Vitamin C enhances the in vitro development of early porcine embryos by improving mitochondrial function

Abstract

Mammalian embryos often suffer from oxidative stress in vitro, as the oxygen in the atmosphere is higher than that in the oviductal environment. Vitamin C (Vc) has been proven to enhance early embryonic development in vitro, but the underlying mechanism remains unclear. In this study, we investigated the pathways of action by which Vc promotes the in vitro development of porcine embryos. Comparative analysis of in vitro and in vivo gene expression profiles of morula found that most of the differentially expressed genes were enriched in pathways related to mitochondrial function. The addition of 12.5 μg/mL Vc to the culture medium significantly increased blastocyst production in a dose- and duration-dependent manner. Moreover, ROS levels were significantly higher in embryos cultured in the air (21% oxygen) than cultured in a hypoxic condition (5% oxygen) and were reduced by Vc supplementation. Vc also significantly increased the mitochondrial membrane potential levels and the expression levels of mitochondrial function-related genes (MFN1 and OPA1) and TCA cycle-related genes (PDHA1 and OGDH) in embryos cultured in vitro. These results suggest that the addition of Vc to the in vitro culture medium can increase the developmental potential and improve the mitochondrial function of early porcine embryos.

Graphical Abstract

Introduction

The in vitro production (IVP) of embryos serves as a fundamental technique in the field of reproductive technologies. However, the efficiency of IVP in porcine is lower than that in other mammalian species, such as cattle or mice. Despite numerous efforts made to enhance the efficacy of porcine IVP, challenges persist in addressing issues related to suboptimal embryonic development.¹ Previous research has shown that the in vitro microenvironment in current embryonic culture systems cannot accurately mimic the complexity of the natural maternal environment. As embryos transition from the fallopian tube to the uterus, the microenvironment undergoes rapid changes in response to the needs and signals of developing embryos,² which in turn affects embryonic morphogenesis and differentiation.³ Therefore, the developmental capacity of the embryo can be remarkably impacted by the limitations of the in vitro microenvironment.

Several variables can affect embryonic growth during in vitro culture, and the level of partial oxygen pressure serves as a prominent distinction between the in vivo and in vitro culture environments of embryos. Compared with the microenvironment in the fallopian tube (about 2%–8% oxygen⁴) the in vitro conditions for embryonic culture (21% oxygen⁵) can induce an undesirable accumulation of reactive oxygen species (ROS), resulting in embryonic arrest, aberrant fetal growth, and poor health.⁶ Pabon et al. found that normoxic partial pressure (21% oxygen) engenders a decrement in the developmental potential of embryos, driven by the excessive generation of ROS and its orchestration of oxidative stress.⁷ Notably, cultured embryos under 21% oxygen resulted in enhanced gene deregulation in mice⁸ and decreased methylation modification and blastocyst development in bovine embryos.⁹ Thus, the 21% oxygen-mediated oxidative stress thereby affects embryonic development in vitro.

The mitochondria play a critical role in embryonic energy metabolism and homeostasis, primarily through oxidative phosphorylation. Notably, the mitochondrial respiratory chain is the primary site of ROS production, so free radical attack occurs directly on the mitochondrial respiratory chain, causing direct damage to the mitochondria, thereby inducing mitochondrial DNA mutations, disrupting the mitochondrial respiratory chain,¹⁰ affecting membrane permeability,¹¹ and disturbing Ca²⁺ homeostasis.¹² This cascade of insults culminates in an escalation of ROS production, which intensifies the harmful effect of oxidative stress. Consequently, a self-perpetuating cycle of ROS generation and mitochondrial imbalances ensues, leading to extensive mitochondrial autophagy and apoptosis.¹¹ Therefore, maintaining optimal mitochondrial function as a pivotal determinant of embryo viability and overall health is necessary.

In recent years, the utilization of antioxidants in embryonic culture has received considerable attention, and their use may protect embryos from oxidative damage.¹³ Antioxidants inhibit or delay molecular oxidation by scavenging or chelating redox free radicals. Notably, vitamin C (Vc) is widely recognized as a potent antioxidant that can protect embryos against oxidative stress by eliminating free radicals and facilitating the regeneration of other antioxidants, such as glutathione and vitamin E.¹⁴ Multiple studies focusing on porcine in vitro culture have consistently indicated that the addition of Vc has a positive impact on embryonic development.^15,16 However, the potential mechanism by which Vc affects early porcine embryonic development and its influence on the mitochondria remain unclear.

In this study, we reanalyzed the transcriptome profiles of in vivo and in vitro porcine embryos and assessed the effects of Vc supplementation during in vitro culture on the development of early porcine embryos and its correlation with embryonic mitochondrial function. We also demonstrated that Vc can enhance the in vitro development of early porcine embryos by mitigating oxidative stress and protecting mitochondrial function. These findings provide a new way to optimize the technical system of in vitro culture of early porcine embryos.

Materials and methods

Unless otherwise indicated, all materials were purchased from Sigma Chemical Co. (St. Louis, MO, USA). All samples were collected in strict accordance with the code of ethics approved by the Ethical Review Committee for Animal Experiments of Guangxi University (approval number GXU-2024-0093).

Collection of transcriptome sequencing data from porcine embryos developed in vitro and in vivo

The transcriptome sequencing data of porcine embryos in vivo and in vitro were provided by the study of van der Weijden VA et al.,¹⁷ which was obtained from the Gene Expression Omnibus (GEO) comprehensive database of the National Center for Biotechnology Information (NCBI) search database, designated as GSE155043.Porcine embryos were created from artificially fertilized German Landrace × Petrand hybrid sows. The sows were slaughtered on the second, fourth, and sixth days after conception to obtain four-cell embryos, morulae, and hatched blastocysts. Laboratory culture was used to create in vitro porcine embryos, and four-cell embryos, morulae, and blastocysts were obtained at 48, 100, and 174 h after fertilization. Each group had 5–10 embryos randomly selected for library preparation.

Reanalysis of the transcriptome of in vivo developing and in vitro produced porcine embryos from NCBI

For transcriptome analysis, clean reads were uploaded to BMK Cloud (www.biocloud.net, Biomarker Technologies Co. Ltd.; Beijing, China). Clean readings were mapped to porcine reference genomes (NCBI: Sscrofa11.1). Gene expression levels were determined by using Cufflinks and FPKM per thousand base exons. DESeq2 and the P value were used to examine the differentially expressed genes (DEGs) of porcine morulae produced in vivo and in vitro. Gene abundance differences among samples were calculated using the FPKM ratio. The false discovery rate (FDR) was used to determine P values thresholds in multiple tests and to calculate significant differences in gene expression. |log₂FoldChange| ≥ 1 and FDR <0.05 were used as the screening criteria for DEGs. The volcano map was used to draw the selected DEGs, which were then followed by Gene Ontology (GO, http://geneontology.org/) functional enrichment annotation analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG, https://www.kegg.jp/) pathway enrichment analysis, thereby determining the differences in transcriptome level between in vivo and in vitro developing embryos. Finally, according to Mingtian Deng et al.,¹⁸ using DEGs from in vivo and in vitro morulae, they performed cluster analysis of K-means co-expression patterns in three samples of in vivo four-cell, morulae and in vitro morulae.

Porcine oocytes in vitro maturation

The porcine ovaries were collected from a local slaughterhouse and transported to the laboratory in thermos flasks containing 0.9 mg/mL NaCl at 37 °C. Porcine cumulus-oocyte complexes (COCs) were recovered from 2 to 6 mm follicles of ovaries and washed with a TCM-199 cell medium containing 2% FBS, 0.9 mg/mL NaCl, 1.2 mg/mL Hepes, and 0.4 mg/mL NaHCO₃. COCs with three or more layers of cumulus cells coated with good refraction and uniform oocyte cytoplasm were selected for in vitro maturation. A microdroplet culture system was used to culture COCs. This approach entails depositing approximately 40 oocytes in 120 μL of maturation solution, coating them with mineral oil, and then transferring them into an incubator for culture at 38.5 °C with 5% CO₂, and maximum saturated humidity. The oocytes were initially incubated in a hormone-containing culture plate for 22 h and then moved to a hormone-free culture plate for a total of 42–44 h. The in vitro maturation medium was composed of TCM-199 (M4530, Gibco, USA), 3.05 mM glucose, 0.91 mM pyruvate sodium, 0.57 mM cysteine, 10 IU/mL PMSG (Ningbo Sansheng Biological Co., Ltd., China), 10 IU/mL HCG (Ningbo Sansheng Biological Co., Ltd., China), 10 ng/mL EGF, and 10% (v/w) porcine follicular fluid.

Parthenogenetic activation and in vitro embryonic culture

The oocytes were removed from the culture plate and placed in 0.1% hyaluronidase, and the cumulus cells were blown off gently. Afterward, the oocytes were washed, and those with homogeneous cytoplasm, free of cumulus cells, and with a discharged first polar body were selected for parthenogenetic activation. The oocytes were incubated in a 5 μM ionomycin solution for 5 min before being rinsed and transferred to a 2 mM 6-DMAP solution for another 4 h. After washing in TCM-199 triple, the oocytes were placed on a PZM-3¹⁹ culture plate, and the blastocyst rate was determined after 168 h.

Treatment of porcine embryos with Vc

For Vc treatment, we dissolved 10 mg/mL Vc (HY-B0166, MedChemExpress, USA) in PZM-3 in a dark environment and stored it protected from light at −80 °C, and diluted it with PZM-3 into a working solution as needed. In assessing the impact of Vc on early porcine embryonic development in vitro, several concentrations (0, 6.25, 12.5, 25, and 50 μg/mL) were added to PZM-3 to cultivate the embryos, and relevant phenotypes were examined. Then, the specific stages of Vc that promotes embryonic growth were then identified by progressively increasing or decreasing the duration of Vc treatment of embryos (days 1–7), and the cleavage and blastocyst rates were examined at the indicated time points.

Determination of ROS levels

The working solution of a 10 μM DCFH-DA fluorescent probe was prepared using PZM-3 in accordance with the directions of the active oxygen detection kit (Beyotime Biotechnology, Shanghai, China). The morula was washed 2–3 times with PBS containing 0.1% polyvinyl alcohol (PBS-PVA), placed in the working solution, and incubated for 30 min at 38.5 °C. Finally, after rinsing with PBS-PVA many times, morulae were observed under a fluorescence microscope (Leica TCS SP8MP), and photographs were taken with the same scanning settings among groups. The entire process was carried out under dark conditions. Fluorescence intensity was calculated using ImageJ (version 1.53t).

Determination of mitochondrial activity

In accordance with the instructions of the MitoTracker Orange CMTM ROS kit (Thermo Fisher Scientific, MA, USA), the MitoTracker fluorescent probe working solution of 200 nM was produced using PZM-3. The working solution must be warmed in the incubator before using the MitoTracker fluorescent probe. After washing the morulae with PBS-PVA 2–3 times, they were placed in the working solution and incubated at 38.5 °C for 30 min. Then, the morulae were rinsed with PBS-PVA for 1–2 times before being observed and photographed under a fluorescence microscope. The fluorescence intensity of the morulae was calculated using ImageJ.

Determination of the mitochondrial membrane potential (MMP, ΔΨm)

The JC-1 stock solution was made into a JC-1 working solution by diluting it with JC-1 staining buffer in 1:200 ratio, in accordance with the instructions of Mitochondrial Membrane Potential Kit (Beyotime Biotechnology, Shanghai, China). After washing the morulae with PBS-PVA for 2–3 times, they were placed in the working solution and incubated for 30 min in a 38.5 °C incubator. Then, the morulae were rinsed with PBS-PVA for 1–2 times before observing and photographing under a fluorescence microscope. The entire operation was carried out under dark conditions. ImageJ software was used to examine the ratio of red to green fluorescence intensity.

RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Blastocysts were collected on the seventh day of embryonic development and were washed three times with pre-cooled 0.1% PBS-PVA, with each group consisting of six embryos. Then, the blastocysts were transferred into PCR tubes containing 8 μL of cell lysate (AM8723, Thermo Fisher, USA). Subsequently, the collected blastocysts were stored at −80 °C before reverse transcription. Reverse transcription was conducted in accordance with the Superscript II Reverse Transcriptase (Thermo Fisher, USA) instruction manual. All experimental stages were performed on ice.

The reverse transcription products were utilized as templates for qRT-PCR to examine the expression level of target genes. qRT-PCR was conducted in accordance with the Novozan Company’s ChamQ Universal SYBR QPCR Master Mix instructions. In brief, the qRT-PCR mixture (20 μL) contains 10 μL of SYBR, 8 μL of ddH₂O, 1 μL of primers, and 1 μL of cDNA with the following reaction conditions: 95 °C for 2 min, 95 °C for 10 s, 60 °C for 30 s, and 40 cycles. MFN2, OGDH, OPA1, and PDHA1 were the targeted genes. Each sample was replicated three times. Relative mRNA levels of target genes were calculated using the 2^−ΔΔCt method with 18S as the reference genes. The primers for qRT-PCR are listed in Table 1.

Table 1.

Primer sequences of target genes in qRT-PCR analysis.

Gene name	Primer sequences (5′–3′)	Fragment size (bp)	Gene accession no./reference
18S	F: GATGGGCGGCGGAAAATTG	19	NM_213940.1
	R: TCCTCAACACCACATGAGCA	20
MFN2	F: CACACCACCAACTGCTTCCTG	21	XM_021095371.1
	R: TTGACGCTCCTCTTCTCCTCTG	22
OPA1	F: TGAAGAGGAAGCACGCAGAGC	21	XM_021070064.1
	R: CTGACACCTTGCGCTTCTGTTG	22
PDHA1	F: TGGTGGCGTCCCGTAACTTTG	21	XM_003360244.4
	R: TCGGCGAACAGTCTGCATCATC	22
OGDH	F: ATCAGGGCCTACCAGATACG	20	XM_021079063.1
	R: GCCGTAGAACCCAAGTTTGTC	21

Statistical analysis

Each experiment was repeated at least three times, with each observation field containing more than five embryos and a total of more than 40 embryos in each group. ImageJ was used for fluorescence intensity statistics, and GraphPad Prism 8.0 was used to analyze and draw graphs. The fluorescence intensity was estimated using the following corrected total cell fluorescence (CTCF): comprehensive density (selected embryo area × average background fluorescence).²⁰ The CTCF of the control group was set to 1, and the experimental group’s fluorescence intensity of the experimental group was estimated using this value. The data results were expressed as mean ± standard error (mean ± S.E.M.) and statistically analyzed by one-way analysis of variance and Tukey’s multiple comparisons test. When P < 0.05, the difference in the data from each group was considered statistically significant and differed considerably.

Results

Abnormal embryonic development in vitro might link to changes in embryo transcriptome profiles

In exploring the differences between in vivo and in vitro embryonic development, we performed differential expression analysis of in vivo and in vitro morulae transcripts in porcine. As shown in Fig. 1A, a total of 1276 DEGs were identified, including 507 upregulated genes and 769 downregulated genes. Considering that genes with comparable expression patterns may perform similar tasks and engage in the same metabolic process or cellular pathway, we then performed K-means co-expression pattern clustering analysis of DEGs in in vivo and in vitro morulae and four-cell embryos generated in vivo. The clustered heatmap of co-expression patterns (Fig. 1B) and the four groups of gene expression trend maps (Fig. 1C) revealed that the gene expression dynamic pattern of morulae produced in vitro was more similar to that of four-cell embryos generated in vivo. GO analysis of DEGs revealed that the variations between in vivo and in vitro morulae involved multiple pathways, especially a large enrichment of items related to ATP hydrolysis and synthesis, mitochondrial function, and cellular metabolism, which may influence the normal developmental trajectory of embryos (Fig. 1D).

Figure 1.

Cluster analysis of co-expression patterns of DEGs in in vivo developing and in vitro produced porcine embryos. (A) Volcanic diagrams of DEGs from in vivo developing and in vitro produced morulae. (B) Cluster heat map of DEGs. (C) Line graph depicting a series test of cluster analysis of the DEGs in in vivo developing and in vitro produced porcine embryos at the four-cell stage and morulae. The blue lines represented the dynamic expression patterns of gene clusters. (D) Representative GO items of the DEGs in in vivo developing and in vitro produced porcine morulae in clusters 1–4.

Mitochondrial functions of in vivo developing and in vitro produced porcine morulae are different

In investigating the biological function of DEGs in porcine morulae from in vivo developing and in vitro produced embryos, we conducted GO functional and KEGG signal pathway enrichment analyses. The result of the GO functional enrichment analysis revealed a significant enrichment of genes associated with the mitochondrial respiratory chain, mitochondrial inner membrane, mitochondria, and other related items (Fig. 2A). Moreover, the result of the KEGG analysis indicated the notable abundance of DEGs involved in signaling pathways such as oxidative phosphorylation (Fig. 2B). The results of GO and KEGG analyses indicate that the mitochondrial function of early embryos is directly associated with their developmental potential.

Figure 2.

Enrichment analysis of DEGs in porcine morulae derived from in vivo developing and in vitro produced. (A) GO function enrichment of DEGs. (B) Enrichment of KEGG signal pathway in DEGs.

Vc can improve the in vitro development of early porcine embryos in a dose- and duration- dependent manner

Based on the previous results of bioinformation analysis, we aimed to further clarify the detailed mechanism by which Vc affects the in vitro development of early porcine embryos. First, in identifying the suitable dose of Vc on the in vitro development of early porcine embryos under the culture system of our lab, different concentrations of Vc (0, 6.25, 12.5, 25, and 50 μg/mL) were added to the PZM-3 culture medium, and the blastocyst rate of each group was statistically calculated at day 7 of culture. As shown in Fig. 3A and B and Table 2, the blastocyst rate of embryos in the group added with 12.5 μg/mL Vc was significantly higher than that in the other experimental groups (P < 0.05), whereas the blastocyst rate of embryos added with 50 μg/mL Vc was significantly lower than that in the other groups (P < 0.05). Then, in determining the essential time during which Vc stimulates embryonic development, we further investigated the effects of the stage and duration of Vc addition on the in vitro development of early porcine embryos. Therefore, we switched the culture medium between the control and Vc addition groups at the D1-7 stages (0–24 h after oocytes parthenogenetic activation was defined as D1, 24–48 h as D2, and so on). As shown in Fig. 3C and D, no significant change in the embryonic development rate was found at D1 when Vc was added, but the embryonic development rate gradually increased as the Vc treatment period prolonged. Notably, the treatment group added with Vc throughout the entire time window (7 days) had the highest embryo blastocyst rate (P < 0.05). Subsequently, a decreasing strategy was used to gradually postpone the duration of Vc treatment, and no significant variation in embryonic development rate was found among the groups (P > 0.05). The above-mentioned findings indicated that 12.5 μg/mL Vc could significantly improve the developing capacity of early porcine embryos in vitro and that the positive effect of Vc addition on embryonic development in vitro was related to the duration of Vc treatment, with no stage specificity. Consequently, we used 12.5 μg/mL Vc for the subsequent experiments.

Figure 3.

Effect of Vc on the in vitro development of early porcine embryos. (A) Representative images of blastocyst development after 7 days of treatment with different concentrations of Vc. Scale bar, 400 μm. (B) Effects of different concentrations of Vc on the blastocyst development rate. (C) Timeline of Vc treatment (12.5 μg/mL). Embryos were cultured in control or Vc-addition medium. Note: the black line indicates the period without Vc treatment; the red line indicates the time period of Vc treatment, 0–24 h after parthenogenetic activation as D1, 24–48 h as D2, and so on. -: it indicates no change in embryonic development rate; +: it indicates an increase in the rate of embryonic development; ++: it indicates that the embryonic development rate increased significantly. (D) Normalized histogram of blastocyst rate in control and Vc-treated groups. *: it indicates that there are significant differences between groups (P < 0.05).

Table 2.

Effects of Vc concentrations on the in vitro development of early porcine embryos.

Vc(μg/mL)	No. of embryos	Cleavage rate (% ± S.E.M.)	Blastocysts rate (% ± S.E.M.)	No. of total cell (mean ± S.E.M.)
0	194(4)	82.75 ± 3.39	14.43 ± 0.69b	29.25 ± 2.33
6.25	199(4)	82.75 ± 3.39	19.07 ± 2.55b	33.83 ± 2.52
12.5	205(4)	84.92 ± 3.97	26.01 ± 1.31a	36.90 ± 2.76
25	191(4)	84.92 ± 3.97	20.20 ± 1.69b	33.03 ± 2.81
50	186(4)	84.92 ± 3.97	11.72 ± 0.91c	29.31 ± 2.79

Note: Different superscripts depict significant differences (P < 0.05).

Vc can protect the in vitro produced embryos from oxidative stress

The prominent distinction between the in vivo and in vitro culture environments lies in the differential oxygen partial pressure. In exploring the mechanisms through which Vc regulates the development of early embryos, we examined the impact of Vc addition on the in vitro development of early porcine embryos cultured in a hypoxic condition (5% oxygen) or in the air atmosphere (21% oxygen). As shown in Fig. 4A and C and Table 3, embryos cultured in 5% oxygen resulted in a significantly higher blastocyst development rate than those cultured in 21% oxygen (23.42% ± 1.68%, n = 233, vs. 16.55% ± 0.96%, n = 222, P < 0.05). Moreover, supplementation with 12.5 μg/mL Vc in embryos cultured in 21% oxygen condition not only led to a developmental rate of embryos close to or even exceeding that of embryos cultured in a hypoxic condition (24.70% ± 0.52%, n = 214, vs. 23.42% ± 1.68%, n = 233, P > 0.05), but also increased the total cell number (40.81 ± 3.04, n = 219, vs. 36.45 ± 2.87, n = 205, P > 0.05). Notably, the addition of Vc can significantly increase the blastocyst rate of embryos cultured in the 21% oxygen and in a 5% oxygen condition (16.15% ± 0.96%, n = 222, vs. 24,70% ± 0.52%, n = 214; 23.42% ± 1.68%, n = 233, vs. 31.53% ± 1.73%, n = 225, P < 0.05). These results indicate that Vc plays a critical role in regulating the in vitro development of early porcine embryos.

Figure 4.

Effects of Vc on the development of early porcine embryos cultured in 21% oxygen and 5% oxygen. (A) Representative images of blastocyst development after 7D Vc treatment under normoxic and hypoxic conditions. Scale bar, 400 μm. (B) Representative images of ROS levels in Vc-treated blastocysts under normoxic and hypoxic conditions. Scale bar, 400 μm. (C) Effects of Vc on blastocyst rate under normoxic and hypoxic conditions. (D) Effects of Vc on the ROS levels of blastocysts under normoxic and hypoxic conditions.

Table 3.

Effects of Vc on the in vitro development of early porcine embryos in 21% oxygen or 5% oxygen.

Group	No. of embryos	Cleavage rate (% ± S.E.M.)	Blastocysts rate (% ± S.E.M.)	No. of total cell (mean ± S.E.M.)
5% O2	233(4)	84.93 ± 1.41	23.42 ± 1.68b	36.45 ± 2.87
21% O2	222(4)	81.72 ± 4.48	16.55 ± 0.96c	33.07 ± 3.66
21% O2 + Vc	214(4)	82.11 ± 1.55	24.70 ± 0.52b	40.81 ± 3.04
5% O2 + Vc	225(4)	86.05 ± 2.16	31.53 ± 1.73a	44.45 ± 2.81

Note: 1. ‘5% O₂’ and ‘21% O₂’ indicate oxygen concentration.

2. Different superscripts depict significant differences (P < 0.05).

Excessive ROS levels induce oxidative stress, which lowers early embryonic growth potential. We used the DCFH-DA probe to measure ROS levels in blastocysts derived from different culture conditions. Figure 4B and D show that the ROS levels of embryos cultured in 21% oxygen was significantly higher than that of embryos cultured in a 5% oxygen condition (P < 0.05). Moreover, the addition of 12.5 μg/mL Vc significantly reduced ROS levels in 21% oxygen (P < 0.05). These results indicate that Vc can protect the early porcine embryos from oxidative stress in vitro.

Vc can boost the mitochondrial function of early porcine embryos produced in vitro

Intracellular ROS levels are normally balanced under healthy conditions. Excessive ROS levels harm mitochondrial function and cause DNA damage. Normal MMP and mitochondrial content represent the health and functional status of the mitochondria. Therefore, MMP and mitochondrial content in porcine morulae were measured to determine whether Vc participates in the regulation of embryonic mitochondrial function. As shown in Fig. 5A and C, the addition of 12.5 μg/mL Vc resulted in a significantly increased MMP in embryos cultured in 21% oxygen or in a 5% oxygen condition Furthermore, mitochondrial content was significantly higher in the experimental group supplemented with 12.5 μg/mL Vc, as evidenced by a stronger intensity of red fluorescence (P < 0.05, Fig. 5B and D), indicating that Vc also increased the mitochondrial content of early porcine embryos.

Figure 5.

Effect of Vc on the mitochondrial function of early porcine embryos produced in vitro. (A–C) Effects of Vc on the mitochondrial membrane potential of morulae under normoxic and hypoxic conditions. (B–D) Effects of Vc on the mitochondrial content of morulae under normoxic and hypoxic conditions. (E–F) Effects of Vc on genes related to mitochondrial function during in vitro development of early porcine embryos. (G–H) Effect of Vc on the expression of critical rate-limiting enzymes in the tricarboxylic acid cycle in early porcine embryos.

In determining the potential pathway by which Vc enhances the mitochondrial function of early porcine embryos in vitro, we examined the expression of genes related to mitochondrial activity and critical tricarboxylic acid (TCA) cycle rate-limiting enzymes. As shown in Fig. 5E, F, G, and H, the expression levels of MFN1 and OPA1, the primary genes involved in mitochondrial fusion, as well as the critical TCA cycle enzymes PDHA1 and OGDH, were drastically increased (P < 0.05). Therefore, Vc improved the mitochondrial function of early porcine embryos.

Discussion

In this study, we conducted comprehensive analysis of transcriptome profiles comparing in vivo developing and in vitro produced embryos. Our results revealed significant distinctions in mitochondrial function between these two embryo types, providing potential insights into the diminished developmental potential of in vitro embryos. Moreover, we examined the crucial steps of Vc action and showed the unique role of Vc in reducing embryonic oxidative stress, preserving mitochondrial function, and promoting embryonic development in vitro. These findings provide important implications for improving the developmental potential of in vitro embryos and expanding our understanding of the underlying mechanism governing embryonic development.

The results of clustering analysis of the co-expression patterns of gene expression profiles of in vivo and in vitro morulae from the NCBI database showed significant differences in gene expression levels between in vivo and in vitro embryos, which may be associated with abnormalities in in vitro embryonic development. Previous studies have extensively demonstrated the low-quality reduced developmental potential of in vitro embryos when compared with their in vivo counterparts.²¹ Of particular concern is the significant accumulation of ROS during in vitro culture, which leads to embryo damage or arrest.²² However, the addition of antioxidants to the in vitro embryonic culture medium has been found to be an effective strategy to counteract ROS accumulation during in vitro culture.²³ As a powerful antioxidant, Vc is abundant in the oviductal and uterine environments, and it is predominantly provided by oviductal secretion and the embryo itself in early embryonic development.²⁴ Recently, Vc has been widely used as a media supplement in in vitro oocyte maturation and embryonic culture systems.²⁵ However, descriptive investigations on the crucial steps of Vc activity remain incomplete. In this investigation, supplementation with 12.5 μg/mL Vc significantly enhanced the development of preimplantation embryos in porcine. A clear dose-response association was also found between Vc and embryonic development. In addition, the advantage of Vc on the development of early porcine embryos in vitro was duration-dependent rather than stage-specific (Fig. 3). Similarly, Fang et al. discovered that adding Vc during IVM and IVC improved the development of porcine parthenogenetic activation (PA) and cloned embryos.¹⁶ However, in contrast with our study, they used 50 μg/mL as the best concentration of Vc, which might be attributable to the use of different culture systems. Interestingly, the treatment of mature oocytes in the same species influences the effect of Vc on embryonic development, with PA embryos being more vulnerable to environmental factors (e.g. oxygen partial pressure) because of the lack of a paternal genome and the haploid state of the majority of embryos activated by solitary females.²⁶ Thus, Vc generates a more significant promoting impact in PA embryos^15,16,27 compared with IVF embryos.²⁸

Embryos may resist oxidative stress in the natural environment by using endogenous antioxidant mechanisms, such as scavenging free radicals and repairing oxidative damage; however, the antioxidant defense system loses its effectiveness when ROS concentrations surpass typical levels.²⁹ Based on previous research, a high oxygen partial pressure environment is one of the principal causes of oxidative stress in embryos.³⁰ Normoxic partial pressure causes DNA damage,³¹ mitochondrial structural changes,³² low embryonic growth potential, and mortality when compared with low-oxygen culture environments.⁷ As an efficient reducing agent and free radical scavenger in biological systems, Vc maintains the balance of the redox environment within the embryo, thereby protecting the embryo from oxidative stress.³³ Our results indicated that the addition of 12.5 μg/mL Vc reduced ROS levels in blastocysts under 21% oxygen and 5% oxygen conditions, but no significant difference was observed in either group (Fig. 4B and D, P > 0.05). Notably, we also found that the blastocyst rate in the Vc test group under 21% oxygen was higher than that in a 5% oxygen partial pressure test group (Fig. 4C). Therefore, we hypothesized that Vc can not only reduce oxidative stress in in vitro embryos, but also may enhance embryonic growth via other mechanisms, such as Vc and hypoxic partial pressure may work together to promote embryonic development.

As the hub of cellular metabolism, the mitochondria have been proven to play key roles in numerous physiological processes and cell development, and mitochondrial function is directly related to early embryonic development.³⁴ For example, the regulation of the mitochondria in early embryos differs between in vivo and in vitro environments. Noguchi et al. discovered that mitochondrial genes were expressed at greater levels in developing embryos in vivo than in vitro.³⁵ Furthermore, the disruption or knockout of genes linked to mitochondrial biogenesis and function can lead to developmental retardation and even embryonic mortality.³⁶ Consistently, our study discovered that DEGs between in vivo developing and in vitro produced morulae were predominantly enriched in mitochondrial-related components, implying that abnormal mitochondrial function contributes to compromised in vitro embryonic development (Fig. 2). Furthermore, we discovered an abundance of signaling pathways linked to oxidative phosphorylation. Oxidative phosphorylation occurs in the mitochondria of early embryos,³⁷ and many transcripts associated with oxidative phosphorylation were significantly inhibited in blastocysts produced in vitro,³⁸ indicating that oxidative phosphorylation may be dysfunctional in in vitro embryos. Therefore, the above-mentioned results indicate a strong association between mitochondrial dysfunction and impaired embryonic development in vitro.

In addition, several investigations have indicated that Vc plays an indispensable role in the endogenous antioxidant defense of the mitochondria.³⁹ This component protects the integrity of the mitochondrial membrane by preventing the dissipation of MMP and the subsequent release of cytochrome C.⁴⁰ Furthermore, SagunKC et al. elucidated that Vc permeates the cellular mitochondria, reduces mitochondrial ROS, and prevents oxidative damage to mitochondrial DNA, thereby protecting the mitochondria from oxidative damage.⁴¹ In our study, we found that MMP and mitochondrial content were significantly lower in the 21% oxygen group than in the 5% oxygen group, which is consistent with previous results.³³ Therefore, in vitro culturing under normoxic conditions impairs embryonic mitochondrial function, and Vc supplementation rescues the aforementioned mitochondrial damage situation (Fig. 5). Furthermore, Vc can enhance the expression of key genes associated with mitochondrial function in our study. These findings indicate that Vc can promote mitochondrial fusion and improve mitochondrial health.

To summarize, explicating the role of molecular and inter-transcriptomic hallmarks responsible for Vc-triggered antioxidative and cytoprotective pathways, which are related to intensified biogenesis of mitochondria and their enhanced ROS-scavenging activities, might give rise to increase in developmental outcome and quality attributes of not only porcine, but also other mammalian IVP-derived embryos developing in hypoxic gas mixture comprised of 5% O₂, 5% CO₂ and 90% N₂. These achievements might contribute to improvement in the efficiency of generating high-quality in vitro-produced embryos with the aid of various assisted reproductive technologies such as cloning by somatic cell nuclear transfer^42–45 and ex vivo fertilization either by co-incubation of meiotically matured oocytes with sperm cells^46–48 or by microinjection of single spermatozoa directly into host ooplasm.^49–51

Conclusion

The present study elucidates the important role of Vc in improving the developmental ability of early porcine embryos produced in vitro through reducing oxidative stress and protecting mitochondrial function. Our findings provide a new perspective for further understanding the key cellular and molecular events during early porcine embryonic development and elucidating the protective properties of small-molecule compounds on mitochondrial function during in vitro embryonic production.

Funding Statement

This work was supported by the National Natural Science Foundation of China (No.31902125), Natural Science Foundation of Guangxi, China (No.2023GXNSFDA026016, No.2017GXNSFAA198311). We are also grateful to the supported of Guangxi Bagui Scholar Program and Bama county program for talents in science and technology, Guangxi, China (20210043, 20220029).

Author contributions

Lei Wang: Methodology, Investigation, Validation, Formal analysis and Writing-original draft. Liu She: Investigation, Formal analysis, Writing-original draft and Writing-review & editing. Peng Qiu, Meiyun Lv, Yunchuan Zhang, Yunjia Qi and Qin Han: Investigation and Formal analysis. Deshun Shi: Conceptualization, Resources and Supervision. Chan Luo: Conceptualization, Resources and Writing-review & editing.

Ethics approval

All experiments were approved by Ethical Review Committee for Animal Experiments of Guangxi University (Approval number GXU-2024-0093).

Consent for publication

This manuscript has not been published or presented elsewhere and is not under consideration by another journal. All study participants provided informed consent and approved it for publication.

Disclosure statement

No potential conflict of interest was reported by the author(s)