Skip to main content
Animal Biotechnology logoLink to Animal Biotechnology
. 2024 Sep 2;35(1):2391520. doi: 10.1080/10495398.2024.2391520

Overexpression of miRNA29a gene inhibits proliferation and promotes apoptosis of jejunal epithelial cells in yak

Jianlei Jia a,b, Erwei Zuo c, Ning Li a, Siyuan Kong c, Pengjia Bao a, Qian Chen b, Ping Yan a,
PMCID: PMC12674364  PMID: 39222080

Abstract

MicroRNAs (miRNAs) were identified to be involved in various biological functions by regulating the degradation or suppressing the translation of their downstream target genes. Recent studies have identified miR-29a play a key role in functions of mammal cell differentiation, proliferation, apoptosis, and signal transduction. However, the underlying functions for miR-29a in jejunal epithelial cells biological function still to be investigated. In order to explore the yak jejunal epithelial cells proliferation and barrier dysfunction with over expression of miR-29a gene, three 0-day-old Pamir male yaks were randomly selected and slaughtered in present study, and the jejunal epithelial cells were isolated and cultured to determine yak jejunal epithelial cells proliferation and protein composition on differential expression of miR-29a gene in Pamir plateau. Here, we demonstrated that the overexpression of miR-29a gene could inhibit the proliferation of Pamir yaks jejunum epithelial cells, and contribute to the apoptosis of Pamir yaks jejunal epithelial cells with some extent. A total of 133 differentially expressed proteins were identified in different expression of miR-29a groups by label-free Mass Spectrometry (MS), which could be concluded to two predominant themes: cell proliferation and inflammatory response. Interestingly, GPR41, as a bridge protein, was contacted two predominant themes to involved in Pamir Yaks jejunal mechanical barrier PPI network, and the target proteins displayed strong mutual interactions in the complex PPI network. Overall, our study suggested that the over-expression miR-29a inhibited the jejunal epithelial cells proliferation and the expressions of specific proteins, which damaged jejunal barrier function to slow down the intestine structure and function advanced mature development during young livestock period for influence the enhanced performance of production efficiency.

Keywords: miR-29a, Pamir yaks, jejunal epithelial cells, cells proliferation and apoptosis, proteomics

Introduction

The Yak living environment is mainly in the plateau areas, such as the Pamir Plateau, the Qinghai-Tibet Plateau and Yungui Plateau, which areas are known for its extremely harsh conditions, characterized by high altitude, severe cold and pasture resource scarcity, and herbage and nutrients are insufficient to support the young livestock growth, especially when raised under traditional grazing management in cold season.1 Therefore, intestine structure and function advanced mature development during young livestock period is needed for the enhanced performance of production efficiency. The Pamir Yak (Bos grunniens) mainly lives above an altitude of 3000 meters in the Pamir plateau and develops a dogged anti-adversity ability to exist and produce during the long period of natural selection artificial domestication.2 Intestine is the main organ for dietary nutrition digestion, absorption and metabolism, and gut health plays a vital role in nutritive absorption and healthy cultivation of juvenile ruminants. The intestine mature development is an important way for young livestock to perfect immune function and maintain body health.3 Epithelial cells are the basic units of intestine structure and function, which are the most important digestive absorption cells in mammalian, and play an important role in intestinal nutrition absorption and immune regulation in young livestock. The Yak extent of enterocyte development identified the ability of dietary nutrients digestion and absorption. The integrity of epithelial cells and their tight junctions are the cornerstone for maintaining intestinal structure and functional stability. The proliferation and differentiation of mammal intestine epithelial cells are the guarantee of intestinal barrier function maturity, early weaning, growth and development, which is regulated by many factors.

miRNAs are a family of endogenous single-stranded noncoding small molecules, which contains about 19-25 nucleotides with highly conserved, time-ordered, and tissue-specific, which are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs.4 To date, various miRNAs have been reported to regulate the biology of apoptosis, such as MicroRNAs (miRNAs) bind to the 3′ UTRs of target mRNAs to negatively regulate gene expression. miR-29, as a kind of miRNAs, widely exists in animals, plants and microorganisms, and is closely related to the regulatory functions of mammal physiology processes, which had been shown to play a key role in various biological processes of targets the transcription or translation, regulates cell differentiation and proliferation.5 miR-29a is a kind of the miR-29 family, mainly distributed in the cytoplasm, which participates in the regulation of cell differentiation, proliferation, apoptosis, and metastasis. Some researchers had confirmed that miR-29a could promote the JNK signaling pathway, mTOR signaling pathway and p38-MAPK signaling pathway, inhibit ERK1/2 signaling pathways to inhibit the proliferation of cells. The upregulated miR-29a gene directly regulates G6Pase or Dnmt3a and goblet cell numbers, ultimately mitigating the damage to gut and liver tissues caused by age and high-fat diets that lead to metabolic disorders.6 Meantime, miR-29a is able to silence some potential genes, which regulates the cells biological activity, such as miR-29a expression repression targets up the expression of genes such as Bcl-2 and Mcl-1 to promote the apoptosis of macrophages, miR-29a is involved in the pathogenesis of the etiology of ulcerative colitis by regulating intestinal epithelial apoptosis via Mcl-1.7 miRNA-29a has been reported to be involved in the regulation of intestinal permeability and epithelial barrier function, and inhibiting miR-29a gene expression could increase the ZO-1 gene and CLDN1 gene expression in intestinal mucosal barrier function, thus increasing the integrity of intestinal epithelials.8

The interaction between miRNAs and functional gene produced a complex regulatory network and were closely involved in regulating cell proliferation and differentiation processes. Studies had shown that the occurrence of various reproductive physiological conditions in the body was associated with abnormal expression of miRNAs. miRNAs research focused on intestinal cancer, inflammatory diseases, irritable bowel syndrome, and was relatively less on regulating intestinal development in mammals. Here, we intend to study the effects of over-expression and interference with miR-29a on jejunal epithelial proliferation, proteome differential expression and target genes expression via 0-day-old Pamir yak intestinal epithelial cells in order to provide theoretical evidence for the study of miR-29a to inhibit the proliferation of intestinal epithelial in Pamir yaks. Meanwhile, this study laid a technical foundation in yak organism health associated with dietary structure.

Material methods

Ethics statement

All procedures involving the use of animals were approved by the Animal Care Committee of Institute of Institute of Western Agriculture, the Chinese Academy of Agricultural sciences, China (CAAS-IWA-2020-115). Animal slaughtering was approved by the National Administration of Cattle Slaughtering and Quarantine regulations (Xinjiang, China).

Jejunal cells isolation and culture

According to the Experimental Animal Operation Manual, the jejunal tissue (4 cm) were separated immediately after the slaughter of the newborn Pamir yaks and was placed in a medium containing three times the volume of penicillin (100 U/ml) and streptomycin (0.1 mg/ml) after removing the intestinal membrane. The tissue was cut into <1 mm3 after washing using PBS, and transferred to serum-free DMEM/F12 culture medium for suspension, and the yak jejunal tissues were digestted by the mixed digestive fluids of streptokinase E, collagenase IV and dithiothreitol, 1000 r/min centrifugal 5 min add 10% FBS DMEM/F12 full culture medium for suspension, and transfer to 96-hole cell culture plate, put in 37 °C, 5% CO2 incubator for culture. Yak jejunum epithelial cells were purified by differential digestion and differential adhesion method,9 then Alkaline phosphatase was used as a marker of intestinal epithelial cells for staining and identification of yak jejunum epithelial cells. All the cells culture medium was removed after cells proliferation of 90% culture plates, 0.05% trypsin was added and digested for 5 min, and the 5% serum DMEM/F12 was added to terminate digestion. Then the samples were centrifuged by 1000r/min for 8 min, and the cell density was adjusted to 50 cells/mL with 5% serum DMEM/F12.

Yak miR-29a-3p mimics and inhibitor transfection

Knock down (inhibitor miR-29a) and overexpression (mimics miR-29a) of miR-29a-3p Small interfering RNA (siRNA) were outsourced to Genomeditech. The empty vector was applied for control group (NC). Mimics, inhibitor and empty vector were supplied by Sangon Biotech (Shanghai) Co., Ltd (Bos taurus, Gene ID: 790973). All primers sequence informations were presented in Table 1. At a density of 2 × 105 cells/well, the cells were plated in 6-well plates 24h before transfection and were transfected at 70%-80% confluency. Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific. Inc.) with 5 pg/sample (empty vector, miR-29a inhibitor and miR-29a mimics) was use for transfection in jejunum epithelial cells at room temperature overnight, with the density of 1 × 104/ml. The efficiency of knockdown and over-expression assay was assessed via RT-qPCR detection. And cells were collected at 24h post-transfection for subsequent experiments. Cellular growth curve were determined and mapped by cell count method, Apoptosis ratio was detected using flow cytometry.

Table 1.

The miR-29a primers sequence informations.

The sequence information of mimics and inhibitor of miR-29a
mimics miR-29a Sense: CUAGCACCAUCUGAAAUCGGUUA
Antisense: UAACCGAUUUCAGAUGGUGCUAG
inhibitor miR-29a Sense: CUGAACACCAAAAGAAAUCAGU
Antisense: CAGUACUUUUGUGUAGUACAA
Primer sequence information
mimics miR-29a F: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGAAC
R: GCGCACTGATTTCTTTTGGT
NC F: CCAGTGCAGGGTCCGAGGTATTCGTGCAGGGTCCGAG
R: GTGCAGGGTCCGAGGT
inhibitor miR-29a F: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAACCG
R: CGCCTAGCACCATCTGAAAT

Proteomics measurement of samples

The separated jejunal epithelial cells were conserved at −80 °C ultracold storage freezer for proteomics analysis. Proteomics analysis was conducted by shanghai Majorbio Biopharm Technology (SMBPT) Co. Ltd (China, Shanghai). There were 6 replicates in each group. The cells proteins were extracted by lysis buffer method.10 Digestion of the protein (250 μg for each sample) was performed according to the FASP procedure. Label-free Mass Spectrometry (MS) experiments were performed on a Q Exactive mass spectrometer that was coupled to an Easy nLC system (Thermo Fisher Scientific, MA, USA). The MS data were analyzed using MaxQuant software (Max Planck Institute of Biochemistry, Germany) and compared with the UniProt (https://www.uniprot.org/) Bos taurus database.

Statistical analysis

The data were expressed as mean ± standard deviation (SD). Duncan’s post hoc test was used to determine any significant differences between each group. Differences were considered significant at P < 0.05 and extremely significant at P < 0.01.

Bioinformatics was analyzed by Jia’s method. DPEs were used for Cluster analysis via CD-HIT (http://www.bioinformatics.org/cd-hit/). Functional annotation and classification of all identified proteins were determined using the Blast2GO program against the uniport database. Pathway analyses were extracted using the search pathway tool of the KEGG mapper platform (http://www.genome.jp/kegg/mapper.html). Pathway enrichment statistics were conducted by the Fisher’s exact test, and the pathways with a corrected P < 0.05 were defined as the most significant pathways. The STRING program (http://string-db.org/) for the retrieval of interacting genes/proteins database for the prediction of the physical and functional interactions was used to analyze the PPI network.

Results

The efficiency of miR-29a Synthetic(mimics and inhibitor) on cell transfection

The synthetic of miR-29a-3p mimics and inhibitor were transfected into Pamir yaks jejunal epithelial cells, and collected the target cells after transfected 48h. The total RNA was extracted by Trizol method (Fig. 1), reverse-transcribed into cDNA, and performed by RT-qPCR (Fig. 2, GAPDH and ACTB as internal parameters). The results showed that the miR-29a mimics could significantly increase the miR-29a expression level of Pamir yaks jejunal epithelial cells, and miR-29a inhibitor could significantly decrease the miR-29a expression level (P < 0.01).

Figure 1.

Figure 1.

The total RNA of pamir yaks jejunum epithelial cells with miR-29a Synthetic(mimics and inhibitor).

Note. 1-2 lines were the mimics miR-29a group, 3 line was the NC group, 4-5 lines were inhibitor miR-29a group.

Figure 2.

Figure 2.

The expression level of pamir yaks jejunum epithelial cells with miR-29a Synthetic(mimics and inhibitor).

The effects of miR-29a Synthetic(mimics and inhibitor) on jejunum epithelial proliferation

The synthetic of miR-29a-3p mimics and inhibitor were transfected into Pamir yaks jejunum epithelial cells, and cellular growth curve were determined and mapped by cell count method (Fig. 3). The results showed that all group cells began with lepidic growth after the first day of cell transfection, and then cells entered the logarithmic growth period with day 3-6. The cell proliferation of NC group and inhibitor miR-29a group was basically at a standstill after transfection of day 6-8, while that in mimics miR-29a group was at a standstill after transfection of 6th day, and the cells showed an apoptosis tendency in day 7-8. Starting with day 4, the cell counts of mimics miR-29a group were significantly less than that in the mimics miR-29a group and NC group (P < 0.05), it indicated that overexpression miR-29a gene could inhibit the proliferation of Pamir yaks jejunum epithelial cells.

Figure 3.

Figure 3.

Proliferation curve of pamir yaks jejunum epithelial cells with miR-29a Synthetic(mimics and inhibitor).

The effects of miR-29a Synthetic(mimics and inhibitor) on jejunal epithelial apoptosis

The synthetic of miR-29a-3p mimics and inhibitor were transfected into Pamir yaks jejunum epithelial cells, and the rate of jejunum epithelial apoptosis was analyzed by flow cytometry after 48h transfection (Fig. 4a, b). The results showed that the early apoptosis rate in NC group was 10.64%, and the late apoptosis rate was 22.46%. The early apoptosis rate in inhibitor miR-29a group was 3.59%, and the late apoptosis rate was 11.13%. The early apoptosis rate in mimics miR-29a group was 19.42%, and the late apoptosis rate was 28.31%. There was a significant decrease in vital cell quantity of the mimics miR-29a group (P < 0.05), The early apoptosis rate and late apoptosis rate were significantly greater than that of the NC group and inhibitor miR-29a group (P < 0.01), which indicated that overexpression miR-29a gene expression could contribute to accelerate apoptosis of Pamir yaks jejunum epithelial cells. The vital cell quantity in inhibitor miR-29a group was lower than that of NC, and the apoptosis rate increased compared to the NC group (early and late stage, P = 0.094), it suggest that Knock down miR-29a gene could inhibit the apoptosis of Pamir yaks jejunum epithelial cells with some extent.

Figure 4.

Figure 4.

a. The apoptosis rate of pamir yaks jejunum epithelial cells with miR-29a Synthetic(mimics and inhibitor). b. The apoptosis rate statistics of pamir yaks jejunum epithelial cells with miR-29a Synthetic(mimics and inhibitor).

Changes in proteome profiles of miR-29a Syntheti (mimics and inhibitor) transfection systems

Principal component analysis (PCA) with the help of weighted unifrac similarity method demonstrated that the PC1 and PC2 expounded 31.63% and 13.28% of the disparity between the samples, respectively. The jejunal epithelial cells during NC group, mimics miR-29a group and inhibitor miR-29a group formed different clusters in the ordination space. This suggested that the different miR-29a transfection system had sensitive effects to the proteins expression of Pamir Yaks’ jejunal epithelial cells (Fig. 5). A total of 133 differentially expressed proteins were identified during NC group, mimics miR-29a group and inhibitor miR-29a group using P < 0.05 and a quantitative ratio of > 2 or < 0.5. There were 61 up-regulated and 59 down-regulated differentially expressed proteins in the mimics miR-29a group compared to that in NC group, and there were 72 up-regulated and 61 down-regulated differentially expressed proteins in the inhibitor miR-29a group compared to that in NC group (Fig. 6).

Figure 5.

Figure 5.

Jejunal epithelial cells differential expression proteins PCA analysis.

Note: Red area was mimics miR-29a group (C1-C6), blue area was NC group (V1-V6), and green area was inhibitor miR-29a group (T1-T6).

Figure 6.

Figure 6.

Differentially expressed proteins, including 6 replicates with jejunal epithelial cells during NC group, mimics miR-29a group and inhibitor miR-29a group. The image presents the relative abundance of proteins using different colors, where deeper red represents higher intensity and blue represents lower intensity.

Bioinformatics analyses

To explore biological functions associated with differentially expressed proteins of jejunal epithelial cells during NC group, mimics miR-29a group and inhibitor miR-29a group, enrichment analysis in the Gene Ontology (GO) containing cellular components (CC), molecular function (MF) and biological process (BP) was performed (Fig. 7). The major enriched terms of differentially expressed proteins were chromatin (GO:0000785), nucleosome (GO:0000786), mitochondrial membrane (GO:0031966) and MHC protein complex (GO:0042611; GO:0042613) for CC. MF enriched terms were molecular function in DNA binding (GO:0003677), ATP binding (GO:0005524), transferase activity (GO:0016757), nucleotidyltransferase activity (GO:0016779), ATPase activity (GO:0042623) and transmembrane transporter activity (GO:0022857). I-kappaB kinase/NF-kappaB signaling (GO:0007249), Wnt signaling pathway (GO:0030111), ATP synthesis coupled proton transport (GO:0015986), immune response (GO:0006955) and regulation of signaling (GO:0023051), which were enriched in BP.

Figure 7.

Figure 7.

Jejunal epithelial cells differential expression proteins GO analysis.

The major pathways associated with differentially expressed proteins of jejunal epithelial cells during NC group, mimics miR-29a group and inhibitor miR-29a group were identified using KEGG pathway analysis via KAAS software. A total of 150 differentially expressed proteins across 20 pathways were enrichment (Fig. 8). The major pathways associated with differentially expressed proteins of intestine epithelial cells during NC group, mimics miR-29a group and inhibitor miR-29a group were identified using KEGG pathway analysis via KAAS program. A total of 150 differentially expressed proteins across 16 pathways were significantly enriched (P < 0.05). The significantly enriched pathways were Intestinal immune network for IgA production (ko04672), MAPK signaling pathway (ko04010), Apoptosis (ko04210), NF-kappa B signaling pathway (ko04064), RNA polymerase (ko03020) and Th1 and Th2 cell differentiation (ko046580, Fig. 9).

Figure 8.

Figure 8.

Jejunal epithelial cells differential expression proteins KEGG pathways analysis.

Figure 9.

Figure 9.

Jejunal epithelial cells differential expression proteins enrichment KEGG pathways analysis (fisher’s exact test, P value < 0.05).

Note: The green zone was Inflammatory Response pathways; The red zone was Cell Proliferation pathways. All tag areas denote significance (P < 0.05) among NC group, mimics miR-29a group and inhibitor miR-29a group.

Protein-protein interaction network among the 133 proteins were analyzed via STRING program. The results identified two predominant themes: cell proliferation proteins (ERK1, ERK2, Bcl-2, Mcl-1, LAMB1 and CTNND2) and inflammatory response proteins (RXRA, IL-6, TNF-α and IL2RA) constituted a complex and strong PPi network (Fig. 10). Moreover, interestingly, GPR41, as a bridge prtein, was contacted two predominant themes to involved in Pamir Yaks jejunal mechanical barrier PPI network, and the target proteins displayed different mutual interections with other pathways in the complex PPI network. Therefore, based on these experimental results, we predicted that these target proteins could be regarded as important for intestinal structure, physiological function and protein composition, and the importance signal transduction of intestine structure and function advanced mature development of Pamir Yaks.

Figure 10.

Figure 10.

Protein-protein interaction networks of the differential abundance proteins of different miR-29a transfection systems in yak jejunal epithelial cells based on STRING program.

Note: The green zone was Inflammatory Response; The red zone was Cell Proliferation. The nodes were proteins from Bos taurus database and the lines were the predicted functional annotations

Validation of differentially expressed proteins coding genes by qPCR

As shown in Fig. 11, the gene expressions of ERK2, Bcl-2 and CTNND2 were higher in the inhibitor miR-29a group and NC group than those in the mimics miR-29a group (P < 0.05) via qPCR, and the ERK1, Mcl-1 and LAMB1 expression had no significant difference among those groups. However, the gene expressions of GPR41, RXRA, IL-6, TNF-α and IL2RA were higher in the mimics miR-29a group than those in the inhibitor miR-29a group and NC group (P < 0.05). In summary, the results of selected differentially expressed proteins coding genes by RT-qPCR were the same expression tendency of Go, KEGG and PPI analysis. The RT-qPCR assay illustrated that the label-free results were reliable for further analyses.

Figure 11.

Figure 11.

Effects of different miR-29a transfection systems on the differentially expressed proteins coding genes in yak jejunal epithelial cells.

Discussion

Pamir yak is a local breed from the Pamir plateau that is mainly raised in the open and easily affected by the external environment in traditional feeding pattern.11 For instance, changeable weather and nutritional deficiencies can cause low production efficiency and a high disease rate of yaks.12 To improve the productivity of yaks, intestine structure and function advanced mature development during young yaks period is needed. Accumulating evidence has revealed that ­dysregulation of miRNAs were involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs.13 The miR-29 family, which includes miR-29a, miR-29b, and miR-29c, is involved in cell cycle, apoptosis and tumorigenesis.14 In this study, we analyzed the effect of miR-29a expression interference (Knock down and overexpression) on 0-day-old Pamir yak intestinal epithelial cells and found that miR-29a overexpression was downregulated the proliferation of Pamir yaks jejunum epithelial cells. Our findings suggest that the predominant effect of miR-29a on Pamir yaks jejunum epithelial cell proliferation is inhibition. miR-29a inhibited Bcl-2 and Mcl-1 genes expression regulation to promote the apoptosis of macrophages, which indirected evidence suggested that miR-29a bind to the 3’UTRs of ERK1/2 gene expression to negatively p38-MAPK pathway of regulate gene expression may be involved in this process.

Jejunal mechanical barrier plays a protective role in jejunal structure and function advanced mature via the normal morphological structure of jejunal mucosa, and the structural and functional properties of jejunal mechanical barrier was regulated via many factors, such as nutritions, microorganisms and genes.15 Tight junction proteins are the important parts of the jejunum mechanical barrier composed of the transporter protein family, including occludin and claudin, which are mainly involved in enterocytes proliferation, differentiation, apoptosis and cell bypass permeability regulation, and also acts as a significant barrier for preventing harmful substances from infestation the digestive system thereby, playing a crucial role in the yak health.16,17 According to our proteomics study results presented that the differential proteins of miR-29a expression interference (Knock down and overexpression) on 0-day-old Pamir yak intestinal epithelial cells can be concluded to two predominant themes: structure proteins (ERK1, ERK2, Bcl-2, Mcl-1, LAMB1 and CTNND2) and inflammatory response proteins (RXRA, IL-6, TNF-α and IL2RA). Structure proteins of ERK2, Bcl-2 and CTNND2 presented significantly down-regulated in mimics miR-29a group, and inflammatory response proteins of RXRA, IL-6, TNF-α and IL2RA showed a contrary tendency, it indicated that overexpression of miR-29a gene could inhibit jejunum epithelial cells proliferation and increase the risk of inflammatory response. Furthermore, GPR41 was detected in the current study, and presented significantly down-regulated in mimics miR-29a group, it showed that overexpression of miR-29a gene changed the normal jejunal metabolic pathways, reduced the ability of the jejunal mechanical barrier to resist SCFAs damage to the structure and function of the intestine, a the same time, GPR41 was activated to up-regulate the expression, and promoted the proinflammatory factors expression.

Mitogen-activated protein kinase (MAPK) pathways are activated by several stimuli and transduce the signal inside cells, generating diverse responses including cell proliferation, differentiation, migration and apoptosis.18 Based on our proteomics results, we will focus on the interactions among MAPK and their connections with cell proliferation pathway and inflammatory response pathway. The recent studies confirm that MAPK pathway downregulates ERK signaling directly or through activity of protein phosphatase 2 A (PP2A), which expression decreases MEK1/2, low-expression of MEK1/2 could accelerate cell apoptosis, inflammatory response and oxidative stress response to phosphorylate p38 protein kinase and activate MAP2K3, which was the upstream activator of p38 protein kinase, and result in intestinal barrier functional impairment.19 Rnvironmental stress and cytokines were some of the stimuli of MAPK pathway, which can be initiated at the MAPKKK level with the regulation gene expression including ERK1, ERK2, Bcl-2, Mcl-1, LAMB1 and CTNND2. Accordingly, overexpression miR-29a gene is followed by p38 activation to reduce cell proliferation pathway expression, and the opposite response was observed after inhibition of p38 activit. The overexpression of miR-29a gene reduced the ability of the jejunal mechanical barrier to resist SCFAs damage to the structure and function of the intestine, and the large SCFAs intake could startup enterocytes gluconeogenesis process, activated the tight junction signaling pathway, then regulated downstream related cell apoptosis pathways, which decreased the tight junction proteins expressions, such as Occluding, Claudin and Zo-1.20 Meanwhile, the proliferation of Regulatory T Cells to secrete many anti-inflammatory cytokines (IL-6, TNF-α, CCL5), promoted the inflammatory response pathway related genes expression. GPR 41, a mammalian G protein-coupled receptors (GPCRs) expressed in adipocytes, gut epithelial cells, and peripheral blood mononuclear cells.21 Previous studies showed that GPR 41 was a key activator of the jejunal mechanical barrier, participates in regulating body inflammatory response and affects the MAPK signaling pathway, which was activated by short-chain fatty acids (SCFAs) such as acetate, propionate, and butyrate-which are produced during dietary fiber fermentation by resident gut bacteria.22 Under the modern high proportion concentrate dietary fed condition, the miR-29a gene was usually at hyperexpression status, the SCFAs produced by the jejunum bacterial fermentation of dietary fiber lead to rumen microorganisms metabolic disorder (such as VFAs accumulated and pH decreased), then fermentable carbohydrate entered small intestine through rumen, caused intestinal acidosis, changed the microbial community structure, and destroyed the integrity of intestinal epithelial morphology and structure.

Acknowledgements

The authors are grateful to all the participants who took part in this study.

Funding Statement

The research was supported by the Shenzhen Science and Technology Program (Grant No. KCXF20201221173205015), Xinjiang Tianchi introduction of talent research Program (TCYC-TP2023) and Gansu Natural Science Foundation (22CX2NA005). The authors are grateful to all the participants who took part in this study.

Disclosure statement

No potential conflict of interest was reported by the author(s).

References

  • 1.McAllister TA, Stanford K, Chaves AV, Evans PR, Figueiredo EE, Ribeiro G.. Nutrition, feeding and management of beef cattle in intensive and extensive production systems. Anim Agric. 2020;5:75–98. [Google Scholar]
  • 2.Guo X, Wu XY, Chu M, et al. Characterization of the complete mitochondrial genome of the Pamir yak (Bos grunniens). Mitochondrial DNA B Resour. 2019;4(2):3165–3166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Jia JL, Liang CN, Wu XY, et al. Effect of high proportion concentrate dietary on Yak jejunal structure, physiological function and protein composition during cold season. Sci Rep. 2021;11(1):5502–5513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Pereira-Castro I, Moreira A.. On the function and relevance of alternative 3’-UTRs in gene expression regulation. Wiley Interdiscip Rev RNA. 2021;12(5):e1653. [DOI] [PubMed] [Google Scholar]
  • 5.Dey S, Kwon JJ, Liu S, et al. Regulatory role of microRNA-29a (miR-29a) in pancreatic ductal adenocarcinoma. Proc New Horizons Biotechnol (NHBT). 2021:57–59. ISBN: 978-81-927768-9-7 [Google Scholar]
  • 6.Yang YL, Huang YH, Wang FS, Tsai MC, Chen CH, Lian WS.. MicroRNA-29a compromises hepatic adiposis and gut dysbiosis in high fat diet-fed mice via downregulating inflammation. Mol Nutr Food Res. 2023;67(13):238–253. [DOI] [PubMed] [Google Scholar]
  • 7.Yan W, Cao Y, Yang H, et al. CB1 enhanced the osteo/dentinogenic differentiation ability of periodontal ligament stem cells via p38 MAPK and JNK in an inflammatory environment. Cell Prolif. 2019;52(6):e12691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhu H, Xiao X, Shi Y, et al. Inhibition of miRNA‑29a regulates intestinal barrier function in diarrheapredominant irritable bowel syndrome by upregulating ZO-1 and CLDN1. Exp Ther Med. 2020;20(6):155. ( [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Fan B, Yu B, Tian G, Zhang K, Liu HZ.. Culture and identification of jejunal epithelial cells isolated from neonatal rabbits in vitro. Chin J Anim Nutr. 2014;26(6):1570–1578. [Google Scholar]
  • 10.Jia JL. Screening and Analysis for Differential Expressed Proteins in Ewes Ovary Tissue of Different Lambing Performance. Gansu Agricultural University. 2015. [Google Scholar]
  • 11.Hameed A, Tariq M, Buerkert A, Schlecht E.. Constraints and prospects of utilising mountain pastures in Gilgit-Baltistan, Pakistan. Pastoralism. 2022;12(1):41–49. [Google Scholar]
  • 12.Sapkota S, Acharya KP, Laven R, Acharya N.. Possible consequences of climate change on survival, productivity and reproductive performance, and welfare of himalayan Yak (Bos grunniens). Vet Sci. 2022;9(8):449–457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Dexheimer PJ, Cochella L.. MicroRNAs: from mechanism to organism. Front Cell Dev Biol. 2020;8:409–417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dalgaard LT, Sørensen AE, Hardikar AA, Joglekar MV.. The microRNA-29 family: role in metabolism and metabolic disease. Am J Physiol Cell Physiol. 2022;323(2):C367–C377. [DOI] [PubMed] [Google Scholar]
  • 15.Ma J, Piao X, Mahfuz S, Long S, Wang J.. The interaction among gut microbes, the intestinal barrier and short chain fatty acids. Anim Nutr. 2022;9:159–174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Moonwiriyakit A, Pathomthongtaweechai N, Steinhagen PR, Chantawichitwong P, Satianrapapong W, Pongkorpsakol P.. Tight junctions: from molecules to gastrointestinal diseases. Tissue Barriers. 2023;11(2):2077620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhang M, Yang Z, Wu G, et al. Effects of probiotic-fermented feed on the growth profile, immune functions, and intestinal microbiota of bamei piglets. Animals. 2024;14(4):647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Morgan D, Berggren KL, Spiess CD, et al. Mitogen-activated protein kinase-activated protein kinase-2 (MK2) and its role in cell survival, inflammatory signaling, and migration in promoting cancer. Mol Carcinog. 2020;61(2):173–199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xie F, Li F, Li R, et al. Inhibition of PP2A enhances the osteogenic differentiation of human aortic valvular interstitial cells via ERK and p38 MAPK pathways. Life Sci. 2020;257:118086. [DOI] [PubMed] [Google Scholar]
  • 20.Mahurkar-Joshi S, Chang L.. Epigenetic mechanisms in irritable bowel syndrome. Front Psychiatry. 2020;11:805–816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Zhang D, Jian Y-P, Zhang Y-N, et al. Short-chain fatty acids in diseases. Cell Commun Signal. 2023;21(1):212–220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Chen Z, Guan D, Wang Z, et al. Microbiota in cancer: molecular mechanisms and therapeutic interventions. MedComm (2020). 2023;4(6):e417. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Animal Biotechnology are provided here courtesy of Taylor & Francis

RESOURCES