ABSTRACT
Background
Lumbar disc herniation (LDH) is a common degenerative spinal disorder that severely impacts patients' quality of life. This study investigated the prognostic values of the lncRNA LINC00638 in LDH and its regulatory role in the senescence of human nucleus pulposus cells (hNPCs).
Methods
Serum was collected from 93 LDH patients and 108 healthy individuals (matched age and gender). RT‐qPCR was used to detect LINC00638 and miR‐185‐5p expression. The diagnostic and prognostic significance was analyzed using ROC and logistic regression. The hNPCs senescence model induced by 50 ng/mL TNF‐α was established to explore the effects of LINC00638 overexpression (alone or combined with miR‐185‐5p) on cell proliferation, apoptosis, senescence, inflammation, and oxidative stress.
Results
Serum LINC00638 levels in LDH patients gradually decreased with disease progression (p < 0.05) and were significantly correlated with VAS, JOA and ODI scores (p < 0.001). Low LINC00638 expression was identified as a reliable diagnostic indicator for LDH (AUC = 0.828, sensitivity 70.97%, specificity 80.56%, p < 0.001) and an independent risk factor for poor prognosis (OR = 0.176, p = 0.009). Cellular experiments showed that LINC00638 overexpression significantly inhibited TNF‐α‐induced cell senescence (p < 0.01), while this inhibitory effect was reversed by miR‐185‐5p overexpression (p < 0.05).
Conclusions
Serum LINC00638 holds promise as a potential biomarker for the diagnosis and prognostic evaluation of LDH, closely reflecting disease severity. Furthermore, LINC00638 participates in regulating hNPCs' senescence and LDH progression by modulating miR‐185‐5p.
Keywords: cell senescence, lncRNA, lumbar disc herniation, miRNA, prognosis
LINC00638 is down‐regulated in LDH patients serum, serving as a promising biomarker for LDH diagnosis and prognosis. Meanwhile, its overexpression can inhibit TNF‐α‐induced senescence of hNPCs, and LINC00638 regulates hNPCs senescence and LDH progression by modulating miR‐185‐5p.
1. Introduction
Lumbar disc herniation (LDH) is a prevalent degenerative spinal disorder with complex pathogenesis [1]. Its incidence is rising due to population aging and sedentary lifestyles [2], and recurrence rates remain high (20%–40%) [3], highlighting the urgency to explore its pathogenesis, identify prognostic biomarkers, and develop novel therapeutic targets.
Long chain noncoding RNAs (lncRNAs) play critical roles in disease pathogenesis [4]. In recent years, research has shown that multiple lncRNA molecules are associated with the severity of LDH. However, these studies have mostly focused on simple correspondences between individual molecules and disease phenotypes. There has been a lack of systematic validation of the dual clinical value of molecular diagnosis and prognosis, which makes it difficult to meet the precise evaluation needs of LDH in clinical practice. LINC00638, an emerging lncRNA, has been linked to malignant progression in cancers (e.g., nonsmall cell lung cancer, hepatocellular carcinoma) [5, 6] and is down‐regulated in rheumatoid arthritis (RA) [7], where it mitigates inflammatory and oxidative stress [8]. Notably, LINC00638 is a key regulator in lumbar disc degeneration (LDD), a closely related condition [9]. However, the role of LINC00638 in LDH pathogenesis and potential as a prognostic biomarker remains poorly understood.
MicroRNAs (miRNAs) are crucial in musculoskeletal degenerative diseases [10]. miR‐185‐5p, for instance, is upregulated in osteoarthritis (OA) [11] and LDD [12], promoting disease progression by inhibiting cell proliferation, exacerbating inflammation, and inducing apoptosis in nucleus pulposus cells (hNPCs) [13]. However, existing research on miR‐185‐5p mostly focuses on exploring the mechanisms at the cellular level without considering the regulatory relationship of lncRNAs or constructing a complete evidence chain linking serum markers, cell function and disease progression. This results in a significant gap between molecular mechanisms and clinical applications. Notably, bioinformatics analyses suggest LINC00638 may bind miR‐185‐5p, but this interaction is unvalidated.
This study thus analyzed the expression characteristics of LINC00638 in LDH and its association with disease severity and clinical prognosis. This study addresses the limitations of previous research that focused solely on the association between molecules and diagnosis or disease severity, lacking prognostic validation. Additionally, we explored the role of LINC00638 in regulating hNPCs senescence through cell modeling, and elucidated the molecular interactions between LINC00638 and miR‐185‐5p. Bioinformatics tools were also employed to identify the core target genes of miR‐185‐5p and elucidate the regulatory axis of LINC00638/miR‐185‐5p/mRNA. This study integrates clinical association analysis of serum biomarkers with molecular mechanism validation at a cellular level. The results aim to address the key issue of the disconnection between clinical phenotype—molecular mechanism in previous studies and provide a theoretical foundation and a potential intervention strategy for LDH clinical assessment and targeted therapy.
2. Materials and Methods
2.1. Research Subjects
A total of 93 LDH patients treated at The Second Affiliated Hospital of Xi'an Jiaotong University between 2022 and 2024 were enrolled as the case group. For the power analysis of the sample size, this study used the G*Power 3.1 software to complete the relevant calculations. Based on the common effect size characteristics of similar lncRNA and degenerative disease association studies, a two‐tailed test, α = 0.05, and a medium effect size (Cohen's d = 0.5) were set. The calculation showed that at least 64 cases in each group could achieve a statistical power of over 80%. In this study, there were 93 cases in the case group and 108 cases in the control group, both of which exceeded this threshold, meeting the a priori design requirements.
The inclusion criteria for this study were as follows: (1) meeting the diagnostic criteria for LDH specified in the Guidelines for the Diagnosis and Treatment of Lumbar Intervertebral Disc Herniation [14], with confirmation by lumbar spine MRI or CT scan; (2) age between 18 and 75 years; and (3) no other severe spinal or systemic diseases. The exclusion criteria were: (1) presence of lumbar fractures, tumors, or other spinal pathologies; (2) a history of lumbar spine surgery within the past 3 months; and (3) severe cardiovascular/cerebrovascular diseases, hepatic or renal insufficiency, or autoimmune disorders. Among the case group, 29 patients had mild symptoms with no significant neurological deficits, 27 patients had moderate symptoms, and 37 patients had severe neurological deficits.
A control group of 108 age‐ and gender‐matched healthy individuals was included. All control participants had no prior history of spinal diseases or related symptoms, and imaging studies (MRI or CT) indicated the absence of disc degeneration. The study was approved by the Ethics Committee of The Second Affiliated Hospital of Xi'an Jiaotong University, with informed consent from all participants.
2.2. Serum Collection
Fasting venous blood (5 mL) was obtained from all participants, centrifuged at 3000 r/min for 15 min at 4°C to separate serum, which was stored at −80°C in RNase‐free tubes.
2.3. General Data Collection and Follow‐Up
Demographic and clinical data [age, gender, body mass index (BMI), treatment method, pain location, and lumbar segments] were collected. Clinical assessments included Visual Analog Scale (VAS), Japanese Orthopedic Association score (JOA), and Oswestry Disability Index (ODI), with mean scores recorded by three trained researchers.
LDH patients were followed up for 12 months to document symptom recurrence or complications. Prognosis was categorized as good or poor based on criteria including re‐exacerbation requiring re‐treatment, imaging‐confirmed re‐herniation, or complications (muscular dystrophy, joint stiffness, etc.).
2.4. Cell Culture and Induction
Human nucleus pulposus cells (hNPCs) were uniformly seeded into cell culture flasks. A complete chondrocyte medium was prepared, and 5 mL of this medium was added to each flask, followed by incubation at 37°C in a 5% CO2 atmosphere. Cells were digested and passaged using 0.25% trypsin–EDTA (Gibco, USA), with cells from the 3rd to 5th passages selected for experimental use.
To establish an hNPCs senescence model, cells were seeded into 6‐well plates. After cell attachment, TNF‐α (Invitrogen, USA) was added to achieve a final concentration of 50 ng/mL, and cells were incubated for 24 h to induce senescence. For the normal control group, an equal volume of medium without TNF‐α was used instead. The 50 ng/mL TNF‐α induction concentration is based on literature support and preliminary experiments. Existing studies [12, 13, 15] confirm this concentration reliably induces hNPC senescence. Preliminary tests of 25, 50, and 100 ng/mL showed: 25 ng/mL only slightly affects cell function and fails to trigger senescence; 100 ng/mL causes excessive cell damage and high apoptosis; 50 ng/mL, however, significantly inhibits hNPC proliferation, increases senescence markers (p16‐INK4A, SA‐β‐gal positivity), and controls apoptosis to avoid over‐damage.
2.5. Cell Transfection
The LINC00638 overexpression vector (oe‐LINC00638) and its negative control (oe‐NC) were constructed by Genechem Medical Technology Co. in Shanghai, China. Additionally, miR‐185‐5p mimetics (mimic‐miR‐185‐5p), inhibitor (inhibitor‐miR‐185‐5p), and their respective negative controls (mimic‐NC and inhibitor‐NC) were purchased from Ribobio Technology Co. in Guangzhou, China.
Induced hNPCs were seeded in 6‐well plates at a consistent density, and transfection was performed when cell confluence reached 50%–60%. The transfection procedure followed the protocol provided with the jetPRIME Transfection Reagent (Polyplus, France). Each experimental group included 5 biological replicates.
2.6. Real‐Time Quantitative Polymerase Chain Reaction (RT‐qPCR)
Total RNA was extracted from serum and cellular samples using TRIzol reagent (Invitrogen, USA) in strict accordance with the manufacturer's protocol. The concentration and purity of the extracted total RNA were determined with a NanoDrop 2000 spectrophotometer (ThermoFisher, USA). Subsequently, 1 μg of total RNA was reverse transcribed into cDNA using HiScript III RT SuperMix for qPCR (Vazyme, China).
The resulting cDNA was used as the template for RT‐qPCR, which was performed on a QuantStudio 5 real‐time fluorescence quantitative PCR instrument (Thermo Fisher, USA) using ChamQ Universal SYBR qPCR Master Mix (Vazyme, China). Primers were synthesized by Nanjing Genscript Biotechnology Co. Ltd., China. The upstream and downstream primers (5′–3′) for LINC00638 were TTCGACCCGTAACAGCTTCT and AGGTCCGTGGAAAACTAGGG, respectively. For miR‐185‐5p, the primers were GCCGAGTGGAGAGAAAGGC and CTCAACTGGTGTCGTGGA. The relative expression levels were quantified via the 2−ΔΔCt method, with GAPDH and cel‐miR‐39 used as internal reference genes.
2.7. Dual‐Luciferase Reporter Gene Assay
The binding sites between LINC00638 and miR‐185‐5p were predicted via the starBase v3.0 database. Fragments of LINC00638 containing wild‐type (wt) and mutant (mut) binding sites were synthesized by Sangon Bioengineering Co. Ltd., China, and these fragments were subsequently cloned into the pGL3‐Basic vector to generate the luciferase reporter gene constructs pGL3‐wt‐LINC00638 and pGL3‐mut‐LINC00638.
The hNPCs were seeded in 24‐well plates, and when cell confluence reached 70%–80%, 100 ng of the reporter gene vector was co‐transfected with 50 nM miR‐185‐5p mimic/inhibitor or their respective negative controls (mimic/inhibitor‐NC) using jetPRIME transfection reagent. After 48 h of transfection, the medium was removed in strict accordance with the manufacturer's instructions for the Dual Luciferase Reporter Gene Assay Kit (Promega, USA), and luciferase activity was measured using a multifunctional enzyme labeling instrument (Berthold Technologies, Germany).
2.8. Cell Proliferation
Transfected hNPCs were subjected to routine trypsin digestion and then resuspended into a single‐cell suspension. The cells were seeded into 96‐well plates at a density of 5000 cells per well and cultured in a 37°C, 5% CO₂ incubator. At predesignated time points after seeding, 10 μL of CCK‐8 solution (Beyotime, China) was added to each well, followed by incubation at 37°C for 4 h. After incubation, the optical density (OD) value at 450 nm was measured using an enzyme labeling instrument (BioTek, USA), and cell growth curves were generated based on the OD values.
2.9. Cell Apoptosis
After transfection, hNPCs were collected and centrifuged at 1500 rpm for 5 min at room temperature. The supernatant was discarded, and 500 μL of binding buffer was added to resuspend the cells. Subsequently, 5 μL of annexin V‐FITC and 5 μL of propidium iodide (PI) staining solution (Beyotime, China) were added sequentially, and the mixture was incubated in the dark at room temperature for 15 min. Cell apoptosis was analyzed using a BD FACSCanto II flow cytometer.
2.10. Cell Senescence
Transfected hNPCs were collected, and the culture medium was discarded. Total protein was extracted from the cells using RIPA lysis buffer supplemented with protease inhibitors (Beyotime, China). After protein denaturation, samples were separated by 12% SDS‐PAGE gel electrophoresis (Yeasen, China) and then transferred onto a methanol‐activated PVDF membrane (Millipore Immobilon, USA). The membrane was blocked with 5% nonfat milk for 1 h at room temperature, followed by sequential incubation with a rabbit anti‐human p16‐INK4A monoclonal primary antibody (1:1000, Proteintech, China) at 4°C overnight and a HRP‐labeled goat anti‐rabbit secondary antibody (1:5000, Proteintech, China) at room temperature for 1 h. Protein bands were visualized using an enhanced chemiluminescence (ECL) reagent kit (Beyotime, China) following the kit instructions, and detected with a chemiluminescence imaging system (Bio‐Rad, USA). β‐actin was used as the internal reference for grayscale quantification of p16‐INK4A protein.
The transfected hNPCs were then collected, the medium was discarded, and the cells were washed three times with PBS. Adhering to the protocol of the SA‐β‐gal staining kit (Cell Signaling Technology, USA), 200 μL of the SA‐β‐gal staining working solution was added to each well, and the cells were incubated overnight at 37°C without CO2. The 5 random fields of view were selected under a microscope, photographed, and the ratio of SA‐β‐gal positively stained cells to the total number of cells was quantified.
2.11. Enzyme‐Linked Immunosorbent Assay (ELISA)
Forty‐eight hours after transfection, hNPCs were collected, subjected to ultrasonic disruption, and then centrifuged at 10 000 r/min for 10 min to obtain the supernatant (for subsequent biomarker detection). ELISA kits for interleukin‐1β (IL‐1β), IL‐6, and interferon‐γ (IFN‐γ) were procured from R&D Systems (USA), while kits for malondialdehyde (MDA) and superoxide dismutase (SOD) were obtained from the Nanjing Jiancheng Institute of Bioengineering (China). All operations were performed in strict accordance with the manufacturers' kit instructions. The OD values were measured at the wavelengths recommended by each kit using a microplate reader. The concentration or activity of each biomarker was calculated based on the standard curve, along with the calculation of relative change levels.
2.12. Bioinformatics Analysis
To further clarify the downstream mechanism of miR‐185‐5p, potential target genes of miR‐185‐5p were predicted using 4 databases: miRDB, miRWalk, TargetScan, and starBase. Cross‐analysis and integration via the Jvenn tool identified core candidate target genes. KEGG enrichment analysis was conducted on these genes to explore pathways related to LDH pathogenesis, and the STRING database was used to construct a protein–protein interaction (PPI) network of core candidate target genes, with core genes screened based on node degree value.
2.13. Statistical Analysis
Continuous data are expressed as mean ± standard deviation (x ± SD), with comparisons via t‐tests employed for comparisons between two groups and analysis of variance (ANOVA) utilized for comparisons among multiple groups. Tukey's HSD test was further applied for pairwise comparison correction. Categorical data are presented as number (%), compared via chi‐squared (χ 2) test. Correlation analyses were conducted using Spearman or Pearson methods. Bonferroni correction was used to adjust the test significance level (corrected α = 0.017) receiver operating characteristic (ROC) curves evaluated the diagnostic utility of serum LINC00638. Additionally, multifactorial logistic analysis was employed to identify factors influencing the prognosis; the stepwise forward method was adopted for variable screening. All experiments were conducted with five biological replicates and three technical replicates, and accidental errors were excluded through multiple independent experiments.
3. Results
3.1. Expression and Diagnostic Value of Serum LINC00638 of LDH Patients
Compared with healthy controls, the serum expression level of LINC00638 was found to be significantly reduced in LDH patients (p < 0.001, Figure 1A). Furthermore, LINC00638 expression showed a progressive decrease with increasing disease severity: the mild group had higher LINC00638 levels than the moderate group, while the moderate group had higher levels than the severe group (p < 0.05, Figure 1B).
FIGURE 1.
The serum LINC00638 levels in control and LDH groups (A), as well as in LDH patients with different severities (B). The diagnostic significance of serum LINC00638 for LDH (C). *p < 0.05; ***p < 0.001.
ROC analysis showed that the area under the curve (AUC) for serum LINC00638 in the diagnosis of LDH was 0.828. Serum LINC00638 exhibited a superior capacity to identify patients with LDH (p < 0.001), with a sensitivity of 70.97% and a specificity of 80.56% (Figure 1C).
3.2. Correlation Between Serum LINC00638 and Clinical Indicators
Correlation analysis revealed a significant negative correlation between serum LINC00638 levels and the pain‐assessing VAS score (p < 0.001, Figure 2A), as well as with the daily activity impairment‐assessing ODI score (p < 0.001, Figure 2C). In contrast, a positive correlation was observed between serum LINC00638 levels and the JOA score, which evaluates neurological status (p < 0.001, Figure 2B). Specifically, lower serum LINC00638 levels were associated with more severe pain, deteriorated neurological status, and greater impairment in daily activities.
FIGURE 2.
The correlation between serum LINC00638 and clinical indicator VAS (A), JOA (B), and ODI (C).
3.3. Baseline Data on the Good and Poor Prognosis Groups
Statistical analysis showed no significant differences in age, gender, BMI, pain location, or lumbar segment between the good and poor prognosis groups (p > 0.05). Notably, the proportion of patients who underwent surgical intervention was significantly higher in the poor prognosis group than in the good prognosis group (p = 0.011). Furthermore, compared with the good prognosis group, the poor prognosis group had significantly elevated VAS scores and ODI scores, alongside significantly reduced JOA scores (p < 0.001, Table 1).
TABLE 1.
Basic information of good prognosis group and poor prognosis group of LDH patients.
| Characteristics | Good group (n = 57) | Poor group (n = 36) | p |
|---|---|---|---|
| Age (years) | 47.86 ± 8.93 | 51.53 ± 11.57 | 0.089 |
| Gender n/% | 0.628 | ||
| Male | 33/57.89 | 19/52.78 | |
| Female | 24/42.11 | 17/47.22 | |
| BMI (kg/m2) | 22.56 ± 2.08 | 23.34 ± 2.41 | 0.102 |
| Treatment method n/% | 0.011 | ||
| Conservative | 39/68.42 | 15/41.67 | |
| Surgical | 18/31.58 | 21/58.33 | |
| Pain location n/% | 0.241 | ||
| Unilateral | 34/59.65 | 17/47.22 | |
| Bilateral | 23/40.35 | 19/52.78 | |
| Lumbar segment n/% | 0.174 | ||
| L4/L5 | 32/56.14 | 15/41.67 | |
| L5/S1 | 25/43.86 | 21/58.33 | |
| VAS (score) | 3.79 ± 2.43 | 7.64 ± 1.93 | < 0.001 |
| JOA (score) | 17.95 ± 7.93 | 8.03 ± 6.76 | < 0.001 |
| ODI (%) | 26.93 ± 22.64 | 56.39 ± 21.43 | < 0.001 |
Note: Measurement data are expressed as mean ± standard deviations (SD). p < 0.05 means a significant difference. The bolded values indicate significant differences.
Abbreviations: BMI, body mass index; JOA, Japanese Orthopedic Association score; LDH, lumbar disc herniation; ODI, Oswestry Disability Index; VAS, visual analogue scale.
3.4. Relationship Between Serum LINC00638 and Prognosis of LDH Patients
Serum LINC00638 levels were markedly lower in the poor prognosis group than in the good prognosis group (p < 0.001, Figure 3A).
FIGURE 3.
The serum LINC00638 levels in good and poor prognosis groups (A). The factors influencing the occurrence of poor prognosis in LDH patients (B). ***p < 0.001.
A multifactorial logistic regression analysis using the stepwise forward method showed that increased VAS scores [odds ratio (OR) = 4.288] and ODI scores (OR = 3.229), along with decreased serum LINC00638 levels (OR = 0.176) and JOA scores (OR = 0.295), were associated with a higher risk of adverse prognosis in LDH patients (p < 0.05), thus serving as risk factors for poor prognosis. Although a comparative analysis revealed that the proportion of patients receiving surgical treatment was significantly higher in the poor prognosis group than in the good prognosis group, after adjusting for multiple factors, the impact of treatment methods on prognosis did not reach a statistically significant level (Figure 3B). It is hypothesized that this may be due to limitations in the sample size and the lack of a stratified analysis of surgical timing or procedure types. These insufficiently controlled confounding factors may interfere with accurately determining the association between treatment methods and prognosis, and this association specifically needs to be further validated through stratified studies with larger sample sizes in the future.
3.5. Effect of LINC00638 on Senescence of hNPCs
Compared with the control group, TNF‐α induction significantly reduced LINC00638 expression in hNPCs (p < 0.05, Figure 4A). Furthermore, TNF‐α induction led to a marked inhibition of the proliferative capacity of hNPCs (p < 0.05, Figure 4B), along with a significant increase in both the apoptotic rate (p < 0.001, Figure 4C), relative protein level of the cellular senescence marker p16‐INK4A (p < 0.001, Figure 4D), and the activity of SA‐β‐gal (p < 0.01, Figure 4E). Concurrently, there was a notable elevation in the levels of inflammatory cytokines IL‐1β, IL‐6, and IFN‐γ (p < 0.05, Figure 4F), as well as an increase in the oxidative stress marker MDA, while SOD activity was significantly diminished in hNPCs (p < 0.01, Figure 4G).
FIGURE 4.
The levels of LINC00638 (A), cell proliferation (B), apoptosis (C), p16‐INK4A protein level (D), SA‐β‐gal activity (E), inflammatory cytokines (F), as well as oxidative stress marker (G) in the TNF‐α induction group and LINC00638 overexpression group in the hNPCs model. *p < 0.05; **p < 0.01; ***p < 0.001 versus the control group. # p < 0.05; ## p < 0.01; ### p < 0.001 versus the TNF‐α induction group.
Overexpression of LINC00638 in TNF‐α‐induced hNPCs significantly restored LINC00638 levels (p < 0.01, Figure 4A), which directly confirms that the oe‐LINC00638 vector was successfully transfected into hNPCs and exerted its overexpression effect. This overexpression also led to a significant recovery of the proliferative activity of hNPCs (p < 0.01, Figure 4B), while the apoptotic rate (p < 0.001, Figure 4C), p16‐INK4A protein level (p < 0.001, Figure 4D), and SA‐β‐gal activity (p < 0.05, Figure 4E) were effectively reduced. Additionally, ELISA results indicated that the levels of inflammatory cytokines and oxidative stress markers in hNPCs were significantly restored (p < 0.05, Figure 4F,G).
3.6. Serum miR‐185‐5p Levels and Its Relationship With LINC00638
Serum miR‐185‐5p expression levels were significantly higher in LDH patients than in controls (p < 0.001, Figure 5A) and negatively correlated with serum LINC00638 levels (p < 0.001, Figure 5B).
FIGURE 5.
The serum miR‐185‐5p levels in control and LDH groups (A), and the correlation between serum LINC00638 and miR‐185‐5p (B). The binding sites of LINC00638 and miR‐185‐5p (C). The dual luciferase activity of LINC00638 regulated by miR‐185‐5p (D). *p < 0.05; ***p < 0.001.
Bioinformatics predicted a potential binding site between LINC00638 and miR‐185‐5p (Figure 5C). The miR‐185‐5p mimics and inhibitors can respectively achieve the overexpression and silencing of miR‐185‐5p. The dual luciferase reporter gene assay demonstrated that overexpression of miR‐185‐5p significantly reduced the luciferase activity of wild‐type LINC00638 compared to the control (p < 0.05), whereas silencing of miR‐185‐5p significantly enhanced its activity (p < 0.001). Notably, neither the overexpression nor silencing of miR‐185‐5p exhibited a significant effect on the mutant LINC00638 (p > 0.05, Figure 5D).
3.7. Effect of Simultaneous Overexpression of LINC00638 and miR‐185‐5p on Senescence of hNPCs
TNF‐α induction significantly increases miR‐185‐5p levels in hNPCs (p < 0.01). In this induced model, LINC00638 overexpression significantly reduced hNPC miR‐185‐5p levels compared with the TNF‐α group (p < 0.05). Furthermore, the concurrent overexpression of both LINC00638 and miR‐185‐5p significantly restored miR‐185‐5p levels in the cells (p < 0.001, Figure 6A), indicating the effective transfection of the miR‐185‐5p mimic.
FIGURE 6.
The levels of miR‐185‐5p (A), cell proliferation (B), apoptosis (C), p16‐INK4A protein level (D), SA‐β‐gal activity (E), inflammatory cytokines (F), as well as oxidative stress marker (G) in the LINC00638 and miR‐185‐5p co‐overexpression group in the hNPCs model. ***p < 0.01 versus the control group. # p < 0.05 versus the TNF‐α induction group. & p < 0.05; &&& p < 0.001 versus the TNF‐α + oe‐LINC00638 group.
In the TNF‐α‐induced model, the concurrent overexpression of LINC00638 and miR‐185‐5p effectively counteracted the promoting effect of LINC00638 on the hNPCs' proliferation (p < 0.05, Figure 6B). Compared with the LINC00638 overexpression alone group, the simultaneous overexpression of both LINC00638 and miR‐185‐5p resulted in an increase in cell apoptosis (p < 0.001, Figure 6C), updated p16‐INK4A protein level (p < 0.001, Figure 6D), and enhanced SA‐β‐gal activity (p < 0.01, Figure 6E). Furthermore, this dual overexpression led to increased release of pro‐inflammatory cytokines, including IL‐1β, IL‐6, and IFN‐γ, in hNPCs, alongside an increase in MDA secretion. Notably, there was a reduction in SOD activity, which further intensified intracellular inflammation and oxidative stress damage (p < 0.05, Figure 6F,G).
Four databases returned 137, 14 787, 385, and 2252 candidate genes respectively. Cross‐analysis of miR‐185‐5p candidate target genes yielded 112 core candidate target genes (Figure 7A). KEGG enrichment analysis showed these genes were significantly enriched in LDH‐related pathways: p53 signaling pathway (cell aging), axon guidance/regulation of actin cytoskeleton pathways (inflammation/oxidative stress), and tight junction pathway (cell matrix homeostasis) (Figure 7B). PPI network analysis of core candidate target genes revealed 112 nodes and 281 edges (PPI enrichment p < 0.01, average node degree 5.02), and 5 core genes were screened by node degree: CDC42 (degree = 29), APP (degree = 18), CAPZB (degree = 15), TJP1 (degree = 14), DLG2 (degree = 13) (Figure 8); among them, CDC42 (cell aging pathway) and APP (inflammatory signaling) were closely related to hNPCs function, suggesting they might be key downstream target mRNAs of miR‐185‐5p.
FIGURE 7.
miR‐185‐5p target gene prediction (A) and KEGG enrichment analysis (B).
FIGURE 8.
PPI network of miR‐185‐5p candidate target genes.
4. Discussion
LDH represents a significant contributor to the global burden of nonfatal diseases [16], with its incidence and recurrence rates rising steadily and affecting increasingly younger populations, thus emerging as a pressing public health concern [17]. Current clinical evaluation of LDH primarily relies on MRI/CT imaging and clinical scoring systems, which may lead to the under‐recognition of early microdegeneration or an elevated risk of overdiagnosis [18]. While existing therapeutic interventions can alleviate symptoms, they fail to halt the pathological progression of intervertebral disc degeneration [3]. Consequently, there is an urgent necessity to investigate novel molecular targets that could enhance clinical assessment and treatment efficacy.
Recent studies have underscored the multidimensional potential of lncRNAs in the clinical diagnosis and management of LDD [19], providing promising avenues for early diagnosis, prognosis prediction, and targeted therapeutic strategies. LDD can lead to the herniation of nucleus pulposus tissue, which may compress the nerve root or spinal cord and thereby trigger LDH. Notably, OIP5‐AS1 has been found to be highly expressed in degenerated disc tissues, and its expression levels are positively correlated with the Pfirrmann score, a metric that reflects disease severity [20]. Similarly, ZFAS1 is up‐regulated in both degenerated intervertebral disc tissues and serum, and its elevated levels are associated with a higher risk of poor prognosis and heightened disease severity [21, 22]. As mentioned earlier, in oncology, LINC00638 has been described as an “accomplice” in the progression of malignant tumors, and its high expression is associated with reduced survival rates [5, 6]. Conversely, in inflammatory and degenerative diseases, down‐regulation of LINC00638 is significantly associated with disease activity, immune inflammation, and oxidative stress [7], and it is involved in regulating various cellular processes, including cell behavior, biosynthesis, and metabolism [9]. In the present study, serum LINC00638 was found to be down‐regulated in LDH patients, and its expression showed a gradient correlation with disease severity. LINC00638 exhibited good diagnostic efficacy for LDH, which is consistent with the findings reported in RA [7]. Furthermore, decreased serum LINC00638 levels were identified as a risk factor for poor prognosis in LDH patients, and they were significantly associated with outcomes related to pain relief, neurological recovery, and the ability to perform activities of daily living. This underscores the potential utility of LINC00638 in evaluating the condition and prognosis of individuals affected by LDH. In this study, the logistic regression prognostic model of LDH only included serum LINC00638 levels and commonly used clinical indicators. While these factors are clearly associated with prognosis, there are limitations. The preliminary study had a limited sample size and scope for variable screening, which meant that basic diseases (such as diabetes and hypertension), lifestyle factors (such as sedentary behavior and exercise frequency), and specific types of LDH (such as the paracentral and central types) were not covered. This affected the efficiency with which the model could be predicted and interpreted. In future, we will increase the sample size, incorporate the aforementioned variables and compare Cox regression, random forest and other methods to optimize the model. This will lay the groundwork for developing a practical LDH prognostic assessment tool.
The functional state of hNPCs is intricately linked to intervertebral disc degeneration, which in turn affects the progression of LDH [15]. During disc degeneration, hNPCs re secrete various inflammatory mediators that not only intensify the local inflammatory microenvironment but also impair hNPCs' function, forming a vicious cycle that strongly drives LDH development [23]. Research has shown that LINC00638 exerts anti‐inflammatory and antioxidant properties by activating the Nrf2/HO‐1 signaling pathway, thereby modulating the disease trajectory [24]. In vitro studies on RA have demonstrated that the overexpression of LINC00638 mitigates inflammatory responses and oxidative stress [8]. In the present study, a model of senescence injury in hNPCs was successfully established, which was characterized by inhibited cell proliferation, enhanced apoptosis and senescence, and exacerbated inflammation and oxidative stress. Notably, additional overexpression of LINC00638 restored hNPCs' function and significantly inhibited their senescence. It is posited that LINC00638 may prevent hNPCs' apoptosis and senescence by alleviating inflammatory damage and oxidative stress, thereby maintaining the stability of the intracellular environment.
Elucidating the mechanism by which lncRNAs act as endogenous sponges or ceRNAs via interactions with miRNAs has opened new directions for epigenetic research [25]. Bioinformatics analyses have identified miR‐185‐5p as a core gene and potential target for LDD identification, and it can regulate processes including apoptosis, inflammatory responses, and extracellular matrix metabolism [26]. Previous studies have demonstrated that miR‐185‐5p is up‐regulated in degenerated nucleus pulposus tissues and in OA patients, where it targets genes or pathways related to apoptosis and inflammation, thereby promoting apoptosis in hNPCs [12, 13]. At the clinical level, serum levels of miR‐185‐5p in LDH patients were significantly higher than in the healthy control group. A dual luciferase reporter assay confirmed that miR‐185‐5p directly targets LINC00638, suggesting that it may be a downstream effector molecule of LINC00638. At the cellular level, the expression of miR‐185‐5p was significantly increased in the TNF‐α‐induced aging model of hNPCs, while the overexpression of LINC00638 reduced its level. Co‐transfection of miR‐185‐5p mimetics reversed the promoting effect of LINC00638 on hNPCs proliferation, as well as its inhibitory effects on apoptosis, aging, inflammation and oxidative stress. This confirms that miR‐185‐5p is a key mediator in the regulation of hNPCs aging by LINC00638. Studies on miR‐185‐5p target genes, KEGG enrichment and PPI network further strengthened the mechanistic association between LINC00638 and miR‐185‐5p: 112 core target genes were identified, and their enriched KEGG pathways were closely linked to LDH pathological processes (cell aging, inflammation, cell matrix homeostasis); PPI network screened core genes CDC42 and APP, which are critical for hNPCs function. This indicates LINC00638 may regulate hNPCs aging, inflammatory response and oxidative stress balance by modulating the miR‐185‐5p‐CDC42/APP axis, thereby participating in LDH pathological progression, providing a more comprehensive mechanistic basis for the study's conclusions. The results of this study align with the conclusions of previous studies, collectively supporting the concept of the “miR‐185‐5p, regulated by LINC00638, targeting multiple genes, influencing multiple pathways, and mediating the ageing and inflammation of hNPCs” functional chain.
However, this study has certain limitations: experiments were primarily conducted at the cellular level, failing to fully replicate the complexities of the in vivo environment. Future research should involve developing a mouse model of intervertebral disc degeneration to further validate the biological roles of LINC00638 and miR‐185‐5p. Subsequent plans include detecting the expression levels of LINC00638 and miR‐185‐5p in the intervertebral disc tissues of the model mice, observing the effects of overexpression/knockdown of LINC00638 on intervertebral disc degeneration (nucleus pulposus cell number, extracellular matrix) and neurological symptoms (hyperalgesia), and using histological staining and immunofluorescence to clarify the regulatory role of this axis in the body on the senescence, inflammation and oxidative stress of nucleus pulposus cells, providing a basis for clinical translation. Other senescence biomarkers (e.g., γH2AX, SASP cytokines) are of great significance for exploring the aging mechanism of hNPCs, and it is planned to detect these biomarkers in subsequent studies using retained samples to better clarify the role of the LINC00638/miR‐185‐5p axis in regulating hNPCs senescence. Additionally, further exploration of the downstream target genes and associated signaling pathways of miR‐185‐5p is required to deepen the understanding of the molecular mechanisms underlying LINC00638‐mediated regulation of hNPCs senescence. This study focuses on the prognostic significance and cellular regulatory mechanisms of LINC00638 in LDH and is currently in the preliminary exploration stage. Due to the limitations of the sample range from a single center, ROC analysis of serum LINC00638 for diagnosing LDH has only been completed through the study cohort and has not yet been verified in an independent validation cohort. This is a limitation in this study. In the future, multicenter studies will be conducted using multiple sample sources, and an independent validation cohort will be established to verify the reliability of the biomarker through repeated analysis of its ROC curve characteristics. Although the sample size of this study was determined by G * Power, there were only 36 cases in the poor prognosis group among 93 LDH patients. The sample size was further reduced during subgroup analysis, which reduced statistical efficiency and made it difficult to conduct detailed analysis. In the future, the sample size will be expanded (especially by increasing the proportion of subgroups), the follow‐up time will be extended (collecting long‐term prognostic events), and stratified analysis will be conducted based on a large sample to refine the application scenarios of biomarkers. In addition, this study was only based on serum sample detection and did not analyze the expression of biomarkers in surgically resected intervertebral disc tissues (nucleus pulposus, annulus fibrosus), which cannot accurately correlate with local pathological processes. Subsequently, tissue samples will be collected to analyze the correlation and localization distribution between LINC00638/miR‐185‐5p and degeneration grading, verify the consistency between serum indicators and local pathology, and provide direct evidence for reflecting internal disc lesions.
In summary, our findings indicate that serum LINC00638 holds promise as a valuable adjunctive biomarker for the early diagnosis of LDH. Continuous monitoring of LINC00638 levels may aid in predicting disease progression and prognostic outcomes. Furthermore, the regulatory axis involving LINC00638 and miR‐185‐5p presents a novel target for the development of targeted therapeutic interventions for LDH.
Conflicts of Interest
The authors declare no conflicts of interest.
Acknowledgments
The authors have nothing to report.
Wang Z., Liu J., Sun Y., et al., “The Prognostic Significance of LINC00638 in Lumbar Disc Herniation and Its Effect on Senescence of Nucleus Pulposus Cells,” JOR Spine 8, no. 4 (2025): e70138, 10.1002/jsp2.70138.
Funding: This work was supported by the Key R&D Projects in Ningxia Hui Autonomous Region, China (No. 2022BEG03086) and the Major Scientific and Technological Achievement Transformation Projects in the Autonomous Region (No. 2022CJE09010).
Data Availability Statement
The original data volume is quite large, and some data that involve details not publicly disclosed by the research need to be temporarily kept confidential. Currently, all the original data has been properly saved in the laboratory data management system in accordance with the regulations. The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
- 1. Yu P., Mao F., Chen J., et al., “Characteristics and Mechanisms of Resorption in Lumbar Disc Herniation,” Arthritis Research & Therapy 24, no. 1 (2022): 205, 10.1186/s13075-022-02894-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Hincapié C. A., Kroismayr D., Hofstetter L., et al., “Incidence of and Risk Factors for Lumbar Disc Herniation With Radiculopathy in Adults: A Systematic Review,” European Spine Journal 34, no. 1 (2025): 263–294, 10.1007/s00586-024-08528-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Zileli M., Oertel J., Sharif S., and Zygourakis C., “Lumbar Disc Herniation: Prevention and Treatment of Recurrence: WFNS Spine Committee Recommendations,” World Neurosurgery: X 22 (2024): 100275, 10.1016/j.wnsx.2024.100275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Ferrer J. and Dimitrova N., “Transcription Regulation by Long Non‐Coding RNAs: Mechanisms and Disease Relevance,” Nature Reviews. Molecular Cell Biology 25, no. 5 (2024): 396–415, 10.1038/s41580-023-00694-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Wang B., Chen L., Li Q., Zhou J., and Jin W., “LINC00638/Hsa‐miR‐29b‐3p Axis‐Mediated High Expression of CDCA4 Correlates With Tumor Immune Infiltration and Hepatocellular Carcinoma Progression,” Translational Cancer Research 12, no. 5 (2023): 1290–1306, 10.21037/tcr-23-569. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Zhang J., Mou Y., Li H., Shen H., Song J., and Li Q., “LINC00638 Promotes the Progression of Non‐Small Cell Lung Cancer by Regulating the miR‐541‐3p/IRS1/PI3K/Akt Axis,” Heliyon 9, no. 6 (2023): e16999, 10.1016/j.heliyon.2023.e16999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Sun Y., Liu J., Zhou Q., Chen X., Ding X., and Zhang X., “Expression of LINC00638 in Rheumatoid Arthritis Patients With Damp‐Heat Obstruction Syndrome and the Regulatory Mechanisms for Inflammation and Oxidative Stress,” Zhong nan Da Xue Xue Bao Yi Xue Ban = Journal of Central South University Medical Sciences 47, no. 2 (2022): 183–193, 10.11817/j.issn.1672-7347.2022.210376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Sun Y., Liu J., Xin L., et al., “The Low Expression of Long Non‐Coding RNA Linc00638 Contributes to Rheumatoid Arthritis Progression by Regulating Inflammation and Oxidative Stress,” Nan Fang Yi Ke da Xue Xue Bao = Journal of Southern Medical University 41, no. 7 (2021): 965–971, 10.12122/j.issn.1673-4254.2021.07.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Zhang Y. H., Song J., Shen L., and Shao J., “Systematic Identification of lncRNAs and circRNAs‐Associated ceRNA Networks in Human Lumbar Disc Degeneration,” Biotechnic & Histochemistry 94, no. 8 (2019): 606–616, 10.1080/10520295.2019.1622782. [DOI] [PubMed] [Google Scholar]
- 10. Zheng Y. L., Song G., Guo J. B., et al., “Interactions Among lncRNA/circRNA, miRNA, and mRNA in Musculoskeletal Degenerative Diseases,” Frontiers in Cell and Developmental Biology 9 (2021): 753931, 10.3389/fcell.2021.753931. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Jia D., Li Y., Han R., et al., “miR‐146a‐5p Expression Is Upregulated by the CXCR4 Antagonist TN14003 and Attenuates SDF‐1‐Induced Cartilage Degradation,” Molecular Medicine Reports 19, no. 5 (2019): 4388–4400, 10.3892/mmr.2019.10076. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Guo W., Zhang B., Sun C., et al., “Circular RNA Derived From TIMP2 Functions as a Competitive Endogenous RNA and Regulates Intervertebral Disc Degeneration by Targeting miR‐185‐5p and Matrix Metalloproteinase 2,” International Journal of Molecular Medicine 46, no. 2 (2020): 621–632, 10.3892/ijmm.2020.4621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Zhang H., Zhang M., Meng L., et al., “Investigation of Key miRNAs and Their Target Genes Involved in Cell Apoptosis During Intervertebral Disc Degeneration Development Using Bioinformatics Methods,” Journal of Neurosurgical Sciences 66, no. 2 (2022): 125–132, 10.23736/s0390-5616.20.04773-6. [DOI] [PubMed] [Google Scholar]
- 14. Introduction to the Essence of Clinical Practice Guidelines for Lumbar Disc Herniation, 2021,” Spine Surgery and Related Research 6, no. 4 (2022): 318, 10.22603/ssrr.2022-0113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. He Z., Zheng N., Guo X. Q., Wang G. G., and Lin M., “Effects of Hsa‐miR‐4741/LILRB2 on Senescence of Nucleus Pulposus Cells and Their Prognostic Values in Lumbar Disc Herniation,” Journal of Investigative Surgery 38, no. 1 (2025): 2458180, 10.1080/08941939.2025.2458180. [DOI] [PubMed] [Google Scholar]
- 16. Wang L., He T., Liu J., et al., “Revealing the Immune Infiltration Landscape and Identifying Diagnostic Biomarkers for Lumbar Disc Herniation,” Frontiers in Immunology 12 (2021): 666355, 10.3389/fimmu.2021.666355. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Mizoguchi Y., Akasaka K., Suzuki K., Kimura F., Hall T., and Ogihara S., “Construct Validation of the Japanese Core Outcome Measures Index and the Impact of Diseases on Patient‐Reported Outcome Measures in Preoperative Patients With Lumbar Spinal Stenosis and Disk Herniation: A Single‐Center Observational Study,” European Spine Journal 33, no. 6 (2024): 2198–2205, 10.1007/s00586-024-08148-2. [DOI] [PubMed] [Google Scholar]
- 18. Martel Villagrán J., Martínez‐Sánchez R. T., Cebada‐Chaparro E., Bueno Horcajadas A. L., and Pérez‐Fernández E., “Diagnostic Accuracy of Lumbar CT and MRI in the Evaluation of Chronic Low Back Pain Without Red Flag Symptoms,” Radiología 65, no. S2 (2023): S59–S70, 10.1016/j.rxeng.2023.02.004. [DOI] [PubMed] [Google Scholar]
- 19. Ran R., Liao H. Y., Wang Z. Q., Gong C. Y., Zhou K. S., and Zhang H. H., “Mechanisms and Functions of Long Noncoding RNAs in Intervertebral Disc Degeneration,” Pathology, Research and Practice 235 (2022): 153959, 10.1016/j.prp.2022.153959. [DOI] [PubMed] [Google Scholar]
- 20. Che Z., Xueqin J., and Zhang Z., “LncRNA OIP5‐AS1 Accelerates Intervertebral Disc Degeneration by Targeting miR‐25‐3p,” Bioengineered 12, no. 2 (2021): 11201–11212, 10.1080/21655979.2021.2007697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Deng R. Y., Hong T., Li C. Y., et al., “Long Non‐Coding RNA Zinc Finger Antisense 1 Expression Associates With Increased Disease Risk, Elevated Disease Severity and Higher Inflammatory Cytokines Levels in Patients With Lumbar Disc Degeneration,” Medicine 98, no. 52 (2019): e18465, 10.1097/md.0000000000018465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Xue W., Song Y., Niu J., and Guan X., “Predictive Value of lncRNA ZFAS1 in Patients With Lumbar Disc Degeneration,” American Journal of Translational Research 13, no. 11 (2021): 12549–12556. [PMC free article] [PubMed] [Google Scholar]
- 23. Pravdyuk N. G., Novikova A. V., Shostak N. A., et al., “Immunomorphogenesis in Degenerative Disc Disease: The Role of Proinflammatory Cytokines and Angiogenesis Factors,” Biomedicine 11, no. 8 (2023): 2184, 10.3390/biomedicines11082184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Sun Y., Liu J., Wen J., et al., “Overexpression of Long Noncoding RNA LINC00638 Inhibits Inflammation and Oxidative Stress in Rheumatoid Arthritis Fibroblast‐Like Synoviocytes by Regulating the Nrf2/HO‐1 Pathway,” Immunity, Inflammation and Disease 10, no. 7 (2022): e663, 10.1002/iid3.663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Panni S., Lovering R. C., Porras P., and Orchard S., “Non‐Coding RNA Regulatory Networks,” Biochimica et Biophysica Acta, Gene Regulatory Mechanisms 1863, no. 6 (2020): 194417, 10.1016/j.bbagrm.2019.194417. [DOI] [PubMed] [Google Scholar]
- 26. Li J., Yu C., Ni S., and Duan Y., “Identification of Core Genes and Screening of Potential Targets in Intervertebral Disc Degeneration Using Integrated Bioinformatics Analysis,” Frontiers in Genetics 13 (2022): 864100, 10.3389/fgene.2022.864100. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The original data volume is quite large, and some data that involve details not publicly disclosed by the research need to be temporarily kept confidential. Currently, all the original data has been properly saved in the laboratory data management system in accordance with the regulations. The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.