Skip to main content
NCBI home page
Karger Author's Choice logoLink to Karger Author's Choice
. 2025 Oct 20;84(5-6):268–276. doi: 10.1159/000548950

Effects of Different SSRIs on nNOS mRNA Expression in the Hippocampus and Prefrontal Cortex of Chronically Stressed Rats

Li Zhang a,✉, Shuang Su a, Jin-Cui Yang b, Heng Zhang c,✉, Fan-Zhi Kong a,✉
PMCID: PMC12685334  PMID: 41115101

Abstract

Introduction

Depression severely affects the psychosocial functioning and quality of life of patients. Among first-line selective serotonin reuptake inhibitors (SSRIs), the incidence of neuropsychiatric side effects caused by paroxetine is 4–6 times higher than that caused by citalopram.

Methods

In this study, a depression model was established using Wistar rats to examine the effects of paroxetine and citalopram on neuronal nitric oxide synthase (nNOS) mRNA expression in the prefrontal cortex and hippocampus and to clarify the possible mechanisms of SSRI-induced neuropsychiatric side effects.

Results

In the hippocampus, nNOS expression was significantly higher in the depression group than in the control group. However, in the prefrontal cortex, nNOS expression was significantly lower in the depression group than in the control group. Following the administration of postsynaptic density protein 95 (PSD-95)/nNOS inhibitor ZL006, nNOS levels decreased significantly in the paroxetine group but showed no significant change in the citalopram group.

Conclusion

The mechanisms regulating nNOS expression differed between the paroxetine and citalopram groups. Paroxetine-induced nNOS expression may be associated with PSD-95/nNOS.

Keywords: Paroxetine, Citalopram, Postsynaptic density-95, Serotonin 2A receptor, Neuronal nitric oxide synthase

Introduction

Depression is a common disorder that seriously affects patients’ psychosocial functioning and quality of life. In 2008, the World Health Organization (WHO) listed depression as the third major disease worldwide and predicted that it would rank first by 2030 [1]. Selective serotonin reuptake inhibitors (SSRIs) are the first-line treatment for most patients with depression [2, 3]. Although SSRIs increase serotonin (5-HT) levels in the synaptic space within hours, their antidepressant effect typically requires several weeks to appear [4]. Moreover, SSRIs are effective in only a subset of patients. This challenges the monoamine transmitter theory and suggests that other pathogenetic mechanisms of depression may exist [5]. In addition, SSRIs are frequently associated with various adverse reactions. The rapid onset of these side effects often leads to poor patient compliance [6]. Published reports indicate that the incidence of neuropsychiatric side effects is 4–6 times higher with paroxetine than with citalopram. Neurological side effects include convulsions, nonspecific tremors, and extrapyramidal reactions, while psychiatric side effects include aggression, nervousness, anxiety, agitation, mania, and suicidal behavior [7, 8]. The Committee on Safety of Medicine (CSM) in the UK has cautioned that paroxetine is more prone to induce orofacial dystonia than other SSRIs. Similarly, data from the Adverse Drug Reaction Online Information Tracking (ADROIT) database show that adverse neurological reactions, such as dystonia and tremor, are more frequently associated with paroxetine use than with other SSRIs [9, 10].

Neuronal nitric oxide synthase (nNOS) is a key enzyme that produces brain-derived nitric oxide (NO). In the central nervous system, nNOS regulates physiological functions such as learning, memory, and neurogenesis, and it has also been implicated in various diseases [11]. Previous studies suggest that nNOS may contribute to the pathogenesis of depression. For example, the SSRI fluoxetine downregulates nNOS expression in hippocampal neurons [12]. Furthermore, the nNOS inhibitors 7-nitroindazole (7-NI) and 1-(2-trifluoromethylphenyl)-imidazole (TRIM) enhance the antidepressant-like effects of fluoxetine and citalopram in the forced swimming test [13]. nNOS has also been implicated in Parkinson’s disease [14]. Overactivation of nNOS leads to excessive NO production, which causes protein nitration and nitrosative stress. In addition, excess NO reacts with superoxide anions (O2−) to form the peroxynitrite (ONOO−), a highly reactive oxidant that induces lipid peroxidation, cell damage, and apoptosis [15, 16]. Thus, nNOS-induced NO overproduction is considered a major factor in the development of several neurological disorders.

SSRIs inhibit 5-HT reuptake by binding to the serotonin transporter, thereby increasing serotonin transmission in both the peripheral and central nervous systems [17]. Serotonin then interacts with its receptors and exerts diverse biological effects [18, 19]. In vitro studies have demonstrated that the serotonin 2A receptor (5-HT2AR) interacts with postsynaptic density protein 95 (PSD-95), which facilitates 5-HT2AR aggregation on the plasma membrane [20]. PSD-95 also interacts with nNOS and modulates nNOS-induced NO production [21, 22]. Therefore, we hypothesized that SSRIs may exert some of their biological effects by influencing nNOS expression and subsequent NO signaling.

The aim of this study was to investigate the potential mechanisms underlying the neuropsychiatric side effects of SSRIs, focusing on nNOS-related pathways [23]. Specifically, we examined the effects of paroxetine and citalopram on nNOS mRNA expression in the prefrontal cortex (PFC) and hippocampus of depressed rats, as well as changes in nNOS mRNA expression following ZL006 treatment.

Materials and Methods

Animals

Sixty adult male Wistar rats (5 weeks old, weighing approximately 150–175 g) without specific pathogens (SPF) were selected for the experiments and purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.

Drugs and Reagents

Citalopram hydrobromide and paroxetine hydrochloride hemihydrate were purchased from Shanghai Yuanye Bio-Technology Co., Ltd. Isoflurane was obtained from REDWELL Life Technology Co., Ltd. DEPC water, BioSharp, ZL006, MCE, and TRIzol were purchased from Thermo Fisher Technology Co., Ltd. The RR047A and RR391A kits, as well as primers and probes, were designed, synthesized, and purchased from Bao Biology Co., Ltd. NanoDrop was obtained from Thermo Fisher Technology Co., Ltd. The qTower 3G polymerase chain reaction (PCR) instrument was purchased from Jena, Germany.

Construction of a Depression Model

The depression model was established in Wistar rats that were allowed a 1-week adaptive feeding period with free access to food and water [24, 25]. The rats were weighed, and their baseline body weight was recorded the following day [26]. A sucrose preference test was then performed, and the rats with abnormal results were excluded [27]. The remaining rats were divided into the following groups: (a) control group (CON); (b) depression group (CMS); (c) paroxetine group (P); (d) citalopram group (C); (e) ZL006 group (Z); (f) paroxetine + ZL006 group (P + Z); (g) citalopram + ZL006 group (C + Z).

One to two stressors were administered randomly each day for 6 weeks, including fasting for 24 h, light/dark reversal for 24 h, water deprivation for 24 h [28], swimming in ice water (4°C) for 5 min, shaking for 5 min, tail clamping for 1 min, wet bedding for 24 h [29], intermittent lighting for 24 h, stroboscopic light for 24 h, cage tilting for 24 h, randomly changing companions for 24 h, solitary housing for 24 h, an empty bottle for 1 h [30], and limited diet for 2 h. The same stimulus was not repeated consecutively [31].

According to group allocation, rats received daily intragastric administration for 6 weeks of either double-distilled water (10 mL/kg), paroxetine (10 mg/kg) [32], or citalopram (10 mg/kg) [33]. A sucrose preference test was conducted weekly, and an open field test was performed at the end of week 6 [34]. Following behavioral testing, ZL006 (10 mg/kg) was administered for 1 week [35]. ZL006 is a small-molecule inhibitor of PSD-95/nNOS that disrupts the interaction of nNOS with PSD-95 by binding to the internal postsynaptic density protein-95 (PDZ) motif of nNOS [36, 37].

Rats were euthanized under anesthesia using a 5% isoflurane induction chamber until respiratory arrest persisted for 60 s. The PFC and hippocampus were removed and stored at −80°C.

Evaluation of Depression Using a Sucrose Preference Experiment

Rats were housed individually and adapted to sucrose for 2 days. During the first 24 h, rats were given two bottles of 1% sucrose solution. During the second 24 h, one bottle contained 1% sucrose water solution and the other contained plain water. To prevent position bias, bottle positions were switched every 12 h [38].

During the third 24 h, after 23 h of food and water deprivation, rats were provided two pre-weighted for 1 h: one with 1% sucrose solution and the other with plain water. Bottle positions were alternated every 30 min. Sucrose preference was calculated as follows [39]: sucrose preference rate = sugar water consumption/(sugar water consumption + drinking water consumption) [40].

Real-Time Quantitative PCR

For the real-time quantitative PCR experiment, RNA was extracted from the PFC and hippocampus using a TRIzol kit. RNA concentration was measured with a NanoDrop spectrophotometer. For each group, 2 µg of RNA was used in a two-step RT-qPCR reaction. Primer and probe sequences are presented in the Table 1. The mean values from replicates were used. The relative mRNA expression level of nNOS was calculated using the 2−(ΔΔCT) method [41–43].

Table 1.

Primer and probe sequences

Primers and probes Base sequence (from 5′ to 3′) Purification
nNOS forward primer CACAGATACCATGGAAGA PAGE
nNOS reverse primer GTCTCCAGCTTGGATAAG PAGE
nNOS probe (FAM)CGCAGCACCTCCTCGAATCA(TAMRA) HPLC
GAPDH forward primer TGG​TCT​ACA​TGT​TCC​AGT​ATG​ACT PAGE
GAPDH reverse primer CCA​TTT​GAT​GTT​AGC​GGG​ATC​TC PAGE
GAPDH probe (FAM)CCACGGCAAGTTCAACGGCACAGT(TAMRA) HPLC
Open in a new tab

Statistical Method

SPSS 22.0 software was used for data analysis. Results are expressed as mean ± standard deviation. Graphs were plotted with GraphPad Prism 8.0. Normality was assessed using the Kolmogorov-Smirnov (KS) test and the Shapiro-Wilk (SW) test. For normally distributed data, one-way analysis of variance (ANOVA) was used to compare group means. Homogeneity of variance was tested with Levene’s test. If the variance was homogeneous, the Sidak method was used; if the variance was unequal, Welch’s test, Brown-Forsythe test, and Tamhane’s T2 method were applied. For non-normally distributed data, the Kruskal-Wallis test was used. A value of p < 0.05 was considered statistically significant.

Results

Changes in Sucrose Preference in a Chronic Mild Stress Depression Model

The sucrose preference test showed that the sucrose preference rate of rats in the depression group was significantly lower than that in the control group (p < 0.001) [44]. However, the sucrose preference rates in both the paroxetine and citalopram groups were significantly higher than those in the depression group (p = 0.0003 and p = 0.0011, respectively) (Fig. 1).

Fig. 1.

Fig. 1.

Open in a new tab

Comparison of sucrose preference percentage among the groups (*p < 0.05, **p < 0.01, ***p < 0.001).

nNOS mRNA Expression in the Hippocampus

Significant differences in hippocampal nNOS mRNA levels were observed among the groups (p = 0.001) (Fig. 2). The depression group showed higher nNOS mRNA expression than those in the control group (p = 0.0011). Expression in the ZL006 group was lower than that in the depression group (p = 0.019). nNOS mRNA levels in the paroxetine group were higher than those in the citalopram group (p = 0.045). Levels in the paroxetine + ZL006 group were lower than those in the paroxetine group (p = 0.024). No significant difference was found between the citalopram and citalopram + ZL006 groups (p = 0.871) [45].

Fig. 2.

Fig. 2.

Open in a new tab

Comparison of nNOS mRNA expression in the hippocampus among the groups (CMS vs. CON: p = 0.011; P vs. C: p = 0.045; CMS vs. Z: p = 0.019; P vs. P + Z: p = 0.024). CMS, depression; CON, control; P, paroxetine; C, citalopram; Z, ZL006; P + Z, paroxetine + ZL006; C + Z, citalopram + ZL006.

nNOS mRNA Expression in the PFC

Significant differences in PFC nNOS mRNA levels were also observed among the groups (p = 0.001) (Fig. 3). The depression group showed lower nNOS mRNA expression than the depression group (p = 0.0005). Expression in the ZL006 group was lower than that in the depression group (p = 0.0007). nNOS mRNA levels in the paroxetine group were higher than those in the citalopram group (p = 0.029). Levels in the paroxetine + ZL006 group were lower than those in the paroxetine group (p = 0.018). No significant difference was found between the citalopram and citalopram + ZL006 groups (p = 0.732) [45].

Fig. 3.

Fig. 3.

Open in a new tab

Comparison of nNOS mRNA expression in the PFC among the groups (CMS vs. CON: p = 0.0005; P vs. C: p = 0.029; CMS vs. Z: p = 0.0007; P vs. P + Z: p = 0.018). CMS, depression; CON, control; P, paroxetine; C, citalopram; Z, ZL006; P + Z, paroxetine + ZL006; C + Z, citalopram + ZL006.

Discussion

Evaluation of the Depression Model

As an effective depression model, the CMS paradigm has robust face validity, construct validity, and predictive validity [46]. It is commonly used to explore depression mechanisms and to assess the efficacy of antidepressants [47]. A meta-analysis reported that the CMS model is strongly associated with anhedonic performance, the core symptom of depression, in rodents [48]. The sucrose preference test is a widely used method for evaluating anhedonia [46, 49]. After 6 weeks of chronic mild stress, the sucrose preference rate in the depression group decreased compared with the control group [50]. The difference was statistically significant, indicating the presence of anhedonia in the depression group. This result confirmed the successful establishment of the depression model in rats [51]. Compared with the untreated depression group, both the paroxetine and citalopram groups exhibited significantly higher sucrose preference rates, indicating that reduced sucrose preference could be reversed by antidepressant treatment. These findings confirmed that the depression model was effectively constructed, as evidenced by sucrose preference measurements, and provided a solid foundation for further exploration of the effects of paroxetine and citalopram on nNOS mRNA expression in the hippocampus and PFC of depressed rats. It has been reported that the CMS-induced depression model can selectively upregulate nNOS expression in the hippocampus and that inhibiting nNOS can prevent and reverse CMS-induced depression [52]. In this study, we compared nNOS expression in the hippocampus and PFC of depression-like and control groups. Moreover, we investigated the mechanistic differences between antidepressants paroxetine and citalopram through drug administration.

nNOS mRNA Expression in the Hippocampus and PFC and the Role of the PSD-95/nNOS Signaling Pathway

Rodent studies have shown that the PFC and hippocampus are closely associated with depression, as these regions regulate emotion and cognition to cope with chronic physical or psychological stress [53]. Our study showed that nNOS mRNA expression in the PFC of the depression group was lower than that in the control group. Several studies in patients with major depressive disorder have also reported that the total number and density of nNOS immunoreactive neurons in the paraventricular nucleus [54], nNOS immunoreactivity in the locus coeruleus, and nNOS activity in the PFC all decreased significantly [55]. These findings suggest that downregulation of nNOS mRNA in the PFC may be related to the mechanism of depression caused by chronic mild stress. Furthermore, the present study revealed that nNOS mRNA levels in the PFC of the ZL006 group were lower than those in the depression group. This finding suggested that the depression-associated nNOS mRNA changes in the prefrontal lobe were related to the PSD-95/nNOS signaling pathway [56], as ZL006 mainly inhibits nNOS activity by blocking the PDZ domain interaction between PSD-95 and nNOS.

In contrast, our study showed that nNOS mRNA expression in the hippocampus was upregulated in the depression group compared with the control group. Several studies have also shown that exposure to chronic mild stress in mice can induce nNOS overexpression in the hippocampus and lead to typical depressive behaviors [52, 57]. Immunohistochemical results further demonstrated that the number of nNOS-positive neurons in the hippocampal CA1 region and hypothalamus of the depression group was significantly higher than in the control group [58, 59]. In addition, some nNOS inhibitors have been shown to exert antidepressant-like effects under physiological conditions [60, 61]. The upregulation of nNOS mRNA in the hippocampus may therefore be linked to the mechanism of depression caused by chronic mild stress [62]. In this study, nNOS mRNA expression in the PFC of the ZL006 group was lower than that in other depression groups [63], indicating that ZL006 inhibited nNOS expression by affecting the interaction between PSD-95 and nNOS and suggesting that the mechanism of CMS-induced depression might involve the PSD-95/nNOS pathway.

The differential expression levels of nNOS mRNA in the hippocampus and PFC of depression rat models highlight the complexity of nNOS’s role in the neurobiology of depression [64]. As a primary downstream molecule of N-methyl-D-aspartate receptors (NMDARs), nNOS has been shown to play a critical role in the development of affective disorders [65, 66] and may represent a potential therapeutic target [67].

Relationship between the Differences in Paroxetine- and Citalopram-Induced nNOS mRNA Levels in the Hippocampus and PFC

The hippocampus has emerged as the predominant focus of neurobiological investigations into depression. The PFC, a critical neural hub governing cognitive processing and behavioral modulation, is also linked to depression [68]. In the central nervous system, nNOS interacts with PSD-95 located on the postsynaptic cellular membrane through the PDZ domain [69]. PSD-95 induces the aggregation of nNOS in the postsynaptic membrane, and the PSD-95/nNOS complex can further assemble with NMDAR to form the NMDAR/PSD-95/nNOS complex [70]. NMDARs activation triggers nNOS activity, an enzyme mainly catalyzing the formation of NOs [71, 72].

A growing body of clinical and preclinical research highlights the involvement of the NO pathway in the development of depression [73, 74]. nNOS-expressing neurons are most abundant in the hippocampus, cortical regions, hypothalamus, dorsal raphe nucleus, and amygdala [12], all of which are implicated in the pathophysiology of depression. nNOS, a key enzyme in the NMDAR signaling pathway, interacts with PSD-95 through its PDZ domain [75, 76]. Behavioral studies have demonstrated rapid antidepressant-like effects following the administration of selective nNOS inhibitors [60, 77]. Experimental evidence also indicates that reduced hippocampal nNOS activity results in measurable antidepressant-like effects by promoting neurogenesis [52, 78]. Recent findings confirm the essential role of medial PFC nNOS-expressing neurons in regulating depressive behaviors [79]. Our results showed that the expression of nNOS mRNA in the paroxetine group was significantly higher than that in the citalopram group, suggesting mechanistic differences between the two antidepressants [80].

This study further demonstrated that nNOS mRNA expression in the paroxetine + ZL006 group was lower than in the paroxetine group in both the hippocampus and PFC [81]. However, there was no difference in nNOS mRNA expression between the citalopram + ZL006 and citalopram groups in either brain regions [82]. As a small-molecule inhibitor of the PSD-95/nNOS interface, ZL006 has been reported to possess antidepressant properties [83]. Our experimental results suggested that paroxetine-induced changes in nNOS mRNA expression may be related to the PSD-95/nNOS interaction. In contrast, the antidepressant mechanism of citalopram might not involve the PSD-95/nNOS interaction, warranting further investigation.

In conclusion, the results of this study suggest that the downregulation of nNOS mRNA in the PFC and upregulation in the hippocampus are associated with the depressive mechanisms induced by chronic mild stress in rats. However, further validation of changes in nNOS mRNA transcription and translation processes is required. The alterations in nNOS mRNA expression in the PFC and hippocampus caused by chronic mild stress may be mediated through the PSD-95/nNOS signaling pathway. Among these, changes in nNOS mRNA expression induced by paroxetine appear to be related to PSD-95/nNOS, whereas those induced by citalopram showed no such association.

This study has several limitations. First, it measured only nNOS mRNA expression, without assessing protein levels or enzymatic activity of nNOS. Posttranscriptional modifications and actual functional outcomes may differ from mRNA expression levels [84]. Second, although the sucrose preference test was used to evaluate depression-like behavior, no other behavioral measures were assessed nor were NO levels, the downstream product of this pathway [28]. Third, the study included only male rats. Given known sex differences in depression and response to SSRIs, this limits the applicability of the findings to the female populations.

Statement of Ethics

All animal procedures were conducted in accordance with the guidelines of the National Institutes of Health for the care and use of laboratory animals and were approved by the Laboratory Animal Management and Use Committee of the Shantou University Medical College (Shantou, China; SUMC2018-056).

Conflict of Interest Statement

The authors declare no conflicts of interest.

Funding Sources

H.Z. was supported by the Science and Technology Special Fund Project of Guangdong, China (2019ST031), and the Medical Scientific Research Foundation of Guangdong, China (B2017020).

Author Contributions

Conceptualization: L.Z. and S.S.; methodology: H.Z. and L.Z.; resources and writing – review and editing: H.Z. and F.-Z.K.; data curation: S.S.; writing – original draft preparation: L.Z. All authors have read and approved the published version of the manuscript.

Funding Statement

H.Z. was supported by the Science and Technology Special Fund Project of Guangdong, China (2019ST031), and the Medical Scientific Research Foundation of Guangdong, China (B2017020).

Data Availability Statement

All data generated or analyzed during this study are included in this article. Further inquiries can be directed to the corresponding author.

References

  • 1. WHO . The global burden of disease: 2004 update. Geneva: World Health Organization; 2008. [Google Scholar]
  • 2. Cleare A, Pariante CM, Young AH, Anderson IM, Christmas D, Cowen PJ, et al. Evidence-based guidelines for treating depressive disorders with antidepressants: a revision of the 2008 British association for psychopharmacology guidelines. J Psychopharmacol. 2015;29(5):459–525. [DOI] [PubMed] [Google Scholar]
  • 3. Bauer M, Bschor T, Pfennig A, Whybrow PC, Angst J, Versiani M, et al. World Federation of societies of biological psychiatry (WFSBP) guidelines for biological treatment of unipolar depressive disorders in primary care. World J Biol Psychiatry. 2007;8(2):67–104. [DOI] [PubMed] [Google Scholar]
  • 4. Abstracts from the XXVI CINP congress, Munich, 13-17 July 2008. Int J Neuropsychopharmacol. 2008;11(S1):1–338. [Google Scholar]
  • 5. Berton O, Nestler EJ. New approaches to antidepressant drug discovery: beyond monoamines. Nat Rev Neurosci. 2006;7(2):137–51. [DOI] [PubMed] [Google Scholar]
  • 6. Lin EH, Von Korff M, Katon W, Bush T, Simon GE, Walker E, et al. The role of the primary care physician in patients’ adherence to antidepressant therapy. Med Care. 1995;33(1):67–74. [DOI] [PubMed] [Google Scholar]
  • 7. Edwards JG, Anderson I. Systematic review and guide to selection of selective serotonin reuptake inhibitors. Drugs. 1999;57(4):507–33. [DOI] [PubMed] [Google Scholar]
  • 8. Su Y, Guo X, Li HD. Depth comparison of side effects of serotonin reuptake inhibitors (SSRIs). Cent South Phamacy. 2007;5(2):151–6. [Google Scholar]
  • 9. Choo V. Paroxetine and extrapyramidal reactions. Lancet. 1993;341(8845):624. [DOI] [PubMed] [Google Scholar]
  • 10. Muscatello MRA, Bruno A, Pandolfo G, Micò U, Settineri S, Zoccali R. Emerging treatments in the management of schizophrenia-focus on sertindole. Drug Des Devel Ther. 2010;4:187–201. [Google Scholar]
  • 11. Luo CX, Zhu DY. Research progress on neurobiology of neuronal nitric oxide synthase. Neurosci Bull. 2011;27(1):23–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Zhang J, Huang XY, Ye ML, Luo CX, Wu HY, Hu Y, et al. Neuronal nitric oxide synthase alteration accounts for the role of 5-HT1A receptor in modulating anxiety-related behaviors. J Neurosci. 2010;30(7):2433–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Harkin A, Connor TJ, Burns MP, Kelly JP. Nitric oxide synthase inhibitors augment the effects of serotonin re-uptake inhibitors in the forced swimming test. Eur Neuropsychopharmacol. 2004;14(4):274–81. [DOI] [PubMed] [Google Scholar]
  • 14. Kühn K, Wellen J, Link N, Maskri L, Lübbert H, Stichel CC. The mouse MPTP model: gene expression changes in dopaminergic neurons. Eur J Neurosci. 2003;17(1):1–12. [DOI] [PubMed] [Google Scholar]
  • 15. Heinrich TA, da Silva RS, Miranda KM, Switzer CH, Wink DA, Fukuto JM. Biological nitric oxide signalling: chemistry and terminology. Br J Pharmacol. 2013;169(7):1417–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Cao J, Viholainen JI, Dart C, Warwick HK, Leyland ML, Courtney MJ. The PSD95-nNOS interface: a target for inhibition of excitotoxic p38 stress-activated protein kinase activation and cell death. J Cell Biol. 2005;168(1):117–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Karlović D, Karlović D. Serotonin transporter gene (5-HTTLPR) polymorphism and efficacy of selective serotonin reuptake inhibitors--do we have sufficient evidence for clinical practice. Acta Clin Croat. 2013;52(3):353–62. [PubMed] [Google Scholar]
  • 18. Stahl SM. Mechanism of action of serotonin selective reuptake inhibitors. Serotonin receptors and pathways mediate therapeutic effects and side effects. J Affect Disord. 1998;51(3):215–35. [DOI] [PubMed] [Google Scholar]
  • 19. David DJ, Gourion D. Antidepressant and tolerance: determinants and management of major side effects. Encephale. 2016;42(6):553–61. [DOI] [PubMed] [Google Scholar]
  • 20. Xia Z, Gray JA, Compton-Toth BA, Roth BL. A direct interaction of PSD-95 with 5-HT2A serotonin receptors regulates receptor trafficking and signal transduction. J Biol Chem. 2003;278(24):21901–8. [DOI] [PubMed] [Google Scholar]
  • 21. Shih AY, Mateo C, Drew PJ, Tsai PS, Kleinfeld D. A polished and reinforced thinned-skull window for long-term imaging of the mouse brain. J Vis Exp. 2012;61:3742. [Google Scholar]
  • 22. Kazama K, Wang G, Frys K, Anrather J, Iadecola C. Angiotensin II attenuates functional hyperemia in the mouse somatosensory cortex. Am J Physiol Heart Circ Physiol. 2003;285(5):H1890–9. [DOI] [PubMed] [Google Scholar]
  • 23. Keshet GI, Ovadia H, Taraboulos A, Gabizon R. Scrapie-infected mice and PrP knockout mice share abnormal localization and activity of neuronal nitric oxide synthase. J Neurochem. 1999;72(3):1224–31. [DOI] [PubMed] [Google Scholar]
  • 24. Papp M. Models of affective illness: chronic mild stress in the rat. Curr Protoc Pharmacol. 2012;57(1):5–9. [Chapter 5]. [Google Scholar]
  • 25. Willner P. Animal models as simulations of depression. Trends Pharmacol Sci. 1991;12(4):131–6. [DOI] [PubMed] [Google Scholar]
  • 26. Wang TT, Zhou MY, Gong XN, Huang Y, Li FL, Gu SL, et al. Eupalinolide B alleviates corticosterone-induced PC12 cell injury and improves depression-like behaviors in CUMS rats by regulating the GSK-3β/β-catenin pathway. Biochem Pharmacol. 2025;235:116831. [DOI] [PubMed] [Google Scholar]
  • 27. Bakirhan A, Kalyoncu T, Ozel I, Erermis S, Kayahan B, Ongur D, et al. 9th international congress on psychopharmacology & 5th international symposium on child and adolescent psychopharmacology. Psychiatry Clin Psychopharmacol. 2017;27(Suppl 1):47–84. [Google Scholar]
  • 28. Yu Z, Chen N, Hu D, Chen W, Yuan Y, Meng S, et al. Decreased density of perineuronal net in prelimbic cortex is linked to depressive-like behavior in young-aged rats. Front Mol Neurosci. 2020;13:4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Tang C, Liu H, Zou H, Su M, Yin H, Sun M, et al. Dihydroartemisinin protects mice from CUMS-induced depression-like behaviors by regulating gut microbes. Neuroscience. 2024;547:28–36. [DOI] [PubMed] [Google Scholar]
  • 30. Ivanović J, Aranđelović J, Jezdić K, Matović BD, Jančić I, Batinić B, et al. Sex-dependent changes induced by combined low-level systemic inflammation and chronic mild unpredictable stress in rats are partially attenuated by positive modulation of α5 GABAA receptors. Pharmacol Biochem Behav. 2025;253:174032. [DOI] [PubMed] [Google Scholar]
  • 31. Mineur YS, Belzung C, Crusio WE. Effects of unpredictable chronic mild stress on anxiety and depression-like behavior in mice. Behav Brain Res. 2006;175(1):43–50. [DOI] [PubMed] [Google Scholar]
  • 32. Han J, Wang LU, Bian H, Zhou X, Ruan C. Effects of paroxetine on spatial memory function and protein kinase C expression in a rat model of depression. Exp Ther Med. 2015;10(4):1489–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Montgomery SA, Loft H, Sánchez C, Reines EH, Papp M. Escitalopram (S-enantiomer of citalopram): clinical efficacy and onset of action predicted from a rat model. Pharmacol Toxicol. 2001;88(5):282–6. [DOI] [PubMed] [Google Scholar]
  • 34. Duan G, Zou T, Wu X, Zhang Y, Liu H, Mei C. Neuroprotective role of geniposide-loaded UMSC nanovesicles in depression via P2ry12 downregulation. Phytomedicine. 2025;140:156581. [DOI] [PubMed] [Google Scholar]
  • 35. Sherwin E, Lennon A, Harkin A. Regional specific modulation of stress-induced neuronal activation associated with the PSD95/NOS interaction inhibitor ZL006 in the wistar Kyoto rat. Int J Neuropsychopharmacol. 2017;20(10):833–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Bach A, Pedersen SW, Dorr LA, Vallon G, Ripoche I, Ducki S, et al. Biochemical investigations of the mechanism of action of small molecules ZL006 and IC87201 as potential inhibitors of the nNOS-PDZ/PSD-95-PDZ interactions. Sci Rep. 2015;5:12157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Jankovic T, Bogicevic M, Knezevic NN. The role of nitric oxide and hormone signaling in chronic stress, anxiety, depression and post-traumatic stress disorder. Mol Cell Endocrinol. 2024;590:112266. [DOI] [PubMed] [Google Scholar]
  • 38. Hu Y, Xiao R, Wang C, Meng H, Yao B, Xu Q, et al. Metabolite classification through novel metabolomics framework reveals mechanism underlying the therapeutic effects of PSD95-nNOS blockade for post-stroke depression. Metabolomics. 2025;21(4):100. [DOI] [PubMed] [Google Scholar]
  • 39. Willner P, Towell A, Sampson D, Sophokleous S, Muscat R. Reduction of sucrose preference by chronic unpredictable mild stress, and its restoration by a tricyclic antidepressant. Psychopharmacol Berl. 1987;93(3):358–64. [Google Scholar]
  • 40. Jiang N, Jingwei L, Wang H, Huang H, Wang Q, Zeng G, et al. Ginsenoside 20(S)-protopanaxadiol attenuates depressive-like behaviour and neuroinflammation in chronic unpredictable mild stress-induced depressive rats. Behav Brain Res. 2020;393:112710. [DOI] [PubMed] [Google Scholar]
  • 41. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8. [DOI] [PubMed] [Google Scholar]
  • 42. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101–8. [DOI] [PubMed] [Google Scholar]
  • 43. Jian H, Zu P, Rao Y, Li W, Mou T, Lin J, et al. Comparative analysis of melanin deposition between chishui silky fowl and taihe silky fowl. J Appl Anim Res. 2021;49(1):366–73. [Google Scholar]
  • 44. López-Muñoz F, Srinivasan V, De Berardis D, Cecilio A, Takahiro AK. Melatonin, neuroprotective agents and antidepressant therapy. New Delhi, India: Springer; 2016. [Google Scholar]
  • 45. Li B, Zhang X, Huo S, Zhang J, Du J, Xiao B, et al. Aluminum activates NLRP3 inflammasome-mediated pyroptosis via reactive oxygen species to induce liver injury in mice. Chem Biol Interact. 2022;368:110229. [DOI] [PubMed] [Google Scholar]
  • 46. Sharma S, Chawla S, Kumar P, Ahmad R, Kumar Verma P. The chronic unpredictable mild stress (CUMS) paradigm: bridging the gap in depression research from bench to bedside. Brain Res. 2024;1843:149123. [DOI] [PubMed] [Google Scholar]
  • 47. Rodriguez A, Zhang H, Klamindrr J. The social defeat stress model of depression: a review of methodological considerations. Neurosci Biobehav Rev. 2023;144:104944. [Google Scholar]
  • 48. Antoniuk S, Bijata M, Ponimaskin E, Wlodarczyk J. Chronic unpredictable mild stress for modeling depression in rodents: meta-analysis of model reliability. Neurosci Biobehav Rev. 2019;99:101–16. [DOI] [PubMed] [Google Scholar]
  • 49. Markov DD. Sucrose preference test as a measure of anhedonic behavior in a chronic unpredictable mild stress model of depression: outstanding issues. Brain Sci. 2022;12(10):1287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Rossetti AC, Papp M, Gruca P, Paladini MS, Racagni G, Riva MA, et al. Stress-induced anhedonia is associated with the activation of the inflammatory system in the rat brain: restorative effect of pharmacological intervention. Pharmacol Res. 2016;103:1–12. [DOI] [PubMed] [Google Scholar]
  • 51. Song Y, Song Q, Tan F, Wang Y, Li C, Liao S, et al. Seliciclib alleviates ulcerative colitis by inhibiting ferroptosis and improving intestinal inflammation. Life Sci. 2024;351:122794. [DOI] [PubMed] [Google Scholar]
  • 52. Zhou QG, Hu Y, Hua Y, Hu M, Luo CX, Han X, et al. Neuronal nitric oxide synthase contributes to chronic stress-induced depression by suppressing hippocampal neurogenesis. Neurochem. 2007;103(5):1843–54. [Google Scholar]
  • 53. Liu W, Ge T, Leng Y, Pan Z, Fan J, Yang W, et al. The role of neural plasticity in depression: from hippocampus to prefrontal cortex. Neural Plast. 2017;2017(1):6871089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. García RG, Zarruk JG, Barrera C, Pinzón A, Trillos E, Arenas WD, et al. Plasma nitrate levels and flow-mediated vasodilation in untreated major depression. Psychosom Med. 2011;73(4):344–9. [DOI] [PubMed] [Google Scholar]
  • 55. Xing G, Chavko M, Zhang LX, Yang S, Post RM. Decreased calcium-dependent constitutive nitric oxide synthase (cNOS) activity in prefrontal cortex in schizophrenia and depression. Schizophr Res. 2002;58(1):21–30. [DOI] [PubMed] [Google Scholar]
  • 56. Lapchak PA, Zhang JH. Neuroprotective therapy for stroke and ischemic disease. Cham: Springer International Publishing; 2017. [Google Scholar]
  • 57. Liu Y, Cui X, Sun YE, Yang X, Ni K, Zhou Y, et al. Intrathecal injection of the peptide myr-NR2B9c attenuates bone cancer pain via perturbing N-methyl-D-aspartate receptor-PSD-95 protein interactions in mice. Anesth Analg. 2014;118(6):1345–54. [DOI] [PubMed] [Google Scholar]
  • 58. Oliveira RM, Guimarães FS, Deakin JF. Expression of neuronal nitric oxide synthase in the hippocampal formation in affective disorders. Braz J Med Biol Res. 2008;41(4):333–41. [DOI] [PubMed] [Google Scholar]
  • 59. Yan XB, Ouyang W, Li G, Duan KM. Involvement of neuronal nitric oxide synthase in cognitive impairment in isoflurane-treated rats. Neurosci Lett. 2012;506(2):240–4. [DOI] [PubMed] [Google Scholar]
  • 60. Joca SRL, Guimarães FS. Inhibition of neuronal nitric oxide synthase in the rat hippocampus induces antidepressant-like effects. Psychopharmacology. 2006;185(3):298–305. [DOI] [PubMed] [Google Scholar]
  • 61. Ghasemi M, Sadeghipour H, Poorheidari G, Dehpour AR. A role for nitrergic system in the antidepressant-like effects of chronic lithium treatment in the mouse forced swimming test. Behav Brain Res. 2009;200(1):76–82. [DOI] [PubMed] [Google Scholar]
  • 62. Piato AL, Detanico BC, Jesus JF, Lhullier FLR, Nunes DS, Elisabetsky E. Effects of marapuama in the chronic mild stress model: further indication of antidepressant properties. J Ethnopharmacol. 2008;118(2):300–4. [DOI] [PubMed] [Google Scholar]
  • 63. Baba H, Suzuki T, Arai H, Emson PC. Expression of nNOS and soluble guanylate cyclase in schizophrenic brain. Neuroreport. 2004;15(4):677–80. [DOI] [PubMed] [Google Scholar]
  • 64. Doucet MV, Harkin A, Dev KK. The PSD-95/nNOS complex: new drugs for depression? Pharmacol Ther. 2012;133(2):218–29. [DOI] [PubMed] [Google Scholar]
  • 65. Mungrue IN, Bredt DS. nNOS at a glance: implications for brain and brawn. J Cell Sci. 2004;117(Pt 13):2627–9. [DOI] [PubMed] [Google Scholar]
  • 66. Bach A, Eildal JNN, Stuhr-Hansen N, Deeskamp R, Gottschalk M, Pedersen SW, et al. Cell-permeable and plasma-stable peptidomimetic inhibitors of the postsynaptic density-95/N -methyl- D -aspartate receptor interaction. J Med Chem. 2011;54(5):1333–46. [DOI] [PubMed] [Google Scholar]
  • 67. Shi HJ, Wu DL, Chen R, Li N, Zhu LJ. Requirement of hippocampal DG nNOSCAPON dissociation for the anxiolytic and antidepressant effects of fluoxetine. Theranostics. 2022;12(8):3656–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Treadway MT, Waskom ML, Dillon DG, Holmes AJ, Park MTM, Chakravarty MM, et al. Illness progression, recent stress, and morphometry of hippocampal subfields and medial prefrontal cortex in major depression. Biol Psychiatry. 2015;77(3):285–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Brenman JE, Chao DS, Gee SH, McGee AW, Craven SE, Santillano DR, et al. Interaction of nitric oxide synthase withthe postsynaptic density protein PSD-95 and alpha1-syntrophin mediated by PDZ domains. Cell. 1996;84(5):757–67. [DOI] [PubMed] [Google Scholar]
  • 70. Zhou L, Li F, Xu HB, Luo CX, Wu HY, Zhu MM, et al. Treatment of cerebral ischemia by disrupting ischemia-induced interaction of nNOS with PSD-95. Nat Med. 2010;16(12):1439–43. [DOI] [PubMed] [Google Scholar]
  • 71. Garthwaite J, Garthwaite G, Palmer RM, Moncada S. NMDA receptor activation induces nitric oxide synthesis from arginine in rat brain slices. Eur J Pharmacol. 1989;172(4–5):413–6. [DOI] [PubMed] [Google Scholar]
  • 72. Zhou QG, Zhu XH, Nemes AD, Zhu DY. Neuronal nitric oxide synthase and affective disorders. IBRO Rep. 2018;5:116–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Ostadhadi S, Khan MI, Norouzi-Javidan A, Chamanara M, Jazaeri F, Zolfaghari S, et al. Involvement of NMDA receptors and L-arginine nitric oxide cyclic guanosine monophosphate pathway in the antidepressant-like effects of topiramate in mice forced swimming test. Brain Res Bull. 2016;122:62–70. [DOI] [PubMed] [Google Scholar]
  • 74. Dhir A, Kulkarni SK. Nitric oxide and major depression. Nitric Oxide. 2011;24(3):125–31. [DOI] [PubMed] [Google Scholar]
  • 75. Christopherson KS, Hillier BJ, Lim WA, Bredt DS. PSD-95 assembles a ternary complex with the N-methyl-D-aspartic acid receptor and a bivalent neuronal NO synthase PDZ domain. J Biol Chem. 1999;274(39):27467–73. [DOI] [PubMed] [Google Scholar]
  • 76. Zhou F, Xu Y, Hou X. MLK3‐MKK3/6‐P38MAPK cascades following N‐methyl‐D‐aspartate receptor activation contributes to amyloid‐β peptide‐induced apoptosis in SH‐SY5Y cells. J Neurosci Res. 2014;92(6):808–17. [DOI] [PubMed] [Google Scholar]
  • 77. Silva M, Aguiar DC, Diniz CR, Guimarães FS, Joca SRL. Neuronal NOS inhibitor and conventional antidepressant drugs attenuate stress-induced fos expression in overlapping brain regions. Cell Mol Neurobiol. 2012;32(3):443–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Zhou QG, Zhu LJ, Chen C, Wu HY, Luo CX, Chang L, et al. Hippocampal neuronal nitric oxide synthase mediates the stress-related depressive behaviors of glucocorticoids by downregulating glucocorticoid receptor. J Neurosci. 2011;31(21):7579–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. Liang HY, Zhao ZB, Liu Z, Samsom J, Chen KH, Chen Y, et al. nNOS-expressing neurons in the mPFC mediate depression-related behaviors in mice through pPVT-mPFC projections. Neuropsychopharmacology. 2025;50(10):1583–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. Li M, Yang C, Duan A, Xiao P, Lu X, Ma X, et al. CX43 and oxidative stress are the targets of BCB staining to predict the developmental potential of buffalo oocytes. Reprod Domest Anim. 2024;59(8):e14673. [DOI] [PubMed] [Google Scholar]
  • 81. Chang A, Chang Y, Wang SJ. Rutin prevents seizures in kainic acid-treated rats: evidence of glutamate levels, inflammation and neuronal loss modulation. Food Funct. 2022;13(20):10401–14. [DOI] [PubMed] [Google Scholar]
  • 82. Lu T, Li M, Xu X, Xiong J, Huang C, Zhang X, et al. Whole exome sequencing identifies an AMBN missense mutation causing severe autosomal-dominant amelogenesis imperfecta and dentin disorders. Int J Oral Sci. 2018;10(3):26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83. Doucet MV, Levine H, Dev KK, Harkin A. Small-molecule inhibitors at the PSD-95/nNOS interface have antidepressant-like properties in mice. Neuropsychopharmacology. 2013;38(8):1575–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84. Yoshino Y, Ochi S, Yamazaki K, Nakata S, Iga JI, Ueno SI. Endothelial nitric oxide synthase in rat brain is downregulated by sub-chronic antidepressant treatment. Psychopharmacology. 2017;234(11):1663–9. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in this article. Further inquiries can be directed to the corresponding author.

Articles from Neuropsychobiology are provided here courtesy of Karger Publishers

RESOURCES