Summary
The female genital tract microbiome is essential for health. This study investigated the endometrial microbiota in endometrial cancer (EC) patients and explored their role in disease progression. We collected samples from patients with benign uterine conditions, endometrial hyperplasia, and EC. Microbial diversity was analyzed using 16S sequencing. The effects of Atopobium vaginae on macrophage phagocytosis, polarization, and EC progression were examined in vitro and in vivo. Atopobium vaginae was significantly upregulated in EC and hyperplasia patients, correlating with increased levels of inflammatory cytokines IL-6 and IL-10. Experiments demonstrated that Atopobium vaginae inhibited macrophage phagocytosis, promoted M2 polarization, and increased tumor size, thereby advancing EC progression. Our findings highlight Atopobium vaginae as a key factor in EC progression by regulating macrophage function and inflammatory cytokines. The study provides new insights into EC pathogenesis and reveals potential therapeutic avenues.
Subject areas: health science
Graphical abstract

Highlights
-
•
Microbial profiles differ in endometrial cancer (EC); Atopobium is a key EC genus
-
•
Atopobium impairs EC macrophage phagocytosis and promotes M2 polarization
-
•
Atopobium contributes to the progression of EC cancer
health science
Introduction
The human microbiota, a complex network of microbial population and present in various parts of the human body and involved in numerous vital life processes, including growth, metabolism, and immune function, has a bearing on both human health and disease.1 A growing body of studies has demonstrated intricate connections between microbiota and cancer development, suggesting the presence and activity of microbiota as well as their metabolites are crucial factors that could lead to cancer.2 As previous studies have found, Porphyromonas gingivalis and Fusobacterium nucleatum accelerate tumor growth in mice with oral cancer.3 Shintaro Okumura’s group also found that the rise in the metabolite butyrate, a metabolic product of Porphyromonas asaccharolytica and Porphyromonas gingivalis, can induce incidence of colorectal tumors.4 Carcinogenic bacteria and viruses may directly exert their carcinogenic effects by expressing toxins that damage the host’s DNA or by integrating oncogenes into the host genome.5 These studies underscore the instrumental role of microorganisms and their metabolites in promoting cancer development and progression. The components of the microbiota in the host and their effects on the physiological changes of cancer hosts, once unveiled, would offer new scientific grounds for targeted cancer treatments.
Endometrial cancer (EC), the most frequent epithelial malignant tumor affecting the endometrium, is showing an upward trend in its incidence globally.6 Though many patients with EC enjoy a relatively good five-year survival rate of up to 77%, the condition could swiftly progress to the terminal phase after a relapse.6,7,8 Obesity, unopposed estrogen exposure, and inflammation have been acknowledged as principal risk factors that contribute to EC development.9,10 The function of microbes in the occurrence and development of EC has also been shed light on in recent studies. For example, research by Marina RS Walther-António and others found that microbial groups such as Actinobacteria (Atopobium vaginae) and Bacteroidetes (Bacteroides and Porphyromonas) are significantly associated with EC occurrence.11 Furthermore, Porphyromonas sp has been found to be implicated in the progression of oral cancer by suppressing macrophage phagocytosis and inducing an M2 macrophage polarization to shield cancer cells from macrophage assault.12 Excessive proliferation of Atopobium vaginae can abrupt the microbial balance, triggering bacterial vaginosis.13,14 While some microbial communities have been discovered to associate with the progression of EC, the underlying mechanisms are still not clear. This study endeavors to delve deeper into the distribution and structural composition of the microbial communities, seeking to uncover their roles in the disease progression and to provide new theoretical underpinnings for EC therapeutics.
With gathered endometrial and blood specimens from patients with benign uterine diseases, endometrial hyperplasia, or EC, we analyzed through 16S sequencing the variations in endometrial microbiome across these health states. Then we moved on to validate the influence of Atopobium vaginae on macrophage polarization and phagocytosis in EC via in vitro and in vivo experiments. These findings are expected to advance our understanding of the mechanisms underlying EC and offer potential treatment perspectives for those affected by this disease.
Results
Variations both in uterine microbial distribution and inflammatory cytokines profiles
Our study sought to uncover the distinctions in the microbial makeup across sampling locations (uterine cavity, cervix, and vagina) in the cases of benign uterine diseases, endometrial hyperplasia, and EC. All samples were subjected to 16S sequencing for detailed analysis. Results from the α diversity analysis indicated that the microbial diversity at all sampling sites in EC was comparable to that in endometrial hyperplasia, and both were obviously higher than in benign uterine diseases (p < 0.05) (Figures 1A, S1, and S2). The β diversity analysis demonstrated that the structure of uterine endometrial communities both in the endometrial hyperplasia and EC groups was similar across all sites, yet distinct from other uterine disease groups (p < 0.05) (Figures 1B, S1, and S2). These results aligned with the α-diversity findings, confirming that the microbial distribution was similar between the EC and endometrial hyperplasia groups, while being different from other uterine disease groups.
Figure 1.
Microbial diversity and composition in the endometrial of benign uterine conditions, hyperplasia, and EC
(A) Assessment of α diversity among benign, hyperplasia, and EC samples.
(B) Assessment of β diversity among benign, hyperplasia, and EC samples.
(C) A stacked bar chart depicting the relative microbial abundance in the various disease samples. benign uterus: group for other uterine diseases; endometrial hyperplasia: group for endometrial hyperplasia; endometrial carcinoma: group for EC.
We conducted a detailed analysis of the microbial composition across different uterine sites (uterine cavity, cervix, and vagina) in individuals with benign uterine diseases and EC. In the endometrial cavity, the benign uterine disease group was dominated by Acinetobacter, Lactobacillus, Methyloversatilis, and Ochrobactrum, while the endometrial hyperplasia and EC groups showed a higher presence of Atopobium vaginae, Pseudomonas, Sphingomonas, and Gardnerella. The cervix samples from the benign uterine disease group were mainly defined by Lactobacillus, Gardnerella, Ralstonia, and Dietzia, compared to the endometrial hyperplasia and EC groups, which were largely populated by Atopobium vaginae, Rhodococcus, and Pseudomonas. Vaginal microbial communities in the benign uterine disease group were predominantly Gardnerella, Prevotella, Corynebacterium, and Dietzia, whereas the endometrial hyperplasia and EC groups were characterized by Atopobium vaginae, Lactobacillus, Ureaplasma, and Rhodococcus (Figure 1C; Figures S1 and S2). Based on our findings and prior research, we proposed that Atopobium vaginae may be correlated with the development of EC, and we further explored its role in EC in subsequent studies.
To evaluate the immune environment across varying uterine states, we measured the expression levels of various inflammatory cytokines. It was found that the expression levels of inflammatory cytokines (IL-6 and IL-10) in the blood samples of patients with EC and endometrial hyperplasia were significantly higher than those in the benign uterine disease group (Figure 2).
Figure 2.
Comparative expression of inflammatory cytokines in samples from different disease states
(A) IL-6 expression levels (n = 3, independent experiments, mean ± SD; ∗∗p < 0.01, ∗∗∗p < 0.001; one-way ANOVA).
(B) IL-10 expression levels (n = 3, independent experiments, mean ± SD; ∗∗p < 0.01; one-way ANOVA).
Atopobium vaginae inhibits phagocytosis and facilitates M2 polarization of macrophages
Studies have previously revealed a strong link between the enrichment of Atopobium vaginae and the development of EC, with Atopobium vaginae enrichment being able to induce the expression of inflammatory cytokines in endometrial cells.11,15 The specific mechanism by which Atopobium vaginae influences EC, however, was not well-defined. In the preliminary phase, 16S PCR was performed to quantify bacterial loads after heat inactivation. The results demonstrated that the heat-inactivated group exhibited a lower bacterial burden compared to the control group, as indicated by higher Ct values (Figure 3A). In this study, we infected the KLE cell line with Atopobium vaginae and co-cultured it with THP-1-derived macrophages to examine the effects on macrophage polarization and phagocytosis. Flow cytometry results indicated that Atopobium vaginae infection led to a marked reduction in the percentage of macrophages engulfing KLE cells compared to the PBS-treated group (Figure 3B), implying that Atopobium vaginae might suppress macrophage-mediated phagocytosis of KLE cancer cells. It was also found that the proportion of M2 was significantly elevated in the Atopobium vaginae group (Figure 3D), suggesting the role of Atopobium vaginae in driving M2 macrophage polarization. Subsequent ELISA detection confirmed that treatment with Atopobium vaginae led to a significant upregulation in the levels of inflammatory cytokines (IL-6 and IL-10) compared to the PBS group (Figures 3F and 3G), highlighting that Atopobium vaginae can stimulate inflammatory cytokine expression. ARK1 is a serous EC cell line commonly used in cancer research.16,17,18 After infection of the ARK1 cell line with Atopobium vaginae and subsequent co-culture with THP-1-derived macrophages, experimental results consistent with those observed in KLE cells were obtained (Figures 3C and 3E–3G). These findings led us to a conclusion that Atopobium vaginae can dampen macrophage phagocytosis, while also promote the expression of inflammatory cytokines and the M2 polarization of macrophages (Figure 3H).
Figure 3.
The effects of Atopobium vaginae on macrophages
(A) 16S-PCR test of Atopobium vaginae abundance (n = 3, independent experiments, mean ± SD; ∗∗∗∗p < 0.0001; t test).
(B) Proportion of macrophages that engulfed KLE cells (PerCP+CFSE+, Q2) (n = 3, independent experiments, mean ± SD; ∗∗∗p < 0.001; t test).
(C) Proportion of macrophages that engulfed ARK1 cells (PerCP+CFSE+, Q2) (n = 3, independent experiments, mean ± SD; ∗∗∗∗p < 0.0001; t test).
(D and E) Proportion of M2 macrophages (APC+PE−, Q1) (n = 3, independent experiments, mean ± SD; ∗∗∗∗p < 0.0001; t tests).
(F and G) Expression of IL-6 and IL-10 (n = 3, independent experiments, mean ± SD; ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; t tests).
(H) Schematic diagram of Atopobium vaginae colonization to promote EC malignant progression.
Atopobium vaginae promotes phagocytosis of macrophages and immune infiltration in EC mice
Extending our research on the influence of Atopobium vaginae on macrophage behavior, we established an EC mouse model and administered Atopobium vaginae. The cancer progression was tracked by periodically measuring the tumor volumes. The data revealed that the tumor volume was significantly increased in the Atopobium vaginae-treated group at 14–18 days post-treatment compared with the PBS-treated group (Figure 4A). This result implied that Atopobium vaginae could promote the malignant progression of EC.
Figure 4.
The influence of Atopobium vaginae in EC mice
(A) Determination of tumor volume in EC mice within different treatment groups (n = 6 per group, mean ± SD; ∗p < 0.05, ∗∗p < 0.01; t tests).
(B and C) Assessment of macrophage polarization in EC mice via flow cytometry for each treatment group (n = 3 per group, mean ± SD; ∗p < 0.05; t tests).
(D) ELISA analysis of anti-inflammatory cytokine levels in EC mice under various treatment conditions (n = 3, animals per group, mean ± SD; ∗∗∗∗p < 0.0001; t tests).
We proceeded with flow cytometry to investigate the polarization of macrophages in EC mice from different treatment groups. The results indicated that the proportion of M2 in the endometrium of EC mice treated with Atopobium vaginae was significantly higher than that in the PBS group (Figures 4B and 4C). This was in line with the results from cellular experiments, further substantiating the potential of Atopobium vaginae to promote macrophage M2 polarization. ELISA also displayed that the expression of inflammatory cytokines (IL-6 and IL-10) was notably increased with Atopobium vaginae treatment compared to the PBS group (Figure 4D). These observations collectively suggested that Atopobium vaginae can facilitate M2 macrophage polarization, potentially leading to increased tumor volume and cancer progression.
Discussion
The presence of microorganisms in the human body is not only ubiquitous but also plays an integral part in shaping our health.19 Prior research has validated that the microbiota can alter the expression of host genes in multiple ways, acting as a stimulator for tumor development.20 The work of Marina R S Walther-António has pointed to a significant association that may exist between the microbial content of the vagina and EC condition.11 Nonetheless, the detailed mechanisms of the action of these microbiotas within the uterus are as yet undefined. Thus, aiming at illuminating the ties between microbiota and cancer, we need to identify the types and distribution of microbiota and probe into their mechanisms of action. This study discovered through 16S sequencing a pronounced accumulation of Atopobium vaginae in EC, which could be correlated with the emergence of EC. In vivo and in vitro experiments have corroborated the tumorigenic influence of Atopobium vaginae on EC, offering fresh theoretical frameworks for understanding the advancement of EC.
Bacteria associated with bacterial vaginosis are believed to promote carcinogenesis through microbiome-mediated pathophysiological changes.15,21 Atopobium vaginae, a bacterium from the vaginal flora, is known to trigger bacterial vaginosis due to its overgrowth,13,14 and is potentially linked to various cancers. Xu’s team22 has reported that Atopobium vaginae is more prevalent in hepatocellular carcinoma (HCC) and shows a positive correlation with IL-6 and IL-10 in HCC. Echoing this, Marina RS Walther-António’s team has also identified a notable association between certain bacteria, including Actinobacteria (Atopobium vaginae) and Bacteroidetes (Bacteroides and Porphyromonas), and the occurrence of EC events.11 In the context of cervical disease, investigations led by Kyeong A So23 and Kunwar Somesh Vikramdeo24 have reported an upsurge in microbial diversity among patients with cervical intraepithelial neoplasia or cervical cancer that is linked to HPV infection, with Atopobium vaginae being markedly associated with the risk of cervical intraepithelial neoplasia 2/3 or cervical cancer. In our research, we employed 16S sequencing, cellular assays, and murine experiments to establish that Atopobium vaginae, the major bacterial species in both the endometrial hyperplasia and EC groups, contributed to the inflammatory response and disease progression in EC. Notably, our study discovered that Atopobium vaginae possess the ability to suppress the macrophage engulfment of EC cells and encourage the shift of macrophage toward an M2 phenotype. This is an important revelation as it has not been previously reported, and our study provides evidence for this regulatory pathway.
The tumor microenvironment is prominently shaped by inflammatory cytokines, which are involved in a string of immune reactions and can feed into cancer progression.25 Over the past four decades, there has been a considerable focus on cytokines and their receptors as targets for cancer treatment or as therapeutic agents.26 Specifically, IL-6 and IL-10, key players among inflammatory cytokines, have been identified to encourage macrophage M2 polarization and modulate immune responses in the tumor microenvironment, thereby facilitating cancer progression.26,27,28 Additionally, past findings suggest that microorganisms and their metabolic products can influence key biological processes such as host immune responses, genetic damage, and apoptosis outside of the inflammation and immune system, subsequently impacting host physiology and cancer progression.2,29,30,31 Further validation of these findings comes from the research of Andrew D Foey’s group. They discovered that PG-LPS treatment can provoke a distinct modulation in macrophage subsets, namely M1 and M2, resulting in the production of the anti-inflammatory cytokine IL-10 and an increase in its natural function. This process is instrumental in the evasion of immune responses and the exacerbation of periodontitis.32 It has been recently revealed that Atopobium vaginae can provoke an inflammatory response in endometrial cells, characterized by the expression of pro-inflammatory cytokines.15 However, in the present study, Atopobium vaginae was able to enhance the expression of the anti-inflammatory cytokines IL-6 and IL-10 in a macrophage-KLE cell co-culture system. This result was likewise validated in clinical samples and results from mouse experiments. These results imply that Atopobium vaginae most likely influences EC development by modulating anti-inflammatory levels in vivo.
To conclude, this study pioneered the confirmation of the capabilities of Atopobium vaginae to impair macrophage phagocytosis, encourage macrophage M2 polarization, and trigger IL-6 and IL-10 secretion, all of which contribute to the progression of EC cancer. These findings could potentially enrich the theoretical framework of how EC develops and pave the way for more precise therapeutic strategies for EC patients.
Limitations of the study
Certainly, this study has its limitations, including the absence of an investigation into the effects of other bacteria on EC. Moreover, the potential mechanism by which Atopobium vaginae regulates macrophage M2 polarization remains unexplored. Future studies should validate our preliminary findings in larger sample sizes and investigate the expression of Atopobium across different histological types, grades, and stages of endometrial carcinoma to further elucidate its relationship with disease progression. Additionally, the study samples were limited to Asian women, which may restrict the generalizability of the findings. Given variations in factors such as diet, lifestyle, and environmental exposures, the microbiome profiles of women with EC in other regions may differ from those observed in this study. Consequently, the conclusions of this study may not be fully applicable to women in other global populations. Further studies are expected to address this gap.
Resource availability
Lead contact
Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Jiong Ma (majiong@zju.edu.cn).
Materials availability
This study did not develop any unique reagents.
Data and code availability
-
•
The raw data of 16S rRNA gene sequencing supporting the conclusion of this article have been stored in Mendeley Data: https://doi.org/10.17632/7chwt33cby.1. We ensure that it is publicly available as of the date of publication. The storage number is listed in the key resources table.
-
•
This study did not generate any new code.
-
•
Any other information required for reanalyzing the data reported in this article can be obtained from the lead contact upon request.
Acknowledgments
None.
Author contributions
All authors contributed to data analysis, drafting and revising the article, gave final approval of the version to be published, and agreed to be accountable for all aspects of the work.
Declaration of interests
The authors have no conflicts of interest to declare.
STAR★Methods
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| FITC Anti-Mouse/Human CD11b Antibody(M1/70) | Elabscience | Cat#E-AB-F1081C; RRID: AB_3102041 |
| PE Anti-Mouse CD86(GL-1) | Elabscience | Cat# E-AB-F0994D; RRID: AB_3102044 |
| PE Anti-Human CD86(BU63) | Elabscience | Cat# E-AB-F1012D |
| APC Anti-Mouse CD206(C068C2) | Elabscience | Cat# E-AB-F1135E; RRID: AB_3102045 |
| APC Anti-Human CD206(15-2) | Elabscience | Cat# E-AB-F1161E; RRID: AB_3713132 |
| Bacterial strains | ||
| Atopobium vaginae | ATCC | N/A |
| Deposited data | ||
| 16S rRNA data | This paper | Mendeley Data: https://doi.org/10.17632/7chwt33cby.1 |
| Experimental models: cell lines | ||
| KLE | ATCC | RRID: CVCL_1329 |
| THP-1 | ATCC | RRID: CVCL_0006 |
| Software and algorithms | ||
| Graphpad Prism 8 | Graphpad Prism 8 | N/A |
| Experimental models: Organisms/strains | ||
| BALB/c nude mice (female, 10 weeks old) | Chengdu Dossy Experimental Animals Co., Ltd. (China) | N/A |
Experimental model and subject details
Cell lines: Endometrial cancer cell line (KLE) and human peripheral blood mononuclear cell line (THP-1) were both purchased from ATCC (USA). The established and previously characterized ARK1 cell line was provided by Shi-Wen Jiang (Mercer University School of Medicine, Savannah, GA). KLE cells were cultured in DMEM/F12 medium (ATCC, USA); THP-1 cells were cultured in medium supplemented with 10% fetal bovine serum, 2 mM glutamine, 0.05 mM β-mercaptoethanol, 10 mM HEPES, 4500 mg/L glucose, 100 U/mL penicillin, and 100 μg/mL streptomycin. All cells were cultured at 37°C in a 5% CO2 incubator.
The Balb/c mice used in this study were purchased from Chengdu Dashuo Laboratory Animal Co., Ltd. (China). These mice were fed according to standard laboratory feeding protocols for one week.
Ethics approval and consent to participate
Animal Ethics Committee of The Second Affiliated Hospital, Zhejiang University School of Medicine, approval number (2024) 136.
Consent for publication
Written informed consent for publication was obtained from all participants.
Method details
Study population
This research involved the recruitment of 10 patients with EC, 10 with endometrial hyperplasia, and 10 with benign uterine disease who were scheduled for treatment at The Second Affiliated Hospital, Zhejiang University School of Medicine from January 2023 to December 2023 (Table S1). Eligibility criteria included: (1) age 18 years or older; (2) a confirmed pathological diagnosis of endometrial hyperplasia, EC, or benign uterine disease; (3) no prior anti-tumor treatments such as radiotherapy, chemotherapy, and uterus intact. Exclusion criteria included: (1) pregnant or breastfeeding women; (2) use of antibiotics within 2 weeks before treatment; (3) presence of other tumors or immune system diseases. All patients provided informed consent, and the study was approved by the Ethics Committee of The Second Affiliated Hospital, Zhejiang University School of Medicine, approval number: (2024) 0730.
Sample collection
In alignment with previously published research,11 the sample collection in this study was conducted in the operating room, with no preoperative prophylactic antibiotics administered to any patient. This protocol was implemented to prevent potential influences of intraoperative disinfectants or antibiotics on the microbiome. Tissue samples were obtained immediately after hysterectomy. We collected with medical-grade swabs vaginal, cervical, and uterine secretions from patients diagnosed with endometrial hyperplasia (n=10), EC (n=10), and benign uterine diseases (n=10). Patient consent was obtained before sampling. Post-collection, the samples were sent to the lab for further experiments. In addition, blood samples from these patients were obtained to evaluate the expression of their immune factors.
Bacterial genome extraction and sequencing
To elucidate the microbial composition in the endometrium of patients with varying disease conditions and to highlight the distinctions, we performed 16S sequencing on the samples. Mirroring the DNA isolation techniques from prior research,11 genomic DNA was extracted from all samples before sequencing. The samples were centrifuged at 10,000 g for 10 min to pellet bacterial cells, the supernatant was removed, and DNA was extracted using a bacterial DNA extraction kit (Beijing Solarbio Science & Technology Co., Ltd., China). Specific regions of 16S rDNA, v3-v5: Bacterial Forward Universal Primer 357 F 5′-ATGATACGGCGACCGAGATCTACACTATGGTAATTGTCCTACGGGAGGCAGCAG-3′, Bacterial Reverse Universal Primer 926R 5′-CAAGCAGAGAGACGCATCGAGAGTGCCGCATTCGATXXXXXXXXXXXXXXXX CCGTCAATTCMTTTRAGT-3’. The amplified PCR products were purified and utilized to create a cDNA library, which was then sequenced using the Illumina MiSeq platform.
Isolation and cultivation of Atopobium vaginae strains
Atopobium vaginae are part of the normal vaginal flora and have been linked to various gynecological conditions.11 As part of our research into the role of Atopobium vaginae in EC, we obtained Atopobium vaginae from the American Type Culture Collection (ATCC). Guided by the manufacturer’s instructions, the bacteria were cultured on 1.5% Brucella agar (BD Biosciences, USA) supplemented with 5% defibrinated sheep blood (Dalynn Biologicals, Canada) at 37 °C in an anaerobic incubator.
Inactivation of Atopobium vaginae
As per the protocol detailed in previous research,12 Atopobium vaginae was incubated in PBS for 2 h at 80°C to induce cell death. Dead cells were centrifuged and resuspended using IMDM (ATCC, USA) with 2% FBS (Invitrogen, USA).
16S-PCR
To assess bacterial viability, 16S-PCR was used to determine bacterial abundance. Total RNA was extracted from lysed bacteria using TRIzol reagent (Invitrogen, USA), followed by reverse transcription with PrimeScript RT reagent (TaKaRa, Japan) to obtain cDNA samples. Finally, real-time PCR was performed on an ABI 7500 Real-Time PCR System (Applied Biosystems, USA). For analysis, the 2−ΔΔCt method was applied to evaluate relative gene expression. The primer sequences were as follows: Atopobium vaginae-F: 5′-TAGGTCAGGAGTTAAATCTG-3′; Atopobium vaginae-R: 5′-TCATGGCCCAGAAGACCGCC-3′, GAPDH-F: GGAGCGAGATCCCTCCAAAAT; GAPDH-R: GGCTGTTGTCATACTTCTCATGG.
Cell culture
The EC cell line (KLE) and human peripheral blood mononuclear cell line (THP-1) were both purchased from ATCC (USA). The established and previously characterized ARK1 cell line was provided by Shi-Wen Jiang (Mercer University School of Medicine, Savannah, GA).18 ARK1 cells were maintained in RPMI medium. As per ATCC’s guidelines, KLE cells were maintained in DMEM/F12 medium (ATCC, USA), while THP-1 cells were grown in a mixed medium containing 10% fetal bovine serum, 2 mM L-glutamine, 0.05 mM β-mercaptoethanol, 10 mM HEPES, glucose (4500 mg/L), penicillin (100 U/mL), and streptomycin (100 μg/mL). Both cell lines were cultured in a 37 °C incubator with 5% CO2, the humidity was 95%. All cell lines were authenticated by STR profiling.
Drawn upon the techniques from prior research, we treated THP-1 to induce their differentiation into macrophage-like cells.33 This was done by exposing the cells to 75 ng/mL PMA (phorbol 12-myristate 13-acetate) for 24 h.
Measurement of macrophage engulfment activity
Following the methodology described in the referenced study,12 2 × 108 CFU of inactivated Atopobium vaginae were added to a flow cytometer tube with 2 × 106 CFSE (Yeasen, China)-labeled KLE cells and incubated for 2 h at 37°C. 2 × 106 macrophages were added and phagocytosed for 2 h. Macrophages were stained with PerCP Anti-Human CD11b (Elabscience, China) according to the manufacturer’s instructions to stain macrophages. The proportion of cells with CSFE+CD11b+, representing phagocytosis by macrophages, was detected by flow cytometry.
The experimental setup for the detection of macrophage phagocytosis included two conditions: one with Atopobium vaginae+THP-1+KLE, and another with PBS+THP-1+KLE.
Development of mouse tumor model
Twelve specific-pathogen-free female BALB/c nude mice (10 weeks old, 25g) were acquired from Chengdu Dossy Experimental Animals Co., Ltd. (China) and were allowed to acclimate to the laboratory environment for 1 week under standard husbandry conditions. These animals were housed in individual ventilated cages under specific pathogen-free conditions, with controlled humidity (60%) and temperature (24°C). They were maintained on a regular 12:12-hour light-dark cycle. Tumor models were developed by subcutaneously injecting KLE tumor cells into the BALB/c nude mice, as described in earlier research.12 The mice were divided into 2 randomized groups: one for Atopobium vaginae treatment and another for PBS treatment. Each mouse was injected with 2 × 106 KLE cells near two separate tumor sites. Two weeks later, 100 μL of heat-inactivated Atopobium vaginae (OD600 = 1) were inoculated near the tumor sites three times a week. The Second Affiliated Hospital, Zhejiang University School of Medicine, approval number:(2024) 136, and all experiments complied with relevant regulatory standards. The Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines were used for reporting animal research.
Tumor progression analysis in mouse models
To determine the success of the mouse model construction and compare tumor progression among two groups, tumor dimensions were taken at day 10, day 14, and day 18 following bacterial treatment. The mice were euthanized by cervical dislocation under a sterile condition, and the tumor tissues were imaged to assess the progression of tumors.
Flow cytometry detection of macrophage polarization
To detect the effect of Atopobium vaginae on macrophage polarization, we referred to the established methods.12,34 Specifically, we employed flow cytometry to assess the levels of M1 (CD86) and M2 (CD206) markers in cells from both the Atopobium vaginae+THP-1+KLE group and PBS+THP-1+KLE groups, as well as in the endometrial tumor tissues from mice. This analysis helped to evaluate the polarization stage of macrophage. The specific antibodies and dyes used in the process included FITC Anti-Mouse/Human CD11b Antibody (M1/70), PE Anti-Mouse CD86 (GL-1), PE Anti-Human CD86 (BU63), APC Anti-Mouse CD206 (C068C2), and APC Anti-Human CD206 (15-2). All antibodies were purchased from Elabscience (China).
Enzyme-linked immunosorbent assay (ELISA) for inflammatory cytokine levels
The expression levels of inflammatory cytokines (IL-6 and IL-10) in patient blood samples, mouse blood samples, and co-culture supernatant of KLE cell lines were measured separately via ELISA. The ELISA kits were procured from Thermo Fisher Scientific (USA).
Quantification and statistical analysis
GraphPad Prism 8.0 software (GraphPad Software, Inc., LaJolla, USA) helped perform the analyses. Data are presented as the mean (X) ± standard deviation (SD) from three independent experiments. P values are calculated using either student T-testsor one-way analysis of variance (ANOVA). The statistical methods used were detailed in the corresponding legend. P < 0.05 was deemed to indicate statistical significance. The significance levels are expressed as follows: ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001.
Published: October 23, 2025
Footnotes
Supplemental information can be found online at https://doi.org/10.1016/j.isci.2025.113820.
Supplemental information
References
- 1.Dominguez-Bello M.G., Godoy-Vitorino F., Knight R., Blaser M.J. Role of the microbiome in human development. Gut. 2019;68:1108–1114. doi: 10.1136/gutjnl-2018-317503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Rajagopala S.V., Vashee S., Oldfield L.M., Suzuki Y., Venter J.C., Telenti A., Nelson K.E. The Human Microbiome and Cancer. Cancer Prev. Res. 2017;10:226–234. doi: 10.1158/1940-6207.Capr-16-0249. [DOI] [PubMed] [Google Scholar]
- 3.Irfan M., Delgado R.Z.R., Frias-Lopez J. The Oral Microbiome and Cancer. Front. Immunol. 2020;11 doi: 10.3389/fimmu.2020.591088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Okumura S., Konishi Y., Narukawa M., Sugiura Y., Yoshimoto S., Arai Y., Sato S., Yoshida Y., Tsuji S., Uemura K., et al. Gut bacteria identified in colorectal cancer patients promote tumourigenesis via butyrate secretion. Nat. Commun. 2021;12:5674. doi: 10.1038/s41467-021-25965-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Schwabe R.F., Jobin C. The microbiome and cancer. Nat. Rev. Cancer. 2013;13:800–812. doi: 10.1038/nrc3610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Crosbie E.J., Kitson S.J., McAlpine J.N., Mukhopadhyay A., Powell M.E., Singh N. Endometrial cancer. Lancet. 2022;399:1412–1428. doi: 10.1016/s0140-6736(22)00323-3. [DOI] [PubMed] [Google Scholar]
- 7.Mandato V.D., Palicelli A., Torricelli F., Mastrofilippo V., Leone C., Dicarlo V., Tafuni A., Santandrea G., Annunziata G., Generali M., et al. Should Endometrial Cancer Treatment Be Centralized? Biology. 2022;11 doi: 10.3390/biology11050768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Yu Z., Zhang J., Zhang Q., Wei S., Shi R., Zhao R., An L., Grose R., Feng D., Wang H. Single-cell sequencing reveals the heterogeneity and intratumoral crosstalk in human endometrial cancer. Cell Prolif. 2022;55 doi: 10.1111/cpr.13249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Allen N.E., Key T.J., Dossus L., Rinaldi S., Cust A., Lukanova A., Peeters P.H., Onland-Moret N.C., Lahmann P.H., Berrino F., et al. Endogenous sex hormones and endometrial cancer risk in women in the European Prospective Investigation into Cancer and Nutrition (EPIC) Endocr. Relat. Cancer. 2008;15:485–497. doi: 10.1677/erc-07-0064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Dossus L., Rinaldi S., Becker S., Lukanova A., Tjonneland A., Olsen A., Stegger J., Overvad K., Chabbert-Buffet N., Jimenez-Corona A., et al. Obesity, inflammatory markers, and endometrial cancer risk: a prospective case-control study. Endocr. Relat. Cancer. 2010;17:1007–1019. doi: 10.1677/erc-10-0053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Walther-António M.R.S., Chen J., Multinu F., Hokenstad A., Distad T.J., Cheek E.H., Keeney G.L., Creedon D.J., Nelson H., Mariani A., Chia N. Potential contribution of the uterine microbiome in the development of endometrial cancer. Genome Med. 2016;8:122. doi: 10.1186/s13073-016-0368-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Liu S., Zhou X., Peng X., Li M., Ren B., Cheng G., Cheng L. Porphyromonas gingivalis Promotes Immunoevasion of Oral Cancer by Protecting Cancer from Macrophage Attack. J. Immunol. 2020;205:282–289. doi: 10.4049/jimmunol.1901138. [DOI] [PubMed] [Google Scholar]
- 13.Onderdonk A.B., Delaney M.L., Fichorova R.N. The Human Microbiome during Bacterial Vaginosis. Clin. Microbiol. Rev. 2016;29:223–238. doi: 10.1128/cmr.00075-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ferreira C.S.T., Donders G.G., Parada C.M.G.d.L., Tristão A.D.R., Fernandes T., da Silva M.G., Marconi C. Treatment failure of bacterial vaginosis is not associated with higher loads of Atopobium vaginae and Gardnerella vaginalis. J. Med. Microbiol. 2017;66:1217–1224. doi: 10.1099/jmm.0.000561. [DOI] [PubMed] [Google Scholar]
- 15.Caselli E., Soffritti I., D'Accolti M., Piva I., Greco P., Bonaccorsi G. Atopobium vaginae And Porphyromonas somerae Induce Proinflammatory Cytokines Expression In Endometrial Cells: A Possible Implication For Endometrial Cancer? Cancer Manag. Res. 2019;11:8571–8575. doi: 10.2147/cmar.S217362. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Wu C.Y., Yang Y.H., Lin Y.S., Shu L.H., Liu H.T., Wu Y.H., Wu Y.H. Induction of ferroptosis and apoptosis in endometrial cancer cells by dihydroisotanshinone I. Heliyon. 2023;9 doi: 10.1016/j.heliyon.2023.e21652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Urick M.E., Yu E.J., Bell D.W. High-risk endometrial cancer proteomic profiling reveals that FBXW7 mutation alters L1CAM and TGM2 protein levels. Cancer. 2021;127:2905–2915. doi: 10.1002/cncr.33567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Bruce S.F., Cho K., Noia H., Lomonosova E., Stock E.C., Oplt A., Blachut B., Mullen M.M., Kuroki L.M., Hagemann A.R., et al. GAS6-AXL Inhibition by AVB-500 Overcomes Resistance to Paclitaxel in Endometrial Cancer by Decreasing Tumor Cell Glycolysis. Mol. Cancer Ther. 2022;21:1348–1359. doi: 10.1158/1535-7163.MCT-21-0704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Salvucci E. The human-microbiome superorganism and its modulation to restore health. Int. J. Food Sci. Nutr. 2019;70:781–795. doi: 10.1080/09637486.2019.1580682. [DOI] [PubMed] [Google Scholar]
- 20.O'Keefe S.J.D. Diet, microorganisms and their metabolites, and colon cancer. Nat. Rev. Gastroenterol. Hepatol. 2016;13:691–706. doi: 10.1038/nrgastro.2016.165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Mert I., Walther-Antonio M., Mariani A. Case for a role of the microbiome in gynecologic cancers: Clinician's perspective. J. Obstet. Gynaecol. Res. 2018;44:1693–1704. doi: 10.1111/jog.13701. [DOI] [PubMed] [Google Scholar]
- 22.Xu W., Jiang Y., Tao J., Liu Y., Xia Y., Chen C., Jiang X. Correlation analysis for alterations of intestinal flora in hepatocellular carcinoma patients: combinatorial detection of Coriobacterium, Atopobium, Coprococcus and Veillonella dispar may be a new method for HCC diagnosis. J. Med. Microbiol. 2023;72 doi: 10.1099/jmm.0.001713. [DOI] [PubMed] [Google Scholar]
- 23.So K.A., Yang E.J., Kim N.R., Hong S.R., Lee J.H., Hwang C.S., Shim S.H., Lee S.J., Kim T.J. Changes of vaginal microbiota during cervical carcinogenesis in women with human papillomavirus infection. PLoS One. 2020;15 doi: 10.1371/journal.pone.0238705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Vikramdeo K.S., Anand S., Pierce J.Y., Singh A.P., Singh S., Dasgupta S. Distribution of microbiota in cervical preneoplasia of racially disparate populations. BMC Cancer. 2022;22:1074. doi: 10.1186/s12885-022-10112-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lan T., Chen L., Wei X. Inflammatory Cytokines in Cancer: Comprehensive Understanding and Clinical Progress in Gene Therapy. Cells. 2021;10 doi: 10.3390/cells10010100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Propper D.J., Balkwill F.R. Harnessing cytokines and chemokines for cancer therapy. Nat. Rev. Clin. Oncol. 2022;19:237–253. doi: 10.1038/s41571-021-00588-9. [DOI] [PubMed] [Google Scholar]
- 27.Xiao L., He Y., Peng F., Yang J., Yuan C. Endometrial Cancer Cells Promote M2-Like Macrophage Polarization by Delivering Exosomal miRNA-21 under Hypoxia Condition. J. Immunol. Res. 2020;2020 doi: 10.1155/2020/9731049. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Li L., Yu R., Cai T., Chen Z., Lan M., Zou T., Wang B., Wang Q., Zhao Y., Cai Y. Effects of immune cells and cytokines on inflammation and immunosuppression in the tumor microenvironment. Int. Immunopharmacol. 2020;88 doi: 10.1016/j.intimp.2020.106939. [DOI] [PubMed] [Google Scholar]
- 29.Hanus M., Parada-Venegas D., Landskron G., Wielandt A.M., Hurtado C., Alvarez K., Hermoso M.A., López-Köstner F., De la Fuente M. Immune System, Microbiota, and Microbial Metabolites: The Unresolved Triad in Colorectal Cancer Microenvironment. Front. Immunol. 2021;12 doi: 10.3389/fimmu.2021.612826. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Natarajan N., Pluznick J.L. From microbe to man: the role of microbial short chain fatty acid metabolites in host cell biology. Am. J. Physiol. Cell Physiol. 2014;307:C979–C985. doi: 10.1152/ajpcell.00228.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Kovács T., Mikó E., Ujlaki G., Sári Z., Bai P. The Microbiome as a Component of the Tumor Microenvironment. Adv. Exp. Med. Biol. 2020;1225:137–153. doi: 10.1007/978-3-030-35727-6_10. [DOI] [PubMed] [Google Scholar]
- 32.Foey A.D., Habil N., Al-Shaghdali K., Crean S. Porphyromonas gingivalis-stimulated macrophage subsets exhibit differential induction and responsiveness to interleukin-10. Arch. Oral Biol. 2017;73:282–288. doi: 10.1016/j.archoralbio.2016.10.029. [DOI] [PubMed] [Google Scholar]
- 33.Tedesco S., De Majo F., Kim J., Trenti A., Trevisi L., Fadini G.P., Bolego C., Zandstra P.W., Cignarella A., Vitiello L. Convenience versus Biological Significance: Are PMA-Differentiated THP-1 Cells a Reliable Substitute for Blood-Derived Macrophages When Studying in Vitro Polarization? Front. Pharmacol. 2018;9:71. doi: 10.3389/fphar.2018.00071. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Pan Z., Zhao R., Li B., Qi Y., Qiu W., Guo Q., Zhang S., Zhao S., Xu H., Li M., et al. EWSR1-induced circNEIL3 promotes glioma progression and exosome-mediated macrophage immunosuppressive polarization via stabilizing IGF2BP3. Mol. Cancer. 2022;21:16. doi: 10.1186/s12943-021-01485-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
-
•
The raw data of 16S rRNA gene sequencing supporting the conclusion of this article have been stored in Mendeley Data: https://doi.org/10.17632/7chwt33cby.1. We ensure that it is publicly available as of the date of publication. The storage number is listed in the key resources table.
-
•
This study did not generate any new code.
-
•
Any other information required for reanalyzing the data reported in this article can be obtained from the lead contact upon request.





