Abstract
It is essential to identify potential genes and genetic variants associated with growth traits to enhance sheep breeding. Previous studies have suggested that the Rho GTPase-activating protein 24 (ARHGAP24) gene may influence the growth of some animals. However, no association has been established between polymorphisms in the ARHGAP24 gene and sheep growth traits. In this study, single-nucleotide polymorphisms (SNPs) in the ARHGAP24 gene of Hu sheep were detected, and functional SNPs associated with Hu sheep growth traits were identified. Twenty-six SNPs were discovered in Hu sheep. Association analysis revealed NC_056059.1:g.455981A > G was significantly associated with average daily gain from six months to one year of age, while NC_056059.1:g.456083 A > G was significantly associated with average daily gain from weaning to six months of age. The relative fluorescence activity (firefly luciferase and sea kidney luciferase) of haplotype GGGG was significantly lower than that of haplotypes GGAA, AAAA and AAGG. Furthermore, ARHGAP24 mRNA expression in the longissimus dorsi muscle of six-months-old sheep was significantly lower than birth sheep. The results showed that NC_056059.1:g.455981A > G and g NC_056059.1:g.456083A > G of ARHGAP24 gene were related to some growth traits of Hu sheep, and ARHGAP24 mRNA was differentially expressed in longissimus dorsi muscle of Hu sheep at different months of age, which could be used as a candidate gene for molecular marker-assisted selection of Hu sheep.
Keywords: Rho GTPase activating protein 24, association analysis, single-nucleotide polymorphism, haplotype, Hu sheep
Introduction
Hu sheep, a rare breed in China, are native to the Taihu Lake region and are renowned for their uniquely patterned lambskins. As one of the few breeds producing white lambskins, they are known as the ‘soft jewel’ in the international market.1 Sheep are highly adaptable, resistant to coarse feeding, and suitable for captive breeding. They exhibit year-round fertility, excellent maternal care, rapid growth, the ability to reproduce at six months and a lambing rate exceeding 200%. They are characterized by their large size, high meat production and flavourful, nutrient-rich meat. Lamb meat offers several advantages over other meats, including juiciness, low cholesterol and fat, high protein content and reduced odour.2 Despite these qualities, Hu sheep perform significantly differently in meat production compared to foreign meat breeds such as Dupo and German Merino sheep. Therefore, selecting and breeding Hu sheep with improved growth performance and meat production is essential.3–5
Growth traits are economically significant for sheep. Advances in molecular genetics have provided new opportunities to utilize genomics for identifying functional genes. In various species, quantitative trait loci (QTL) mapping and complex trait localization have been widely achieved using SNPs.6 The discovery of abundant SNPs has enhanced our understanding of the relationship between genomic variations and different traits, aided by modern sequencing technologies and bioinformatics tools.7
Rho GTPase-activating protein 24 (ARHGAP24) is a member of the Rho GTPase-activating proteins (Rho-GAPs) family and consists of 748 amino acids.8 Previous studies suggest that the ARHGAP24 gene may influence proliferation, cell-cycle progression, apoptosis, migration and invasion of kidney cancer cells.9,10 Additionally, Uehara et al. demonstrated ARHGAP24’s role in ADP ribosylation factor 6-dependent pseudopod formation in human breast carcinoma cells.11 Hara et al. hypothesized that ARHGAP24 contributes to astrocytoma progression by increasing Rac1 activity.12 The development of paclitaxel resistance has been linked to ARHGAP24 downregulation in lung adenocarcinoma.13,14 Jin et al. reported that CBX3 upregulation promotes pulmonary adenocarcinoma cell growth by suppressing ARHGAP24 and activating Rac1 signaling.15 Overexpression of ARHGAP24 has been shown to regulate cellular function and apoptosis by modulating p53, p21 and Bax, thereby inhibiting colon cancer cell proliferation.8
Several studies have suggested that the ARHGAP24 gene influences animal growth. Five candidate SNPs in ARHGAP24 were associated with average daily gain (ADG) between 30 and 100 kg and days to 100 kg of body weight (D100) in Duroc male pigs.16 Additionally, D100 was associated with a candidate SNP within ARHGAP24 in Yorkshire pigs.1 In Xiangsu hybrid pigs, the g.735313C > T locus in ARHGAP24 was significantly associated with chest and abdominal circumferences.18 Xu et al. suggested that ARHGAP24 polymorphisms may affect animal growth and development.19 In addition, rs335052970 was highlighted as a functional mutation for aggressive behavioural traits that changed the transcriptional activity of the ARHGAP24 gene by affecting the binding of the transcription factor p53.19 Therefore, it is speculated that the SNP of the ARHGAP24 gene is associated with the growth traits of Hu sheep.
No studies have reported associations between ARHGAP24 gene variations and sheep growth traits. This study focused on Hu sheep and selected ARHGAP24 as a candidate gene. SNPs in ARHGAP24 were analysed through direct sequencing of PCR products to assess their association with Hu sheep growth traits. The study also examined expression differences in ARHGAP24 gene during sheep growth, providing a theoretical basis for molecular breeding of mutton Hu sheep.
Materials and methods
All animal-related procedures were reviewed and approved according to the Guidelines for the Care and Use of Animals of the Zhejiang Academy of Agricultural Sciences. The study was approved by the ethics committee of the Zhejiang Academy of Agricultural Sciences, Hangzhou, China (2021ZAASLA18).
Animals, samples collection and DNA extraction
The study involved 308 Hu sheep (ewes) provided by Hangzhou Pangda Agricultural Development Co. The sheep were kept under uniform conditions. Hu sheep were 12 months old and non-pregnant. The experiment was conducted in autumn under a confined housing system. All sheep were managed under identical conditions and fed according to the NY/T 816-2021 Nutrient requirements of meat-type sheep and goat.
A 10 mL jugular blood sample was collected from each sheep, placed in EDTA anticoagulant tubes, and stored at −20 °C. Body weight and size measurements were recorded. Genomic DNA was extracted using TIANamp Blood DNA Kits (Tiangen Biochemical Technology, Beijing, China). After electrophoresis detection, the DNA was stored at −20 °C for further experiments.
Primer design and PCR amplification
Table 1 shows the oligonucleotide primers designed to specifically amplify the ARHGAP24 gene in Hu sheep (Ensembl Accession: 101119904). These primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.
Table 1.
Primers of ARHGAP24 gene PCR amplification.
| Primer name | Primer sequence (5’→3’) | Amplified region | Annealing degree | Amplification length |
|---|---|---|---|---|
| 1F | GCTACATAGGAAAGTCCACCAG | Exon 1 and part of intron 1 | 61 °C | 601 bp |
| 1R | CCTACTGGTTCGCTATGATG | |||
| 2F | CAGGGTAGACAAGTGAACAAAACA | A partial region Intron 1 | 53 °C | 476 bp |
| 2R | GGAAATCATCTGACAATTCTGGC | |||
| 3F | GACACACCTTGGATGTTCACTG | Exon 2 and part of Intron 2 | 59 °C | 665 bp |
| 3R | GAAGTGGTTGGTTGTGAGC | |||
| 4F | CTGGTCTCTGGCTTCTTTG | Intron 8, Exon 9 and 3utr | 61 °C | 747 bp |
| 4R | CTTAACAGTAGCATTATGGGAC |
Polymerase chain reaction (PCR) was performed in a 25 μL reaction mixture containing 1 μL of DNA, 12.5 μL of KOD One™ PCR Master Mix (TOYOBO, Japan), 11.1 μL of double-distilled water, and 0.2 μL of 10 μM forward and reverse primers. The PCR protocol included 35 cycles of denaturation at 98 °C for 10 s, annealing at 61 °C, 53 °C, 59 °C, and 61 °C for 30 s, extension at 68 °C for 30 s, and storage at 4 °C.
PCR product sequencing and sequence analysis
Each sample was amplified using the primers listed in Table 1. Electrophoresis was performed on a 1.5% agarose gel. Samples corresponding to the target band were sent to Anhui General Biological Co. (Anhui, China) for Sanger sequencing using the Thermo Fisher ABI 3730XL system. The forward and reverse Sanger sequence plots for each individual were analysed using Mutation Surveyor 5.02 (Softgenetics, USA) to identify mutation locations and genotype.
Effects of candidate SNPs on gene transcriptional activity
According to the results of association analysis between different genotypes and growth traits of Hu sheep. After organizing the wild-type and mutant haplotype sequences, they were submitted to General Biosystems (Anhui) for full-gene synthesis and subsequent cloning into the pGL4.10 vector. The luciferase expression vector was transfected into porcine kidney cells (PK15). After 24 h, the activity of firefly luciferase and Renilla luciferase was measured using a plate reader and the Dual-Luciferase® Reporter Assay System (Promega, USA). The fluorescence ratio between the two was calculated.
Differential expression of ARHGAP24 gene in longissimus dorsi muscle during the growth of Hu sheep
RNA from longissimus dorsi muscle in brith sheep(0-day), two-months-old sheep and six-month-old sheep was extracted using the RNeasy Plus Universal Mini Kit (QIAGEN, Germany). Reverse transcription was performed with the Polestar initial complementary DNA synthesis kit and genomic DNA removal (Tiosbio, China). KOD SYBR quantitative PCR (qPCR) Mix (TOYOBO, Japan) was used to detect and quantify ARHGAP24 gene mRNA expression in longissimus dorsi muscle. The 18s gene was used as the reference for normalization. The reaction conditions were as follows: 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 10 s. Relevant primer pairs are listed in Table 2.
Table 2.
Primers for qPCR to the detection of ARHGAP24 gene in the longissimus dorsi muscle.
| Primers | Primer sequence (5’→3’) | Annealing degree | Amplification product length |
|---|---|---|---|
| ARHGAP24 | F:GGGGCAGCTACAGAACAAGGAGA | 60 °C | 288 bp |
| R:GTCTGGGCTTTCTCGAGTGCTTCA | |||
| 18s rRNA | F:GACACGGACAGGATTGACAGATT | 267 bp | |
| R:GAGCCAGTCAGTGTAGCGCG |
Data statistics and analysis
Individual SNPs were analysed using Sanger sequencing with Mutation Surveyor 5.02 (SoftGenetics, LLC, State College, PA, USA). Gene frequency, genotype frequency, site heterozygosity (He), and Chi-square (χ2) values for each SNP were calculated using PopGen32 software. The polymorphism information content (PIC) was determined using PIC_Calc 0.6 software.
The ARHGAP24 gene was evaluated using two-way analysis of variance (ANOVA) for relative luciferase activity and reverse transcription-PCR. These analyses were performed with the IBM SPSS Statistics (SPSS, USA). A P-value <0.05 was considered statistically significant. Three biological replicates were conducted for each sample, and The relative quantification of mRNA in 9 samples was performed based on the 2−ΔΔCTmethod.20 Results are presented as mean ± standard deviation. Data plotting was performed using GraphPad Prism 8.0.
Association analysis
The General Linear Model (GLM; SPSS) was used to analyse SNPs associated with body weight and body size traits in Hu sheep. Since all samples were female sheep raised on the same farm under identical feeding and management conditions, field and gender effects were excluded from the data modelling.
A P-value < 0.05 was considered statistically significant.
The model used for analysis was as follows:
In which, Y: the phenotypic values of body size traits and body weight traits;
Xβ: fixed effect of SNP genotype;
e: residual effect;
Result
Single-nucleotide polymorphism (SNP) identification
The PCR product displayed high brightness, a single band, and no nonspecific amplification (Figure 1). The PCR result could be directly sequenced as the actual PCR product matched the expected size of the amplified fragment.
Figure 1.
The results of PCR amplification (M: DNA MarkerDL5000).
A total of 26 mutations were identified in the ARHGAP24 gene of Hu sheep. Sequence analysis revealed two mutations with the first primer pair, 14 mutations with the second pair, two mutations with the third pair, and eight mutations with the fourth pair. These SNPs NC_056059.1: g.413003A > G, NC_056059.1:g.413125A > G,NC_056059.1:g.455808C > T, NC_056059.1:g.455815A > G,NC_056059.1:g.455820A > T, NC_056059.1:g.455847A > G, NC_056059.1:g.455865G > C, NC_056059.1:g.455922 G > A, NC_056059.1:g.455954G > A, NC_056059.1:g.455981A > G, NC_056059.1:g.456017G > A, NC_056059.1:g.456080A > G, NC_056059.1:g.456083A > G, NC_056059.1:g.456100A > G, NC_056059.1:g.456121C > T, and NC_056059.1:g.456146G > A are located in intron 1; NC_056059.1:g.584096T > C and NC_056059.1:g.584117A > G are in intron 2; NC_056059.1:g.886177A > G, NC_056059.1:g.886187A > G, NC_056059.1:g.886296 T > G, and NC_056059.1:g.886342A > G are in intron 8; NC_056059.1:g.886574G > A is in exon 9 (synonymous mutation); NC_056059.1:g.886595G > A and NC_056059.1:g.886625G > A are in the 3′ untranslated region (UTR); and NC_056059.1:g.886709G > A is downstream of the 3′ UTR (Table S1). Sanger sequencing figure in Supplement Figure 1, Figure 2, Figure 3.
Population genetic analysis of SNPs of ARHGAP24
The effective allele number (Ne), average heterozygosity (He), and polymorphism information content (PIC) of the 26 SNP loci are presented in Table S2. Ne ranged from 1.05 to 2.00, with NC_056059.1:g.455847A > G and NC_056059.1:g.455865G > C having the highest values, and NC_056059.1:g.584096 T > C the lowest. The population’s average heterozygosity ranged from 0.04 to 0.50, with NC_056059.1:g.455847A > G, NC_056059.1:g.455865 G > C, and NC_056059.1:g.886342 A > G showing the highest values, and NC_056059.1:g.584096 T > C the lowest.
PIC values were classified as follows: 0.25 < PIC <0.50, moderately polymorphic; and PIC < 0.25, lowly polymorphic21. Eight loci (NC_056059.1:g.413003A > G, NC_056059.1:g.456121C > T, NC_056059.1:g.584096 T > C, gNC_056059.1:g.584117A > G, NC_056059.1:g.886187A > G, NC_056059.1:g.886296T > G, NC_056059.1:g.886574G > A, and NC_056059.1:g.886709 G > A) were lowly polymorphic, while the remaining 18 loci were moderately polymorphic (Table S3).
The results of the Hardy-Weinberg equilibrium test are shown in Table S3. A P < 0.05 indicated a population deviation from equilibrium. According to the χ2 test, the loci NC_056059.1:g.413003A > G, NC_056059.1:g.413125 A > G, NC_056059.1:g.456121C > T, NC_056059.1:g.584096T > C, gNC_056059.1:g.584117A > G, NC_056059.1:g.886177A > G, NC_056059.1:g.886296T > G, NC_056059.1:g.886342A > G, NC_056059.1:g.886574G > A, NC_056059.1:g.886595G > A, NC_056059.1:g.886625G > A, and NC_056059.1:g.886709G > A were in Hardy-Weinberg equilibrium, while the remaining 14 SNPs were not.
Association analysis of ARHGAP24 gene polymorphism with growth traits
Association analysis revealed that NC_056059.1:g.455981A > G was significantly associated with average daily gain from six months to one year of age. The AA and AG genotypes significantly higher than the GG genotype (P < 0.05), while there was no significant difference between the AA and AG genotypes (P > 0.05). The NC_056059.1:g.456083A > G was significantly associated with average daily gain from weaning to six months of age. The GG genotype significantly higher than the AA genotype (P < 0.05), with no significant difference between the AG and GG genotypes (P > 0.05) (Table 3).
Table 3.
Association analysis between the ARHGAP24 gene single nucleotide polymorphisms and growth traits in Hu sheep.
| Loci name | Genetype | Body height (cm) | Circumference(cm) | Birth weight (kg) | Average daily gain before weaning (kg) | Weaning weight (kg) | Average daily gain from weaning to six months of age (kg) | six-month-old weight (kg) | Average daily gain from six months to one year of age (kg) | one-year-old weight (kg) |
|---|---|---|---|---|---|---|---|---|---|---|
| NC_056059.1:g.455981 A > G | AA (191) | 75.03 ± 3.67 | 100.52 ± 7.29 | 3.03 ± 0.46 | 0.35 ± 0.13 | 19.05 ± 2.27 | 0.16 ± 0.02 | 38.09 ± 3.75 | 0.18 ± 0.06a | 64.42 ± 9.96 |
| AG (89) | 74.79 ± 3.20 | 99.93 ± 6.51 | 3.04 ± 0.44 | 0.36 ± 0.14 | 18.69 ± 2.25 | 0.16 ± 0.02 | 38.09 ± 3.63 | 0.18 ± 0.05a | 63.13 ± 8.90 | |
| GG (28) | 73.27 ± 4.09 | 99.35 ± 6.65 | 3.07 ± 0.46 | 0.29 ± 0.09 | 19.59 ± 2.96 | 0.16 ± 0.02 | 38.95 ± 5.20 | 0.15 ± 0.04b | 64.56 ± 9.54 | |
| P | 0.06 | 0.63 | 0.92 | 0.08 | 0.18 | 0.46 | 0.52 | 0.02 | 0.56 | |
| NC_056059.1:g.456083 A > G | AA (219) | 74.71 ± 3.68 | 100.29 ± 6.89 | 3.04 ± 0.45 | 0.34 ± 0.13 | 19.07 ± 2.47 | 0.15 ± 0.02b | 38.07 ± 3.71 | 0.18 ± 0.05 | 64.38 ± 9.06 |
| AG (56) | 74.72 ± 2.99 | 100.21 ± 5.70 | 2.95 ± 0.39 | 0.35 ± 0.14 | 18.55 ± 1.63 | 0.16 ± 0.02ab | 37.82 ± 3.58 | 0.18 ± 0.05 | 63.16 ± 8.82 | |
| GG (33) | 75.59 ± 4.00 | 99.92 ± 9.55 | 3.15 ± 0.54 | 0.36 ± 0.13 | 19.28 ± 2.40 | 0.17 ± 0.03a | 39.44 ± 5.06 | 0.17 ± 0.06 | 63.46 ± 11.71 | |
| P | 0.42 | 0.96 | 0.15 | 0.55 | 0.23 | 0.03 | 0.12 | 0.76 | 0.65 |
Note: Data with the different superscript letters within the same column in the same location are significantly different (P < 0.05).
ARHGAP24 gene transcriptional activity analysis of candidate SNPs
In Hu sheep, NC_056059.1:g.455981A > G was significantly associated with average daily gain from six months to one year of age. The NC_056059.1:g.456083A > G was significantly associated with weight gain from weaning to six-months-old weight. Further in vitro experiments were conducted using the four haplotypes GGAA, GGGG, AAAA, and AAGG of NC_056059.1:g.455981A > G and NC_056059.1:g.456083A > G. Recombinant plasmids were transfected, and measurements were taken after 24 h. The results showed that the relative fluorescence activity of the GGGG haplotype was significantly lower than that of GGAA, AAAA, and AAGG among the four haplotypes (Figure 2).
Figure 2.

The detection results of luciferase activity in different groups.
Notes: Different letters labeled on the bars indicate significant differences (P < 0.05).
Linkage disequilibrium and haplotype block analyses
Haploview software was used to analyse the linkage disequilibrium of all SNP loci and construct haplotypes, as shown in Figure 3. Two significant linkage blocks were identified among the 26 SNP loci. Block 1, formed by NC_056059.1:g.455847A > G and NC_056059.1:g.455954G > A, produced three haplotypes: GG, AG, and AA, with frequencies of 0.507, 0.313, and 0.176, respectively. Block 2, formed by NC_056059.1:g.886342A > G and NC_056059.1:g.886574G > A, produced three haplotypes: AG, GG, and GA, with frequencies of 0.544, 0.314, and 0.318, respectively.
Figure 3.
Linkage disequilibrium analysis ARHGAP24 gene.
Notes: A. SNPs linkage disequilibrium analysis; B. Haplotype module analysis.
Differential expression of ARHGAP24 mRNA in longissimus dorsi muscle during the growth of Hu sheep
The expression of ARHGAP24 mRNA in the longissimus dorsi muscle of six-month-old sheep was significantly lower than birth sheep (Figure 4).
Figure 4.

Detection of ARHGAP24 mRNA at different ages.
Notes: Different letters labelled on the bars indicate significant differences (P < 0.05).
Discussion
The Rho family consists of Ras-related small actin-based Rho GTPases, which act as molecular switches to regulate various cellular functions, including cytoskeletal organization and gene transcription. Rho-GAPs, the most abundant class of Rho GTPase regulators in eukaryotes, are essential for cytoskeletal organization, growth, differentiation, neural development, and synaptic functions.22,23 Recent studies have shown that ARHGAP21 influences body weight and insulin energy metabolism in mice.24–26 Genetic variation can affect the phenotypic traits of animals by altering gene expression and function.27,28
In this study, 26 SNPs were identified in the ARHGAP24 gene of Hu sheep, including g.474408G > A, which was located in exon 9 and classified as a synonymous mutation. Generally, higher polymorphism information content (PIC) indicates greater genetic diversity in a population. Several SNPs, such as NC_056059.1:g.413125A > G, NC_056059.1:g.455808 C > T, NC_056059.1:g.455815A > G, NC_056059.1:g.455820A > T, NC_056059.1:g.455847A > G, NC_056059.1:g.455865G > C, NC_056059.1:g.455922G > A, NC_056059.1:g.455954G > A, NC_056059.1:g.455981 A > G, NC_056059.1:g.456017G > A, NC_056059.1:g.456080 A > G, NC_056059.1:g.456083 A > G, NC_056059.1:g.456100A > G, and NC_056059.1:g.456146 G > A, exhibited moderate polymorphism (0.25 < PIC < 0.50), indicating their selection potential. This suggests that the genetic resources of the population are well-suited for survival and reproduction in the current breeding environment.
Hardy–Weinberg equilibrium assumes a naturally occurring population with completely random mating, and the genetic equilibrium of the population is assessed using a chi-square test. According to the χ2 test results, loci NC_056059.1:g.413003A > G, NC_056059.1:g.413125 A > G, NC_056059.1:g.456121C > T, NC_056059.1:g.584096T > C, NC_056059.1:g.584117A > G, NC_056059.1:g.886177A > G, NC_056059.1:g.886296T > G, NC_056059.1:g.886342A > G, NC_056059.1:g.886574G > A, NC_056059.1:g.886595G > A, NC_056059.1:g.886625G > A, and NC_056059.1:g.886709G > A in the Hu sheep population were in Hardy-Weinberg equilibrium, while the remaining 14 SNPs deviated from equilibrium. Hardy-Weinberg disequilibrium is common in sheep breeding programs focused on production performance and physical traits. The primary cause of such deviations is the excess of homozygotes due to inbreeding.29
Polymorphisms in the ARHGAP24 gene have been shown to influence growth traits in pigs and the progression of chronic hepatitis B virus infection in the Han Chinese population.16,17,30 Previous studies revealed that the g.735313C > T locus in ARHGAP24 is significantly associated with chest and abdominal circumference in Xiangsu hybrid pigs. Individuals with the TT genotype exhibit greater chest and abdominal circumferences than those with the CT genotype.18 ARHGAP24 polymorphisms may affect growth and development.19 In this study, two SNPs, NC_056059.1:g.455981A > G was significantly associated with average daily gain from six months to one year of age, while NC_056059.1:g.456083A > G was significantly associated with average daily gain from weaning to six months of age.
Among the four haplotypes (GGAA, GGGG, AAAA, and AAGG) of NC_056059.1: g.455981A > G and NC_056059.1:g.456083A > G, the relative fluorescence activity of GGGG was significantly lower than that of GGAA, AAAA, and AAGG (P < 0.05). As there was no significant difference between GGAA and AAAA, the first G allele may represent the primary effector gene. These findings suggest that the impact of NC_056059.1:g.455981A > G on transcriptional activity may be greater than that of NC_056059.1:g.456083A > G. Studies have shown that introns can directly and indirectly affect gene expression, mainly by changing splicing patterns and regulatory elements.31 SNP located in introns may influence gene expression, mRNA transport, and mRNA aging, thereby exerting post-transcriptional regulatory effects.32 Further research could focus on elucidating the molecular mechanisms by which the ARHGAP24 gene regulates developmental traits in Hu sheep.
We concluded that ARHGAP24 gene mutations are associated with Hu sheep growth traits based on prior association analyses and our data. Thus, ARHGAP24 can be considered a candidate gene for growth traits in Hu sheep. Therefore, variations in the expression of candidate genes in the longissimus dorsi muscle were examined. Expression levels of ARHGAP24 in six-month-old sheep were significantly lower than in brith sheep, that ARHGAP24 may involved in the development of skeletal muscles. Consequently, the ARHGAP24 gene could serve as a molecular marker for marker-assisted selection in sheep breeding, reducing the breeding cycle and advancing sheep industry development.
This study was limited to exon 1, part of intron 1, exon 2, part of intron 2, intron 8, exon 9, and the 3′ UTR. Therefore, detecting and analyzing SNPs in other regions of the ARHGAP24 gene may help uncover its polymorphisms and precise effects.
Conclusions
This study used Hu sheep as experimental material and selected ARHGAP24 as a candidate gene. SNPs were screened using direct sequencing and sequence analysis. Two SNPs, NC_056059.1:g.455981A > G and NC_056059.1:g.456083A > G, were significantly associated with Hu sheep growth traits. The transcriptional activity of the candidate SNPs was analysed using a dual-luciferase assay. The results suggest that these SNPs could serve as important molecular markers for growth traits in sheep. This study provides novel insights into the genetic functions of ARHGAP24 in Hu sheep.
Supplementary Material
Acknowledgements
The authors thank China Hangzhou Giant Agricultural Development Co., Ltd. for support.
Funding Statement
This work was supported by Zhejiang Science and Technology Major Program on Agricultural New Variety Breeding (2021C02068-6), Zhejiang Provincial Agricultural Major Technology Collaborative Promotion Program (2023ZDXT16-3) and Huzhou Key Research and Development Project (2021ZD2035)
Author contributions
Huili Shan: Contributed to formal analysis, soffware implementation, investigation, and original draff writing;Liangyong Guo: Participated in formal analysis, and investigative efforts; Xin Huang and Xiaowei Zhang: Investigative efforts; Yongqing Jiang:Exercised supervision over the project; Sangang He: project administration, reviewing and editing the manuscript; Junfang Jiang:Engaging in conceptualization, validation, funding acquisition, project administration, and participated in reviewing and editing the manuscript.
Disclosure statement
No potential conflict of interest was reported by the author(s).
Data availability statement
Data included in article/supplementary material in article.
References
- 1.Hongye Y. Experiment on factors affecting feed intake of Hu sheep. Heilongjiang Animal Science and Veterinary. 2017;3:144–146. [Google Scholar]
- 2.Hongzhuang L. Prospects for the development of lake sheep farming southward. Zhejiang Animal Husbandry and Veterinary Medicine. 2013;38:1. [Google Scholar]
- 3.Zhu Wanbin JJ, Lei Z, Zhongming M, Lei G, Xiaolan L, Yong Z.. Comparative analysis and research of meat production performance of EastFriensian milk sheep, Hu sheep, and their hybrid offspring. J Anim Husbandry Vet Med. 2022;41:9–14. [Google Scholar]
- 4.Zhang Zhihong ZG, Li H, Jiangli H, et al. Study on fattening performance and biochemical indexes, immune level of hybrid progeny F1 and F2 of Hu sheep × Dorper sheep. China Herbivore Science. 2020;40:23–27. [Google Scholar]
- 5.Jiang Liege LY, Yaping J, Haitao Z, Beiliang C.. Comparison of the main production performance of German Merino sheep with Chinese Merino sheep. Herbivore Science China. 2013;66:78–79. [Google Scholar]
- 6.Daw EW, Heath SC, Lu Y.. Single-nucleotide polymorphism versus microsatellite markers in a combined linkage and segregation analysis of a quantitative trait. BMC Genet. 2005;6(Suppl 1):S32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Zhang L, Ma X, Xuan J, et al. Identification of MEF2B and TRHDE gene polymorphisms related to growth traits in a new Ujumqin sheep population. PLoS One. 2016;11(7):e0159504. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhang S, Sui L, Zhuang J, et al. ARHGAP24 regulates cell ability and apoptosis of colorectal cancer cells via the regulation of P53. Oncol Lett. 2018;16(3):3517–3524. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wang L, Wei WQ, Wu ZY, Wang GC.. MicroRNA-590-5p regulates cell viability, apoptosis, migration and invasion of renal cell carcinoma cell lines through targeting ARHGAP24. Mol Biosyst. 2017;13(12):2564–2573. [DOI] [PubMed] [Google Scholar]
- 10.Xu G, Lu X, Huang T, Fan J.. ARHGAP24 inhibits cell cycle progression, induces apoptosis and suppresses invasion in renal cell carcinoma. Oncotarget. 2016;7(32):51829–51839. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 11.Uehara S, Saito K, Asami H, Ohta Y.. Role of ARHGAP24 in ADP ribosylation factor 6 (ARF6)-dependent pseudopod formation in human breast carcinoma cells. Anticancer Res. 2017;37(9):4837–4844. [DOI] [PubMed] [Google Scholar]
- 12.Hara A, Hashimura M, Tsutsumi K, et al. The role of FilGAP, a Rac-specific Rho-GTPase-activating protein, in tumor progression and behavior of astrocytomas. Cancer Med. 2016;5(12):3412–3425. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Zhang Y, Zhao W, Zhang J.. Comprehensive epigenetic analysis of the signature genes in lung adenocarcinoma. Epigenomics. 2017;9(9):1161–1173. [DOI] [PubMed] [Google Scholar]
- 14.Kashkin KN, Musatkina EA, Komelkov AV, et al. Genes potentially associated with resistance of lung cancer cells to paclitaxel. Dokl Biochem Biophys. 2011;437(1):105–108. [DOI] [PubMed] [Google Scholar]
- 15.Jin X, Zhang B, Zhang H, Yu H.. Smoking-associated upregulation of CBX3 suppresses ARHGAP24 expression to activate Rac1 signaling and promote tumor progression in lung adenocarcinoma. Oncogene. 2022;41(4):538–549. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Wang K, Liu D, Hernandez-Sanchez J, et al. Genome wide association analysis reveals new production trait genes in a male duroc population. PLoS One. 2015;10(9):e0139207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Meng Q, Wang K, Liu X, et al. Identification of growth trait related genes in a Yorkshire purebred pig population by genome-wide association studies. Asian-Australas J Anim Sci. 2017;30(4):462–469. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Chuanmei J, Ruan Y, Jifeng L, et al. SNP detection of ARHGAP24 gene and correlation analysis of GrowthTraits in Xiangsu Hybrid Pigs (Sus scrofa). J Agricult Biotechnol. 2024;32:833–842. [Google Scholar]
- 19.Xu Q, Zhao J, Guo Y, Liu M, Schinckel AP, Zhou B.. A single-nucleotide polymorphism in the promoter of porcine ARHGAP24 gene regulates aggressive behavior of weaned pigs after mixing by affecting the binding of transcription factor p53. Front Cell Dev Biol. 2022;10:839583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Livak KJ, Schmittgen TD.. Analysis of relative gene expression data using real-time quantitative PCR and the 2 − ΔΔCT method. Methods. 2001;25(4):402–408. [DOI] [PubMed] [Google Scholar]
- 21.Sun Y, Xu C, Yang Z, et al. The polymorphism of bovine Cofilin-1 gene sequence variants and association analysis with growth traits in Qinchuan cattle. Anim Biotechnol. 2022;33(1):63–69. [DOI] [PubMed] [Google Scholar]
- 22.Moon SY, Zheng Y.. Rho GTPase-activating proteins in cell regulation. Trends Cell Biol. 2003;13(1):13–22. [DOI] [PubMed] [Google Scholar]
- 23.Hodge RG, Ridley AJ.. Regulating Rho GTPases and their regulators. Nat Rev Mol Cell Biol. 2016;17(8):496–510. [DOI] [PubMed] [Google Scholar]
- 24.Soares GM, Zangerolamo L, Costa-Júnior JM, et al. Whole-body ARHGAP21-deficiency improves energetic homeostasis in lean and obese mice. Front Endocrinol (Lausanne). 2019;10:338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Soares GM, Zangerolamo L, Azevedo EG, et al. Whole body ARHGAP21 reduction improves glucose homeostasis in high-fat diet obese mice. J Cell Physiol. 2018;233(9):7112–7119. [DOI] [PubMed] [Google Scholar]
- 26.Zangerolamo L, Soares GM, Vettorazzi JF, et al. ARHGAP21 deficiency impairs hepatic lipid metabolism and improves insulin signaling in lean and obese mice. Can J Physiol Pharmacol. 2019;97(11):1018–1027. [DOI] [PubMed] [Google Scholar]
- 27.Wyszyńska-Koko J, Pierzchała M, Flisikowski K, Kamyczek M, Rózycki M, Kurył J.. Polymorphisms in coding and regulatory regions of the porcine MYF6 and MYOG genes and expression of the MYF6 gene in m. longissimus dorsi versus productive traits in pigs. J Appl Genet. 2006;47(2):131–138. [DOI] [PubMed] [Google Scholar]
- 28.Bonafè M, Barbieri M, Marchegiani F, et al. Polymorphic variants of insulin-like growth factor I (IGF-I) receptor and phosphoinositide 3-kinase genes affect IGF-I plasma levels and human longevity: cues for an evolutionarily conserved mechanism of life span control. J Clin Endocrinol Metab. 2003;88(7):3299–3304. [DOI] [PubMed] [Google Scholar]
- 29.Sun G, Salomon B.. Microsatellite variability and heterozygote deficiency in the arctic-alpine Alaskan wheatgrass (Elymus alaskanus) complex. Genome. 2003;46(5):729–737. [DOI] [PubMed] [Google Scholar]
- 30.Liu L, Yao J, Li J, et al. Effects of variant rs346473 in ARHGAP24 gene on disease progression of HBV infection in Han Chinese population. J Huazhong Univ Sci Technolog Med Sci. 2011;31(4):482–487. [DOI] [PubMed] [Google Scholar]
- 31.Rose AB. Intron-mediated regulation of gene expression. Curr Top Microbiol Immunol. 2008;326:277–290. [DOI] [PubMed] [Google Scholar]
- 32.Nott A, Meislin SH, Moore MJ.. A quantitative analysis of intron effects on mammalian gene expression. RNA. 2003;9(5):607–617. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data included in article/supplementary material in article.


