mRNA expression of DNA methylation machinery genes in periapical granuloma and their potential relationship with periapical wound healing

Abstract

This study was designed to explore the relative expression of DNA methylation machinery genes in periapical granuloma and to assess longitudinal changes in gene expression within the healing group at 6 and 12 months. A total of twenty-seven patients (13 chronic apical periodontitis and 14 chronic apical abscess) underwent surgical endodontic treatment. During surgical endodontic treatment, periapical lesion tissue was collected and used for relative expression analysis of the following DNA methylation machinery genes: DNMT-1, TDG, TET-1, TET-2, and TET-3. These patients were subsequently re-appointed after 6 and 12 months for the evaluation of the periapical healing based on the established clinical and radiographic criteria. Quantitative PCR (qPCR) was employed for gene-expression analysis. Statistical analysis was performed using unpaired t-tests and a p-value < 0.05 was considered statistically significant. Post-operative healing was observed in 21 out of 27 patients (77.8%) after 12 months, whereas 6 patients (22.3%) showed no signs of healing at the end of the follow-up period. A statistically significant difference was observed in the expression of the TET-3 genes in chronic apical abscess. Moreover, TDG, TET-2, and TET-3 exhibited a positive fold change in healed chronic apical abscess samples (H + 12 M and H + 6 M) compared to non-healed (NH) samples. The significant differences in the expression of TET-3 gene, may suggest their potential role as epigenetic markers warranting further validation.

Introduction

The most frequently occurring periapical lesion is periapical granuloma, which consists of a proliferative mass of granulation tissue that forms around the apex of a non-vital tooth in response to pulpal necrosis caused by chronic bacterial infection^1,2. Radiographically, periapical granuloma appears as a unilocular radiolucency surrounding the apex of a necrotic tooth. Histologically, granulation tissue within the lesion consists of a mixed inflammatory infiltrate, including lymphocytes, plasma cells, eosinophils, macrophages, and a small number of neutrophils, along with newly formed blood vessels and nerve fibers³. The spread of bacterial toxins from necrotic pulp through the apical foramina triggers the release of immunoregulatory mediators, neuropeptides, and pro-inflammatory cytokines from host cells, contributing to extracellular matrix (ECM) degradation and periapical bone resorption⁴.

The preferred treatment for periapical lesions is either primary or secondary root canal treatment. However, research indicates that microorganisms can persist in seemingly well-treated teeth, residing within dentinal tubules, apical ramifications, or forming extra-radicular colonies that are difficult to eliminate through conventional non-surgical root canal treatment^5,6. As a result, surgical endodontic treatment becomes a viable alternative for symptomatic, persistent, or enlarging periapical lesions^7,8. The healing process following periapical surgery at the molecular level is influenced by individual genetic variations⁹ and the expression of genes involved in the epigenetic methylation pathway¹⁰. Changes in the expression of specific DNA methylation machinery genes can determine the healing outcome.

DNA methylation, an essential epigenetic regulatory mechanism, is known to modulate gene expression by transcriptional inhibition. Hypomethylation in the promoter region of a gene generally leads to transcriptional activation, whereas hypermethylation causes transcriptional repression⁹. DNA methylation is primarily catalyzed by enzymes from the DNA methyltransferase (DNMT) family. DNMT1 maintains methylation patterns during DNA replication by methylating hemi-methylated CpG sites. Meanwhile, de novo methyltransferases, DNMT3a and DNMT3b, establish new methylation patterns during embryonic development and can methylate both hemi-methylated and unmethylated DNA^11,12,13. Cai et al.¹⁴ reported that DNMT1 plays a protective role against inflammation in dental tissues by inhibiting lipopolysaccharide-induced inflammatory responses in human dental pulp cells and modulating the methylation of genes like IL-6 and TRAF6.

Additionally, thymine DNA glycosylase (TDG), a multifunctional enzyme, plays a crucial role in DNA demethylation, transcriptional regulation, and base excision repair¹⁵. The Ten-Eleven Translocation (TET) enzyme family, including TET1, TET2, and TET3, is also involved in epigenetic gene regulation through active DNA demethylation¹⁶. A study by Rao et al.¹⁷ demonstrated that reducing TET1 expression can disrupt the odontogenic differentiation potential of dental pulp cells, emphasizing the essential role of TET1-mediated DNA demethylation in dental pulp tissue differentiation.

Healing following periapical surgery is influenced by epigenetic mechanisms regulating inflammatory and regenerative responses. Given the potential impact of DNA methylation machinery genes on periapical lesion development and healing, this study aims to investigate the relative expression of DNA methylation machinery genes in periapical granuloma and their potential relationship with periapical wound healing, providing novel insight into molecular predictors of treatment outcome.

Materials and methods

Patient selection

This study was conducted on selected patients who presented to the Department of Operative Dentistry, Dow University of Health Sciences, during the period between November 2017 and October 2019. The study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Review Board of Dow University of Health Sciences, Karachi (Ref: IRB-862/DUHS/Approval/2017/50). Prior to treatment, informed consent was obtained from all participants and in case of minors from a parent and/or legal guardian.

Patients aged between 15 and 57 years diagnosed with chronic apical abscess or chronic apical periodontitis as indicated by the presence of periapical radiolucency with or without clinical sinus tract or swelling in an anterior tooth with a previously failed root canal treatment were included. Additionally, patients with periapical lesions in single-rooted teeth that had undergone trauma before root closure were also eligible. Exclusion criteria included pregnancy, lactation, pre-existing periodontal disease, medically compromised patients taking regular corticosteroids, immunosuppressants, or anti-inflammatory medications, uncontrolled systemic diseases classified as ASA Level III, single-rooted teeth with periapical lesions smaller than 4 mm, and multi-rooted teeth.

Treatment protocol

Initially, 52 patients who met the study’s inclusion criteria were recruited. Conventional re-root canal treatment was performed for all participants, following American Association of Endodontists (AAE) and the European Society of Endodontology (ESE) treatment guidelines^8,18 and recalled after 3 to 6 months for clinical and radiographic evaluation of the periapical healing. All periapical radiographs were taken using paralleling technique. A cone indicator was used and custom made reference marker was placed over the sensor to ensure the constant distance and angle between the X-ray cone and the sensor on every shoot. The reference marker was made by cutting the donut shaped diamond bur (Mani, Tochi-gi, Japan) from the junction between neck and the working end. Patients who showed no signs of healing after conventional retreatment (n = 27) subsequently underwent periapical surgery.

The local anesthesia (lidocaine with epinephrine 1:80,000) was administered, followed by elevation of a full-thickness mucoperiosteal flap. The periapical lesion site was identified, and a bony window was created by removing cortical bone using a small round bur (#2, Mani, Japan) on a slow-speed handpiece. The lesion was excised using curettes (Hilbro, Japan).

Apicoectomy and retrograde cavity preparation were performed using ultrasonic tips (ProUltra, DENTSPLY), and retrograde filling was completed with mineral trioxide aggregate (MTA, ProRoot MTA, DENTSPLY). The flap was repositioned and secured with 3/0 silk sutures (ETHICON). The excised periapical lesion samples were preserved for gene expression and histopathological analysis.

Clinical outcome assessment criteria

The healing of the periapical lesion was assessed on six and twelve months follow-up. The criteria for evaluation included both clinical and radiographic assessment. Clinical healing assessment was based on the absence of signs and symptoms such as pain, sinus tract, swelling, apico-marginal communication, and tenderness to palpation or percussion. Radiographic healing was assessed using Periapical Index. To ensure the accuracy of all radiographs were taken with the paralleling technique, three different examiners then independently evaluated the radiographs and the specific healing score at which two examiners agreed was accepted. The inter-examiner reliability was also calculated using Cohen’s kappa statistics (κ = 0.85).

Tissue processing for histopathological analysis

Histopathological examination confirmed periapical granuloma characterized by inflammatory cells, capillaries, fibroblasts, collagen, and macrophages, with an absence of stratified squamous epithelium lining (Fig. 1).

Fig. 1.

The histopathological image showing periapical granulation tissue (periapical granuloma).

Tissue processing, RNA extraction and cDNA synthesis

Total RNA was extracted from frozen periapical granuloma tissue (15–20 mg) using bead mill homogenization, following the manufacturer’s protocol. RNA yield ranged from 80 to 150 ng/µL (A260/A280 = 1.8–2.0). The tissue was homogenized with 0.4 g of 0.5 mm glass beads in 500 µL RLT Buffer (Qiagen, Hilden, Germany) containing 1% β-mercaptoethanol using an Omni Bead Ruptor 24 (Omni International, Kennesaw, GA, USA). RNA was purified using the RNeasy Mini Kit (Qiagen) and quantified using a Nanodrop spectrophotometer. The extracted RNA was stored at −80 °C until further use.

cDNA synthesis was performed using the M-MLV reverse transcriptase kit (Promega, Madison, WI, USA) according to the manufacturer’s guidelines. 200 ng RNA per reaction was used.

Quantitative polymerase chain reaction for DNA methylation machinery genes

qPCR was performed to quantify the expression levels of DNMT1, TDG, TET1, TET2 and TET3 genes. β-actin and β-globin was used as a housekeeping gene for normalization. The primers used for each gene are listed in Table 1.

Table 1.

Name of target genes and respective primer sets used to quantify mRNA levels in qPCR.

Gene	Forward Primer (5’ to 3’)	Reverse Primer (5’ to 3’)
β-actin	GCGCGGCTACAGCTTCA	CTCCTTAATGTCACGCACGAT
β-globin	ACA CAA CTG TGT TCA CTA GC	CAA CTT CAT CCA CGT TCA CC
DNMT-1	TACCTGGACGACCCTGACCTC	CGTTGGCATCAAAGATGGACA
TET-1	CAGAACCTAAACCACCCGTG	TGCTTCGTAGCGCCATTGTAA
TET-2	GATAGAACCAACCATGTTGAGGG	TGGAGCTTTGTAGCCAGAGGT
TET-3	TCCAGCAACTCCTAGAACTGAG	AGGCCGCTTGAATACTGACTG
TDG	TGAAGCTCCTAATATGGCAGTTG	TTCCACTGGTTGTTTTGGTTCT

qPCR reaction conditions

Each 10 µL qPCR reaction mixture contained the following components: 1 µL cDNA, 0.3 µL (5 pmol/µL) forward and reverse primers each, 3.75 µL nuclease-free water, and 5 µL BrightGreen qPCR Master Mix (ABM, Canada). The qPCR was conducted on a CFX96™ Real-Time PCR System (BIO-RAD, USA) using the following thermal cycling protocol: 2 min at 50 °C, 2 min at 95 °C, 40 cycles of 15 s at 95 °C and 1 min at 60 °C. Melt curve analysis (55–95 °C) was performed at the end of 40 cycles to confirm product specificity.

All reactions were conducted in technical triplicate. The gene expression was determined using the ΔΔCt method¹⁹.

Statistical analysis

Statistical analysis were conducted using IBM SPSS Statistics version 20. An unpaired t-test with Welch’s correction was applied to evaluate significant differences in relative gene expression between the healing (6- and 12-month) and non-healing groups. A p-value of less than 0.05 was considered statistically significant.

Results

A total of 27 patients underwent periapical surgery in this study, with a mean age of 22.81 ± 7.45 years. Among them, 20 were male and 7 were female. Before periapical surgery, more than half of the patients (55.6%) reported symptoms such as pain, swelling, and/or the presence of a sinus tract, while tenderness was observed in 20 patients (741%). Radiographic evaluation using the periapical index (PAI) revealed that all patients had a PAI score of either 4 or 5. A pre-operative diagnosis of chronic apical abscess were established in 14 (51.9%) patients while chronic apical periodontitis in 13 (48.2%) patients.

Postoperatively, healing was observed in 21 out of 27 patients (77.8%) after 12 months (Fig. 2), whereas 6 patients (22.3%) showed no signs of healing at the end of the follow-up period (Table 2).

Fig. 2.

Immediate postoperative and 12-month follow-up periapical radiographs demonstrating periapical healing following surgical endodontic treatment.

Table 2.

Radiographic assessment of patients following periapical surgery using the PAI Index.

Outcome	After 6-Months		After 12-Months
	Frequency	Percentage	Frequency	Percentage
Healing	15	55.6%	21	77.8%
No healing	12	44.5%	6	22.3%

Analysis of relative gene expression of various DNA methylation machinery genes in healing vs. non-healing group with respect to pre-operative diagnosis

The relative expression levels of DNA methyltransferases (DNMT), Thymine DNA glycosylase (TDG), and Ten-eleven translocation methylcytosine dioxygenase (TET) genes were assessed in both healing and non-healing groups associated with chronic apical abscess and chronic apical periodontitis. The relative gene expression of the tested genes in chronic apical abscess showed that TET-3, TDG and DNMT-1 were down-regulated when compared to the 6-month with the non-healing group, however, only TET-3 showed significant difference. It is suggesting that while all three genes may play a role in the healing process, TET-3 is particularly important in distinguishing healers from non-healers. All other genes relative expression were comparable in chronic apical periodontitis (Fig. 3A and B).

Fig. 3 .

(A) Relative gene expression for various genes involved in DNA methylation/demethylation pathways in healing vs. non-healing group diagnosed preoperatively with chronic apical abscess. (B) Relative gene expression for various genes involved in DNA methylation/demethylation pathways in healing vs. non-healing group diagnosed preoperatively with chronic apical periodontitis.

Fold change in gene expression for various genes involved in DNA demethylation and methylation pathways in the healing group at 6 and 12 months

In patients diagnosed with chronic apical abscess, the results showed up-regulation (positive fold change) of all genes except TET-1 of 12-months healer group. In 6-months healing group, we observed positive fold change of TDG, TET-2, TET-3 and DNMT-1 by 17.9, 23.1, 25.1 and 18.7. Meanwhile, in 12-month healing the fold change were somewhat comparable to non-healer group (Fig. 4A).

Fig. 4.

(A) Fold change in the expression of genes associated with DNA methylation and demethylation pathways in the healing group preoperatively diagnosed with chronic apical abscess. (B) Fold change in the expression of genes associated with DNA methylation and demethylation pathways in the healing group preoperatively diagnosed with chronic apical periodontitis.

In patients with pre-operative diagnosis of chronic apical periodontitis, in the 12-months group, all genes showed positive fold change with an approximately 1.4, 0.6, 0.8, 0.6 and 0.1 increase in TDG, TET-1, TET-2, TET-3 and DNMT-1, respectively. In contrast, in the 6 months healing group, the expression pattern was variable. TDG and TET-2 showed down-regulation while TET-1, TET-3 and DNMT-1 was increased by fold of 0.79, 1.3 and 0.1, respectively. (Fig. 4B).

Discussion

This study aimed to assess the relative gene expression of DNA methylation machinery genes including DNMT-1, TDG, TET-1, TET-2, and TET-3 in periapical granulomas and to explore their potential role in periapical wound healing following surgical endodontic treatment. The study finding reveals a statistically significant difference in the expression of the TET-3 gene in chronic apical abscess, suggesting that it may be associated with healing response and a potential epigenetic indicators. Furthermore, a positive fold change was observed in TDG, TET-2, and TET-3 in healed chronic apical abscess (H + 12 M and H + 6 M) compared with non-healed (NH).

DNA methylation plays a critical role in various inflammatory diseases, and disruptions in this process may contribute to inflammatory conditions. DNA methylation is catalyzed by DNA methyltransferases (DNMTs) and is regulated through multiple cellular mechanisms. The three main types of DNMTs; DNMT-1, DNMT-3a, and DNMT-3b. DNMT-1 is primarily responsible for methylating hemi-methylated DNA during replication, particularly during gametogenesis and early embryonic development^12,13,20. However in this study, no significant difference was observed in the expression of DNMT-1 between healed and non-healed chronic apical periodontitis.

TET and TDG enzymes are primarily responsible for DNA demethylation. In this study, TET-3 demonstrated the most notable down-regulation at 6-months, with an approximately − 0.8-fold decrease suggests a potential pro-healing epigenetic role of TET-3. This reduced expression might be involved in inflammation regulation or enhancing the healing resolution phase. Our findings are consistent with the study conducted by Carella et al²¹., reported that TET-3 down-regulation increases the global reductions in 5-hydroxymethylcytosine (5hmC) and promoted pathological outcomes for instance, tumorigenesis in glioblastoma. Similary, recently Du et al.²² conducted a work in fibrotic cardiac tissue and showed that when TET-3 was inhibited, it enhances fibrosis and alters DNA repair. Zhang et al.²³ (2023) has reported that TET-3 is essential for stress response and epithelial regeneration. Collectively, these findings suggests that protective role of TET-3, and its down-regulation in this study may reflect a tightly regulated epigenetic mechanism contributing to the transition from inflammation to repair in chronic apical abscess.

The healing outcomes of periapical surgery were assessed in this study over a one-year follow-up period, provides a reliable preliminary assessment, extended follow-up may better reflect long-term healing dynamics as the presence of residual radiolucency may represent fibrous scars rather than persistent pathology. This is supported by Halse et al.²⁴, who stated that a one-year follow-up is a reliable indicator of treatment prognosis, with only a small percentage of cases requiring additional follow-up. However, Kruse et al.²⁵ argued that one year may be insufficient for a conclusive healing assessment, as factors unrelated to surgical endodontic treatment can influence long-term outcomes. Similarly, Song M et al.²⁶ found no significant difference in healing success rates between six and ten years in a prospective study, where a 93.3% success rate after microsurgical treatment remained stable after five years.

Despite its contributions, this study has certain limitations. First, periapical surgery was performed using a conventional approach rather than a microsurgical technique. The latter offers advantages such as smaller osteotomies, better root apex visualization, improved identification of minor anatomical variations, and preservation of cortical bone and root length with a nearly 90-degree root resection. Second, healing was evaluated using digital periapical radiographs, ensuring consistent imaging conditions through the use of a cone indicator and reference marker. However, as conventional radiographs provide only two-dimensional images, details in the third dimension may have been missed. Cone-beam computed tomography (CBCT) is now considered the standard for assessing periapical healing and could provide a more accurate evaluation. Third, this study focused exclusively on single-rooted anterior teeth, excluding multi-rooted posterior teeth. Fourth, post hoc power analysis (ClinCalc, α = 0.05) indicated that the study achieved 80% power, confirming that the sample size was adequate for detecting medium effects between groups. However, the results should be interpreted with caution, as the relatively small sample size may limit the detection of smaller effect sizes and reduce the generalizability of the findings to larger populations. Finally, while baseline gene expression profiles were recorded at the outset, no additional tissue samples were collected during the healing process to avoid interfering with healing or posing ethical concerns for patients. Future studies with larger cohorts are needed to validate these findings. Longitudinal multi-gene profiling could contribute to the development of personalized endodontic strategies and prognostic molecular markers for periapical healing.

Conclusion

In summary, the significant differences in the expression of TET-3 gene, may suggest their potential role as epigenetic markers. The dynamic changes observed during healing underscore the need for further validation and may eventually contribute to future diagnostic and therapeutic innovations.

Author contributions

M.A.A. and F.N. contributed to conceptualization, formal analysis, investigation of the study, and writing of the manuscript (review and editing).

Funding

This work was supported by the Deanship of Scientific Research, Vice Presidency for Graduate Studies and Scientific Research, King Faisal University, Saudi Arabia [Grant No. KFU 253898].

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.