultrasonic nebulizer, we aerosolized their lungs with increasing doses of methacholine (Acetyl-beta-methacholine-chloride; Sigma-Aldrich; catalog number: A2251), ranging from 0 to 100 mg/ml. Methacholine is a cholinergic receptor agonist that induces bronchoconstriction, allowing for the study of dynamic airway mechanic properties, including airway resistance (Rs), airway elastance (Ers), Newtonian resistance (Rn), tissue damping (G), and tissue elastance (H). At the end of the flexiVent protocol, anesthetized mice were euthanized via cervical dislocation.

Bronchoalveolar lavage fluid (BALF) and analyses.

Following our established protocol (43, 44, 53–56), BALF was collected postmortem. Briefly, lungs were delivered with three sequential 1 ml lavages of 0.9% sterile saline via the cannulated trachea using a 1 ml syringe. All collected material from one mouse was pooled, spun at 500 g for 5 min at 4°C, and the supernatant was collected and kept at −80°C. The remaining cell pellet was used to count total cells using a hemocytometer, and morphologic differentiation of cells was further assessed using Kwik-Diff™ Stain (Fisher Scientific, catalog number: 99–907-00).

Enzyme-linked immunosorbent assay (ELISA).

We measured Muc5ac (Novus Biologicals, catalog number: NBP2–76704), Muc5b (Novus Biologicals, catalog number: NBP2–76706), and IL-6 (Invitrogen, catalog number: KMC0061) in BALF by using ELISA kits. Following the manufacturer’s protocols, BALF samples were run in duplicates, and concentrations were determined using an 8-point standards curve. To determine the optical density of each well, we used a filter-based accuSkan FC microplate photometer (Thermo Fisher Scientific, Waltham, MA, US) as previously described (43).

Lung Histology.

Following our published methods (43, 56), the density of goblet cells in the airways was assessed using traditional Alcian Blue/Periodic Schiff (PAS stain) staining. Briefly, the left lung lobe was collected and fixed in 10% neutral buffered formalin (Epredia™ Formal-Fixx™, catalog number: 9990244). Following established lab procedures, lungs were then embedded in paraffin and transversely sectioned, starting at the most distal airway of the bronchus. Paraffin-embedded samples were transversely sectioned at 4 μm thickness through the terminal and lower bronchioles. Sections containing lower bronchioles were stained with Alcian Blue/Periodic Schiff (PAS stain; Epredia, catalog number: 87023). A Zeiss Axio Zoom.V16 (Carl Zeiss, Germany) microscope was used to image the stained airways (43). Alcian Blue/PAS-positive cells were counted and normalized to the airway luminal area using ZenPro software (Carl Zeiss).

Lung immunofluorescence.

After flexiVent, the right middle lung lobe was collected for immunofluorescence staining of sympathetic nerves. The postmortem lung lobe was embedded in an Optimal Cutting Temperature compound (Tissue-Tek^® O.C.T. Compound, catalog number: 4583) using tissue molds (Epredia™ Peel-A-Way™ Disposable Embedding Molds, catalog number: 2219), frozen on dry ice, and coronally sectioned at 300 μm thickness using a cryostat. Immunostaining for tyrosine hydroxylase (TH) was used to quantify the density of adrenergic axons, and Vesicular Acetylcholine Transporter (VAChT) was used to quantify the density of cholinergic axons in the airways in lung tissues that were cleared with the Ce3D™ (clearing-enhanced 3D) Tissue Clearing Kit from BioLegend® (San Diego, CA, USA; catalog number: 427701). The TH⁺ nerves in the lungs were stained with a sheep anti-TH antibody (source: Sigma; catalog number: AB1542; RRID: AB_90755; 1:500), and VAChT⁺ nerves in the lungs were stained with a rabbit anti-VAChT antibody (source: Synaptic Systems; catalog number: 139008; RRID: AB_2943517; 1:400). Lung sections were incubated at RT in primary antibodies for 2 days, before counterstained with either a donkey anti-sheep Alexa fluor 647 antibody (source: Thermo Fisher Scientific; catalog number: A21448; RRID: AB_10374882; 1:800) or a goat anti-rabbit Alexa fluor 647 antibody (source: Thermo Fisher Scientific; catalog number: A21245; RRID: AB_2535813; 1:800). Lung sections were incubated at room temperature in respective secondary antibodies for 1 day. Then, lung sections were washed with the kit’s wash buffer solution three times for 3 hours, and, at the second washing step, DAPI solution (source: Novus; NBP2–31156; 1:1000) was added to the wash buffer and incubated for 1 hour. Following antibody labeling and DAPI staining, the lung tissues were cleared using the Ce3D™ tissue clearing solution according to the manufacturer’s instructions and mounted onto microscope slides (Fisher Scientific, catalog number: 1255015) and coveslipped (Epredia, catalog number: 12450S) with the clearing solution. To identify and image both TH⁺ and VAChT⁺ nerves in the lung sections, we used a confocal inverted microscope (Nikon A1R MP) from the Evelyn F. and William L. McKnight Brain Institute at the University of Florida. The images were processed and analyzed with Fiji (ImageJ v1.5x). We analyzed three randomly chosen airways per mouse. For each airway, we evaluated an area of 2.5 × 10⁵ μm² (500 × 500 μm) for the expression of TH⁺ and VAChT⁺ nerves. Pixel intensity threshold adjustments were applied to detect TH⁺ and VAChT⁺ immunofluorescence staining and reduce nonspecific background signal. Appropriate threshold values were validated using manual image analysis of lung sections containing TH⁺ and VAChT⁺ immunofluorescence staining from AA-VEH-treated mice, which were animals with intact sympathetic nerves (positive control group). After threshold adjustments, the resulting binary images were measured for raw intensity density and subsequently normalized to the airway luminal area. The resulting normalized values for the airway areas were pooled and averaged for each mouse.

Adrenal gland immunofluorescence.

To check whether intranasal instillation of 6-OHDA would deplete TH⁺ cells systemically, we assessed TH⁺ cells in the adrenal glands. The two adrenals from either an AA-VEH or 6-OHDA-treated mouse were dissected post-mortem. Adrenal glands were post-fixed in PFA 2% overnight at 4°C, followed by sucrose 30% immersion at 4°C for 24 hours. Then, adrenals were embedded in O.C.T. using appropriate tissue molds, frozen on dry ice, and sectioned at a thickness of 14 μm using a cryostat. As we sectioned, adrenal gland slices were mounted on microscope slides (Fisher Scientific, catalog number: 1255015). Slides with the adrenal samples were kept at −80°C until the immunofluorescence protocol was performed. Immunostaining for TH was used to quantify the density of adrenergic cells in the adrenal glands. Briefly, sections on the slides were permeabilized in 0.15% Triton X-100 (Fisher Scientific, catalog number: AAA16046AE) for 15 minutes at RT, followed by incubation in a blocking solution of SuperBlock™ Blocking Buffer (Thermo Scientific, catalog number: 37515) and 4% Normal Horse Serum for 30 minutes at RT. To detect TH⁺ cells in the adrenal glands, sections were incubated in a sheep anti-TH antibody (source: Sigma; catalog number: AB1542; RRID: AB_90755; 1:500) for 2 hours at 37°C. Then, sections were washed thoroughly for 30 minutes in PBS buffer solution, changing the buffer every 10 minutes, followed by incubation in a secondary antibody (donkey anti-sheep Alexa fluor 647 antibody; source: Thermo Fisher Scientific; catalog number: A21448; RRID: AB_10374882; 1:800) for 1 hour at RT. Then, sections were thoroughly washed with PBS buffer three times for 30 minutes, and, at the second washing step, DAPI solution (source: Novus; NBP2–31156; 1:1000) was added to the buffer and incubated for 10 minutes at RT. Samples were coverslipped (Epredia, catalog number: 12450S) with ProLong™ Gold Antifade Mountant (Invitrogen™, catalog number: P36930). To identify and image TH⁺ cells in the adrenal glands, we used a Keyence BZ-X700 All-in-One Fluorescence Microscope. Images were focused on the adrenal medulla to capture TH⁺ cells. Immunostaining images were processed and analyzed with Fiji (ImageJ v1.5x). Pixel intensity threshold adjustments were applied to detect TH⁺ immunofluorescence staining and reduce nonspecific background signal. Appropriate threshold values were validated using manual image analysis of sections containing TH⁺ immunofluorescence staining from AA-VEH-treated mice (control group). After threshold adjustments, images were measured for raw intensity density and subsequently normalized to the respective adrenal medullary areas.

RNA isolation and qRT-PCR.

We used methods as previously published (43, 44, 56). Briefly, after flexiVent, the right cranial lung lobes were placed in RNAlater™ Stabilization Solution (Thermo Fisher Scientific, catalog number: AM7021) and stored at 4°C until use (within a week). Lung lobes were processed using the RNeasy Lipid Tissue kit (Qiagen, catalog number: 74804) with in-column DNase digestion (Qiagen, catalog number: 79254). RNA concentration was determined with a NanoDrop (Thermo Fisher Scientific), and total RNA (2000 ng) was reverse transcribed using Superscript VILO Master Mix (Thermo Fisher Scientific, catalog number: 4385614). Using established protocols and primers we have previously published (43, 56), expressions of mucins, including Muc5ac, Muc5b, and Muc1, as well as purinergic receptor P2Y2 (P2ry2), member RAS oncogene family (Rab3D), and cholinergic receptor muscarinic 3 (M3R) were measured in total lung homogenates. We also quantified transcripts for SAM pointed domain containing ETS transcription factor (Spdef), forkhead box A2 (Foxa2), and Mucin 2 (Muc2) (Table 1). Actin was used as a housekeeping gene. Inflammatory-directed quantitative real-time (qRT)-PCR arrays (Qiagen, catalog number: PAMM-052Z) were employed according to the manufacturer’s instructions with detection accomplished with fast SYBR green master mix (Thermo Fisher Scientific, catalog number: 4385614), as we have previously published (57). Melting curves were performed and abundances relative to the AA-VEH-SAL group were calculated using the 2^−ΔΔCt method (58).

Table 1.

Primer information.

Gene Symbol	Gene	GenBank accession	Sequence of Forward (5’- 3’) and Reverse (3’- 5’) primers	Amplicon (bp)
Muc2	mucin 2	NM_023566.4	5’ AGCCCGGATCTCCAGTGTAT 3’ CACAAGCTCAAAGCCAGAGC	139
Foxa2	forkhead box A2	NM_001291065.1	5’ GAGGGCTACTCTTCCGTGA 3’ CATTCCAG’CGCCCACATAG	152
Spdef	SAM pointed domain containing ets transcription factor	NM_013891.4	5’ ACATCACAGCAGACCCTG 3’ AACTGTTCCTCGGACATGG	147

Actb, B2m, Gapdh, Gusb and Hsp90ab1 are endogenous controls in the array. All PCR studies were performed on a LightCycler^® 96 (Roche).

Statistical analysis.

We used Prism 10 (GraphPad Software, Boston, MA, USA) to generate graphs and statistical calculations. Results are expressed as means and standard deviation of the mean. For flexiVent analysis, we performed a three-way ANOVA with methacholine dose as a repeated measure and treatments (6-OHDA and IL-13) as main factors. The resultant statistically significant main effects and interactions were reported in the panels and the p-values for all the main effects and two-way and three-way interactions were reported in a supplementary file (Supplementary Table S1). For the inflammatory-directed qRT-PCR array analysis, we performed a three-way ANOVA with gene and treatments (6-OHDA and IL-13) as main factors. If triple interactions (gene vs. 6-OHDA vs. IL-13) were detected, a post-hoc False Discovery Rate (FDR) test was performed, and all the comparisons and p-values were reported in a supplementary file (Supplementary Table S2). A two-way ANOVA was performed for the other studies with both treatments (6-OHDA and IL-13) as main factors. The statistical significance for main effects and interactions was set at a p-value of less than 0.05. If significant interactions were detected, post-hoc comparisons were performed using Sidák’s multiple comparisons test. Major comparisons of interest were: 1) 6-OHDA + IL-13 vs. AA-VEH + IL-13; 2) 6-OHDA + IL-13 vs. 6-OHDA + SAL; and 3) AA-VEH + IL-13 vs. AA-VEH + SAL. A t-test was performed for the experiment comparing VAChT immunofluorescence expression in the airways of AA-VEH or 6-OHDA-treated mice (Supplemental Figure S1).

Sample size adequacy.

Sample sizes of 5 to 8 mice per group were used in this study, consistent with prior publications from our laboratory employing similar experimental models and endpoints (52, 57, 59–62). These group sizes have been sufficient to detect biologically meaningful differences in respiratory mechanics and inflammatory responses. Given the four treatment groups and a 3-way ANOVA design, this sample size provides adequate statistical power (typically >80%) to detect medium to large effect sizes and allows reliable detection of both main effects and interactions among factors.

RESULTS

Intranasal 6-OHDA depletes sympathetic nerves in the airways.

To assess the effect of 6-OHDA on depleting airway sympathetic nerves, we performed immunofluorescence staining. We examined nerves labeled with tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine synthesis and marker for sympathetic nerves, in the mouse airway (Fig. 1). Consistent with the literature (39, 49), intranasal administration of 6-OHDA for three consecutive days significantly reduced the density of TH-positive (TH⁺) nerve fibers in the mouse airway. IL-13 treatment did not affect TH⁺ nerve density in the mouse airway. Non-sympathetic nerves in the airways, such as cholinergic fibers, were not depleted by intranasal administration of 6-OHDA (Supplemental Figure S1). Additionally, at the systemic level, we observed that TH⁺ cells in the adrenal medulla were also not depleted by intranasal administration of 6-OHDA (Supplemental Figure S2), suggesting that 6-OHDA selectively depletes airway sympathetic nerves.

Figure 1. Intranasal instillation of 6-OHDA in mice depletes TH⁺ fibers in the airways.

(A) Semi-quantification of sympathetic innervation. Individual points are the average of three airways analyzed from a single mouse. A two-way ANOVA test was performed to check for statistical significance, and a significant main effect of 6-OHDA treatment was observed (M.E: 6-OHDA; p < 0.0001). n = 4–6 mice/group. (B) Representative images of lung cross-sections stained with an anti-TH antibody, a marker for sympathetic nerves. Compared to AA-VEH-treated mice, mice treated with 6-OHDA displayed depletion of TH⁺ nerve fibers in the airways. Asterisk (*) indicates airway lumen. Abbreviations: 6-OHDA, 6-hydroxydopamine; AA-VEH, ascorbic acid vehicle; IL-13, Interleukin 13; M.E: 6-OHDA, main effect of 6-OHDA; SAL, saline; TH, tyrosine-hydroxylase.

Airway sympathectomy dampens select airway mechanic responses to methacholine.

We assessed in vivo pulmonary mechanics using forced oscillation (flexiVent) in saline and IL-13-treated mice with or without airway sympathectomy (Fig. 2). All statistical results for the airway mechanic experiments are available in Supplementary Table S1. Neither IL-13 nor 6-OHDA affected basal values of airway resistance, airway elastance, Newtonian resistance, tissue damping or tissue elastance (Fig. 2A-E). However, IL-13 augmented all airway mechanic measurements in response to nebulized methacholine compared to saline controls (Fig. 2A-E). More specifically, we observed a statistically significant IL-13 x methacholine interaction for airway resistance (Fig. 2A), airway elastance (Fig. 2B), tissue damping (Fig. 2D), and tissue elastance (Fig. 2E). These results indicate that IL-13 enhanced the methacholine-induced response in the aforementioned airway properties. A statistically significant 6-OHDA x methacholine interaction was also observed, with 6-OHDA reducing airway elastance (Fig. 2B) and tissue damping (Fig. 2D) in response to methacholine. A main effect here indicates that, when data are combined across saline- and IL-13- treated animals, 6-OHDA reduced airway elastance and tissue damping responses to methacholine. A statistical trend (p = 0.055) for a main effect of 6-OHDA to reduce airway resistance (Fig. 2A) was also observed. Because no statistically significant methacholine x IL-13 × 6-OHDA interactions were observed for any airway mechanical properties (e.g., 6-OHDA did not influence the airway’s response to treatment and methacholine), no post-hoc multiple comparison tests were performed. Combined, these data demonstrated that 6-OHDA-mediated airway sympathectomy impacted select dynamic airway responses (airway elastance and tissue damping) to methacholine, whereas IL-13 augmented all dynamic airway responses to methacholine.

Figure 2. Evaluation of pulmonary mechanics using forced oscillation (flexiVent).

Basal (left panel) and normalized airway mechanics in response to increasing doses of methacholine (right panel). Airway resistance (A), airway elastance (B), Newtonian resistance (C), tissue damping (D), and tissue elastance (E). A three-way ANOVA was performed to test for statistical significance. n = 5–8 mice/group. p-values for all the main effects, as well as double and triple interactions, are reported in Supplementary Table S1. Abbreviations: 6-OHDA, 6-hydroxydopamine; AA-VEH, ascorbic acid vehicle; IL-13, Interleukin 13; SAL, saline. Significant statistical tests shown: MxIL-13: methacholine x IL-13; Mx6-OHDA interaction: methacholine x 6-OHDA interaction.

Airway sympathectomy mitigates IL-13-mediated increases in the density of goblet cells containing neutral mucins.

Prior studies have demonstrated that IL-13 increases production of both acidic and neutral mucins (63) and goblet cell density. To assess the density of goblet cells in the airway epithelia, we performed lung histology using traditional Alcian Blue/Periodic Schiff (PAS stain) staining, which identifies acidic (blue) and neutral (magenta) mucins. Confirming our published data (43), the density of goblet cells containing acidic mucins did not differ across treatment groups (Fig. 3A). However, a statistically significant IL-13 × 6-OHDA interaction for goblet cells containing neutral mucins was found (Fig. 3B), indicating that 6-OHDA altered the goblet cell response to IL-13. Post hoc comparisons revealed that IL-13 increased goblet cells containing neutral mucins in mice with airway sympathetic nerves intact, but not in mice with airway sympathectomy (Fig. 3B).

Figure 3. Acidic and neutral mucin-containing goblet cells in mouse airways.

Histological analysis of the numbers of acidic (A) and neutral (B) mucin-containing goblet cells in mouse airways. A significant main effect of IL-13 (M.E: IL-13; p = 0.006) and 6-OHDA (M.E: 6-OHDA; p = 0.002) treatment was observed, as well as an IL-13 × 6-OHDA interaction (p = 0.043). For panels A and B, individual points are data collected from a single mouse. n = 5–7 mice/group. (C) Representative images of lung cross-sections stained with Alcian Blue/Periodic Schiff (AB/PAS stain). Dashed line boxes indicate visual fields represented in the higher power magnified insets. Asterisk (*) indicates airway lumen. Neutral mucin-containing goblet cells are stained in magenta, and acidic mucin-containing goblet cells are stained in blue. Abbreviations: 6-OHDA, 6-hydroxydopamine; AA-VEH, ascorbic acid vehicle; IL-13, Interleukin 13; M.E: 6-OHDA, main effect of 6-OHDA; M.E: IL-13, main effect of IL-13; SAL, saline.

Airway sympathectomy decreases the transcriptional ratio of Muc5ac to Muc5b.

Given that airway sympathectomy reduced the density of goblet cells containing neutral mucins, we hypothesized that the abundance of key mucins (i.e., Muc5ac, Muc5b, Muc1, Muc2) may be reduced. To test this hypothesis, we measured transcript levels of Muc5ac, Muc5b, Muc1, Muc2 in the lung homogenates by qRT-PCR. As expected, IL-13 increased Muc5ac and Muc5b mRNA in the whole lung homogenate compared to saline-treated mice (Fig. 4A, B). Though 6-OHDA tended to decrease the effect of IL-13 on Muc5ac mRNA, this effects was statistically non-significant (p = 0.1). However, we found that airway sympathectomy with 6-OHDA attenuated the ratio of Muc5ac/Muc5b mRNA in response to IL-13 treatment (p = 0.03 for IL-13 × 6-OHDA interaction, Fig. 4C). To determine whether this change in mRNA ratio translated to differences in Muc5ac and Muc5b protein levels, we also measured their protein levels in the BALF (Fig. 4D–4F). We observed that IL-13 increased Muc5ac protein (Fig. 4D), but not Muc5b (Fig. 4E). Sympathetic nerve depletion with 6-OHDA did not modify BALF levels of Muc5ac or Muc5b in either saline- or IL-13- treated mice. Though IL-13 increased the ratio of Muc5ac/Muc5b in the BALF (Fig. 4F), sympathetic nerve depletion did not statistically alter this ratio. Thus, these data suggest that IL-13 elevates the abundance of the major secreted mucins (Muc5ac, Muc5b) at the transcript level, but only Muc5ac at the protein level. Airway sympathectomy reduced the effect of IL-13 on the mRNA ratio of Muc5ac to Muc5b, but did not alter mucin protein levels.

Figure 4. Effects of IL-13 and 6-OHDA-sympathectomy on airway mucins.

Muc5ac (A) and Muc5b (B) transcripts abundance in whole lung homogenates and the associated ratios (C); protein levels of Muc5ac (D) and Muc5b (E) in BALF and the associated ratios (F); Muc1 (G) and Muc2 (H) transcript abundance in whole lung homogenates. In A, B, D, and F, a significant main effect of IL-13 treatment was observed (M.E: IL-13; p < 0.001). In C, a significant main effect for IL-13 and 6-OHDA treatments (M.E: 6-OHDA; p = 0.0001 and p = 0.02, respectively), as well as an IL-13 × 6-OHDA interaction (p = 0.03) were noted. For all panels, individual points are data collected from a single mouse. n = 5–8 mice/group. Abbreviations: 6-OHDA, 6-hydroxydopamine; AA-VEH, ascorbic acid vehicle; BALF, bronchoalveolar lavage fluid; IL-13, Interleukin 13; M.E: IL-13, main effect of IL-13; SAL, saline.

Muc1, a membrane-bound mucin with context-dependent anti-inflammatory effects (64), is reduced in airway epithelial cells from patients with uncontrolled severe asthma (65). While IL-13 has not been shown to regulate Muc1, we hypothesized a potential regulatory role for airway sympathetic nerves. However, no statistically significant effects of IL-13 or 6-OHDA treatment were observed on Muc1 (Fig. 4G). Muc2, a low-expressing secreted mucin in the respiratory tract, is elevated in patients with eosinophilic asthma (66). Although IL-13 regulation of Muc2 in airway epithelia is unconfirmed, IL-13 has been shown to increase Muc2 expression in colonic epithelial cells (67). We found no effect of IL-13 or 6-OHDA treatment on Muc2 mRNA abundance in lung homogenates (Fig. 4H).

Goblet cell transcription factors and mucin secretion machinery are negligibly regulated by airway sympathectomy.

We assessed transcription levels of two master regulators of goblet cell metaplasia, SPDEF and FOXA2 (68–70). We found a main effect of IL-13 to increase SPDEF mRNA expression in lung homogenates (Fig. 5A) but no effect of 6-OHDA (Fig. 5A). FOXA2 mRNA expression was not impacted by either IL-13 or 6-OHDA (Fig. 5E). These data suggested that 6-OHDA did not influence the mRNA abundance of factors known to regulate the goblet cell metaplasia. We also analyzed the expression of three critical transcripts associated with the mucin secretion machinery. We observed a main effect of IL-13 treatment on mRNA for P2ry2, which controls mucin secretion in response to ATP (71)(Fig. 5C). This finding was consistent with our previous reports (43). We noted a main effect of 6-OHDA to mildly increase mRNA for Rab3D, a critical molecule for the secretion of stored mucin vesicles in goblet cells (72–74) (Fig. 5D). Lastly, we found no effect of either IL-13 or of 6-OHDA to regulate transcript abundance for M3R, a key regulator of mucus secretion under cholinergic stimulation (75)(Fig. 5E).

Figure 5. Expression of key transcripts involved in the goblet cell metaplasia and mucin secretion.

mRNA expression of key transcripts in the whole lung homogenate that regulate goblet cell metaplasia, including Spdef (A) and Foxa2 (B). Transcript abundance for mucin secretion machinery, including P2ry2 (C), Rab3D (D), and M3R (E), in the whole lung homogenate. In A and C, a significant main effect of IL-13 was observed (M.E: IL-13; p = 0.03 and p < 0.0001, respectively). In D, a significant main effect of 6-OHDA treatment was observed (M.E: 6-OHDA; p = 0.03). For all panels, individual points are data collected from a single mouse. n = 5–8 mice/group. Abbreviations: 6-OHDA, 6-hydroxydopamine; AA-VEH, ascorbic acid vehicle; IL-13, Interleukin 13; M.E: 6-OHDA, main effect of 6-OHDA; M.E: IL-13, main effect of IL-13; SAL, saline.

Select inflammatory responses in the lung are modulated by airway sympathectomy.

Our data suggested that some key IL-13-mediated pathologic features were mitigated by airway sympathectomy. Therefore, we sought to determine whether 6-OHDA-mediated airway sympathectomy affected the basic inflammatory response to IL-13. We assessed the percentage of granulocyte cells, including eosinophils and neutrophils, in the BALF (Fig. 6A). As expected by our previous reports (43, 44), a significant main effect of IL-13 treatment was observed to increase total granulocytes (p = 0.002) and eosinophils (p = 0.005). 6-OHDA treatment did not modify the effect of IL-13 on granulocytes nor eosinophils (Fig. 6A). For neutrophils, we observed a statistical trend for the main effect of IL-13 treatment (p = 0.053), suggesting an increase in neutrophils in response to IL-13. We also employed a discovery-driven approach and performed inflammatory-directed PCR arrays on lung homogenates (Fig. 6B and Supplementary Table S2). Our statistical analysis revealed a significant gene x IL-13 × 6-OHDA interaction (Supplementary Table S2). After correcting for false discovery rate (FDR), we curated a list of genes that post hoc comparisons identified as being upregulated in IL-13-treated mice but not in IL-13-treated mice with airway sympathectomy (Fig. 6B). All genes and their p values are available in Supplementary Table S2. We were intrigued by the effect of IL-13 on transcript abundance for interleukin-6 (IL-6), as IL-6 has been implicated in allergic asthma. Thus, we also assessed IL-6 protein levels in BALF (Fig. 6C). However, we did not see a corresponding increase in IL-6 protein levels in BALF. Thus, these data demonstrate that airway sympathectomy reverses the effect of IL-13 on select transcripts important for innate and adaptive immunity. The physiological significance of these genes is described in the discussion.

Figure 6. Inflammatory responses in the lung.

(A) Analysis of cells that were granulocytes, eosinophils, or neutrophils in the bronchioalveolar lavage fluid (BALF) of mice. A two-way ANOVA was performed, and a significant main effect of IL-13 treatment was detected for both granulocytes (M.E: IL-13; p < 0.0017) and eosinophils (M.E: IL-13; p < 0.0017). For neutrophils, a statistical trend for the main effect of IL-13 treatment (p = 0.053) was observed. (B) Heat map of select differentially expressed genes that were mitigated by 6-OHDA in IL-13-treated mice. Scale represents fold change relative to AA-VEH + SAL group. All the multiple comparisons and respective p-values are reported in Supplementary Table S2. (C) Protein levels of IL-6 in BALF. A two-way ANOVA was performed, and no statistically significant differences were found. For panels A and C, individual points are data collected from a single mouse. n = 4–8 mice/group. Abbreviations: 6-OHDA, 6-hydroxydopamine; AA-VEH, ascorbic acid vehicle; BALF, bronchoalveolar lavage fluid; IL-13, Interleukin 13; M.E: IL-13: main effect of IL-13; SAL, saline.

DISCUSSION

Although lung sympathetic innervation has been historically considered sparse (26–28), adrenergic nerves are found along the airways in mice and humans (33). Experimental models have demonstrated that stimulation of sympathetic nerves innervating the lung enhances mucus secretion (16, 76), whereas pharmacological activation of adrenergic receptors increases mucus outflow (15–17). In the present study, we tested the hypothesis that airway sympathetic nerves modulate airway responses to type 2 (IL-13-mediated) inflammation. Our data demonstrated that airway sympathectomy attenuated key features of IL-13-induced airway pathology, including density of neutral mucin-containing goblet cells, the mRNA ratio of Muc5ac to Muc5b, and airway mechanic deficits. Further, airway sympathectomy reversed specific inflammatory signals in IL-13-treated mice important for regulating allergic responses, suggesting a broader impact on inflammatory signaling in the lung.

IL-13 is known to induce airway hyperreactivity, which is an exaggerated narrowing of the airway. We found a statistical trend suggesting that airway sympathectomy may reduce airway resistance. This observation may seem counterintuitive given that β₂AR agonists are used to relax the airway, typically through direct action on the airway smooth muscle. Thus, one might anticipate that elimination of sympathetic nerves would cause greater smooth muscle contraction and enhanced airway narrowing. Therefore, how airway sympathectomy modifies airway resistance remains unknown. We also found a significant effect of airway sympathectomy to reduce airway elastance. Airway elastance is influenced by many factors, including airway smooth muscle tone, cartilage, inflammation, mucus, as well as blood flow. A prior report has shown that the β₂AR agonist salbutamol increases airway elastance in vagotomized mice (77). Therefore, our finding that loss of airway sympathetic nerves reduces airway elastance is consistent with this observation. It is also possible that loss of sympathetic innervation to the airways decreases pulmonary volume loading; a decrease in pulmonary volume loading is expected to decrease airway elastance (78). This speculation merits some consideration, given that abrupt increases in sympathetic tone can precipitate flash pulmonary edema (79). Lastly, we found that airway sympathectomy reduced tissue damping. One possible explanation is that removal of sympathetic nerves diminished increased blood flow due to inflammation within the alveolar compartment. Indeed, it is well established that sympathetic nerves densely innervate blood vessels in the lung (25, 29–32), and that inflammation increases lung blood flow (80, 81). It is also possible that loss of airway sympathetic nerves decreases constriction of pulmonary blood vessels (82), thereby reducing tissue damping. Indeed, in pulmonary hypertension, blood vessels show higher damping coefficients (83), lending support to this speculation.

It is well established that IL-13 enhances Muc5ac (43–48). While we found that 6-OHDA-mediated airway sympathectomy reduced the ratio of Muc5ac to Muc5b mRNA in the total lung, we did not find an effect of airway sympathetic nerves to regulate Muc5ac or Muc5b production at the protein level. However, interestingly, we also found that airway sympathectomy reduced the density of goblet cells containing neutral mucins in mice treated with IL-13. The physiologic significance of this finding lies in the roles of sialylation and sulfation, which give acidic mucins their negative charge (84). This charge promotes mucin expansion and rigidity through repulsion, supporting effective mucociliary clearance (85). In contrast, reduced sialylation leads to increased gel-forming properties and impaired mucus transport (85). While a low-charge form of MUC5B is overrepresented in children with asthma (86), increased sialylation of MUC4 has also been observed in asthmatic airways (87). Therefore, a decrease in goblet cells producing neutral mucins may reflect a shift toward more rigid, less transportable mucus.

We are unsure of the mechanism explaining a reduction in the density of cells containing neutral mucins. One interpretation is that the secretion of goblet cells containing neutral mucins was enhanced by airway sympathectomy. Though we know of no such work to support this statement, we did observe that airway sympathectomy increased Rab3D mRNA, suggesting that goblet cells might have a greater capacity to discharge their cellular contents. However, the increase in Rab3D mRNA was modest and seems unlikely to be the sole mechanism. Our data do not support that there was a global reduction in goblet cell density, given that mRNA for critical goblet cell regulators (e.g., Spdef and Foxa2) were not impacted by airway sympathectomy. Additionally, we observed no changes in the density of cells containing acidic mucins, further suggesting that goblet cell numbers remained stable. However, despite these speculations and interpretations, we still don’t address the selective impact of airway sympathectomy on neutral mucins. Thus, more detailed studies are needed to understand the mechanistic link between airway sympathectomy and neutral mucin abundance and/or secretion mechanisms. Moreover, understanding whether such changes affect mucus rheological properties will be important for assessing their implications in health and disease.

To further investigate how airway sympathetic nerves regulate airway inflammatory responses to IL-13, we also implemented a discovery-driven approach through performing inflammatory-directed PCR arrays. In doing so, we found that airway sympathectomy due to 6-OHDA reversed the IL-13-mediated increase in interleukin 6 (IL-6) mRNA. IL-6 is highly expressed in lung basophils (88). It has been strongly implicated in the pathogenesis of allergic asthma, where it is upregulated (89). Thus, our data suggest that airway sympathectomy with 6-OHDA inhibited the IL-6 mRNA abundance. If the source of IL-6 mRNA was basophils, it seems less likely that airway sympathectomy reduced the number of basophils since our granulocyte counts were similar across mice with and without airway sympathetic nerves. If basophils are the source of IL-6 mRNA, then one interpretation is that basophils are synthesizing less IL-6 mRNA. Indeed, basophils respond to β₂AR agonists and antagonists (90), though direct evidence linking β₂AR activation to IL-6 transcription is lacking. It is also important to note that IL-6 protein levels in BALF remained unchanged across treatment groups in our study. This suggests that other molecular mechanisms might be involved and highlights a disconnect between the impact of IL-13 and airway sympathectomy on IL-6 protein and mRNA abundance. Therefore, the source of the mRNA signal for IL-6 in our studies, and the mechanism by which it is regulated by sympathetic airway nerves, remains to be determined.

Our exploratory analysis of inflammatory molecules also determined that chemical sympathectomy of airway nerves blunted IL-13-mediated increases in mRNA for complement component 3 (C3) and colony stimulating factor 2 (Csf2). C3 is critical for regulating epithelial cell function, with expression found in club cells, goblet cells, fibroblasts, as well as immune and mesenchymal cells (88, 91–94). C3 is a key regulator of allergic responses, with loss of C3 reducing lung eosinophilia in an Aspergillus-sensitization model (95). Csf2, also known as granulocyte-macrophage-colony stimulating factor, propagates allergic inflammatory responses in the airway (96) and promotes Th2 polarization (97). Given that alveolar epithelia are an important source of Csf2 (98), it is possible that sympathetic nerves directly regulate these cells, or that sympathetic nerves regulate other cells that interface with the alveolar epithelia. Additional studies are needed to determine this. Regardless, our studies from the inflammatory arrays highlight novel roles for sympathetic nerves to regulate airway allergic responses.

Our study has limitations. It remains to be determined whether sympathetic nerves directly target airway epithelial cells, including goblet cells, or other lung cell types, such as immune cells. Our observation that TH⁺ nerve fibers are close to the airway epithelium is consistent with previous reports (27, 33) and suggests possible direct regulation of the airway epithelia. The documented expression of β₂ARs in both airway epithelial cells (13, 88, 99) and immune cells (88, 100–102) also suggests that epithelia and immune cells are likely targets. As noted in our introduction, while direct sympathetic innervation of the airway epithelium in humans is limited, adrenergic fibers are present in bronchial glands, vessels, submucosal glands, and smooth muscle (27, 34–36). Given this, the translational relevance of our findings may not lie in direct epithelial innervation but rather in how these innervated structures influence the airway surface through paracrine and neuroimmune mechanisms. Another limitation is that we only studied male mice. Sex differences in airway responses have been reported in mice, as we recently published (43, 44), and in humans (103–106). Thus, future studies to assess the effect of sympathectomy in female mice are needed. Lastly, the receptor subtype(s) and neurotransmitter(s) regulating airway responses to IL-13 remain unknown, as does whether 6-OHDA ablation alters adrenergic receptor expression. Future studies using receptor expression analyses alongside selective adrenergic receptor antagonists, agonists, or genetic knockouts will clarify these mechanisms. While β₂AR is a well-established mediator of sympathetic tone in the airway and regulates mucus production and mucus secretion in multiple species (13–24), other adrenergic receptors are also likely to contribute.

In summary, our study provides novel evidence that airway sympathetic nerves regulate inflammatory responses to IL-13 in mice. Additional investigations may reveal that airway sympathetic nerves are key intervention points for airway diseases, like asthma. Alternatively, our findings may prompt reappraisal of standard of care treatments, such as β₂AR agonists, in some patient populations.

Supplementary Material

Supplemental Figure S1: https://figshare.com/s/e77dabce324344cb28e4

Supplemental Figure S2: https://figshare.com/s/253d6ceadf7ab1188c67

Supplemental Table S1: https://figshare.com/s/3d6ec9b3a3b5a5532ff6

Supplemental Table S2: https://figshare.com/s/dba2297cc7aa14bc0ebe