A case of primary ovarian clear cell carcinoma with ETV6::NTRK3 fusion

Abstract

We report the first documented case of primary ovarian clear cell carcinoma harboring an ETV6::NTRK3 fusion gene. A 49-year-old woman presented with a rapidly growing ovarian cyst that was diagnosed as stage IC1 clear cell carcinoma following primary debulking surgery. Molecular analysis revealed an ETV6::NTRK3 fusion gene, confirmed by RT-PCR and Sanger sequencing. The tumor also contained an ARID1A variant (p.P1326Rfs*155), exhibited low tumor mutation burden (3.7 Muts/Mbp), and showed stable microsatellite status. Following standard surgical and chemotherapeutic treatment, the patient remained disease-free at 2.5 years post-surgery. This case demonstrates that NTRK fusion gene, in conjunction with ARID1A mutation, may contribute to clear cell carcinoma development, highlighting the need for further investigation into the prevalence and significance of NTRK fusions in ovarian clear cell carcinomas. The identification of this actionable genetic alteration provides potential targeted therapeutic options should disease recurrence occur.

Introduction

Ovarian clear cell carcinoma is less sensitive to platinum than high-grade serous or endometrioid ovarian cancer, and the prognosis of advanced or recurrent cases is poor. ARID1A and PIK3CA gene mutations are characteristic [1]. Although treatments targeting the PI3K pathway and treatments targeting ARID1A mutations are being explored, the standard treatment is combination therapy using taxane and platinum drugs, the same as for histological types such as high-grade serous carcinoma and endometrioid carcinoma.

Neurotrophic receptor tyrosine kinase (NTRK) is a gene encoding tropomyosin receptor kinase (TRK) and plays an important role in the establishment of the nervous system [2]. The NTRK fusion gene generates TRK fusion protein, which induces sustained activation of tyrosine kinase and is involved in the development of malignant tumors. The NTRK fusion gene is a rare genetic abnormality found in less than 0.3% of all solid tumors, but is frequently found in some malignant tumors such as infantile fibrosarcoma and secretory carcinoma of the breast and salivary gland [3, 4]. NTRK fusion gene is rarely found in ovarian cancer [5], and there is no report of its discovery in primary ovarian clear cell carcinomas. In this study, we report a case in which an ETV6::NTRK3 fusion gene was found in a primary ovarian clear cell carcinoma.

Case report

A 40-mm simple ovarian cyst was incidentally detected on transabdominal ultrasonography during follow-up for multiple renal cysts in a 49-year-old woman (Gravida 1, Para 1). The cyst was determined to be an ovarian endometriotic cyst on detailed examination, and the patient was placed on a no-treatment, follow-up policy. Nine months later, transvaginal ultrasonography revealed that the ovarian cyst had increased to 82 mm in size, and the patient was referred for detailed examination. CA125 was elevated at 93 U/mL and CA19-9 was elevated at 132 U/mL. Pelvic contrast-enhanced MRI showed a left ovarian tumor as large as 90 mm with solid component (Fig. 1A). Contrast-enhanced CT scan showed no metastasis in other organs or lymph nodes.

Fig. 1.

A Left: pelvic contrast-enhanced MRI T2WI horizontal section, right: pelvic contrast-enhanced MRI T1WI horizontal section. A nodule (arrow) was seen in the wall, and it was accompanied by a contrast effect. B. macroscopic findings of the left adnexa. Papillary nodules were seen on the inner wall. C. pathological findings of the ovarian tumor. Upper left: H&E staining: cells with nuclei with coarse chromatin and clear cytoplasm are proliferating in a multilayered pattern, and are accompanied by hobnail cells. Upper middle: HNF1β: positive. Upper right: Ki67: partially positive. Lower left: 53 immunohistochemical staining: wild-type pattern. Lower middle: pan-TRK: weak nuclear staining

Left ovarian cancer was suspected, and surgery was decided upon. A left adnexectomy was performed (Fig. 1B), and intraoperative rapid histopathological diagnosis revealed adenocarcinoma; therefore, primary debulking surgery (simple hysterectomy, bilateral adnexectomy, pelvic lymph node dissection, para-aortic lymph node dissection, omentectomy, peritoneal biopsy) was performed with no residual tumor. The postoperative histopathological diagnosis was primary left ovarian clear cell carcinoma (Fig. 1C). The tumor was positive for HNF1-β. P53 staining showed TP53 wild-type pattern. Pan-TRK immunohistochemistry (clone EPR17341, ab181560, abcam) showed weak nuclear staining. Both gross and histopathological examinations showed no metastasis to the uterus, contralateral adnexa, peritoneum, omentum, or lymph nodes. Cytology of ascites fluid was negative. The left ovarian tumor was adherent to the rectum and uterus, suggesting the tumor originated from endometriosis. Adenomyosis was also identified in the uterus. Due to the intraoperative rupture, the postoperative stage was set to FIGO stage IC1, pT1c1N0M0. Postoperative adjuvant chemotherapy consisted of six cycles of triweekly paclitaxel-carboplatin. Two years and 5 months have passed since the surgery, and the patient is alive and disease-free.

The multi-gene panel testing of the primary tumor using a next-generation sequencer (Rapid-Neo [6]) was performed as part of a research study, which revealed an ETV6::NTRK3 fusion gene and an ARID1A variant. The ETV6::NTRK3 fusion gene was detected as a fusion between exon 4 of ETV6 (Chr12:12,017,609) and exon 14 of NTRK3 (Chr15:88,634,291) (15 unique/18 total reads (junction allele frequency 43%), pathologic tumor content: 50%, genomic tumor content: 20%) (Fig. 2A). The ARID1A variant was identified as p.P1326Rfs*155 (variant allele frequency (VAF): 19.4%). PIK3R1 p.M563_L570del (VAF: 8.7%) was also identified. No oncogenic variants in PIK3CA, PTEN, or TP53 were detected. Tumor mutation burden was low (3.7 Muts/Mbp) and microsatellite status was stable. To confirm the presence of ETV6::NTRK3 fusion transcripts, RNA extracted from the tumor tissue was reverse transcribed into cDNA, and PCR was performed using three sets of primers targeting different fusion transcript variants. In addition, one set of primers each for the normal sequences of ETV6 and NTRK3 was included as controls (Table 1). Human genomic DNA was used as a positive control for normal ETV6 and NTRK3 sequences. PCR products were analyzed via agarose gel electrophoresis, revealing bands corresponding to all three fusion transcript variants as well as the normal sequences of ETV6 and NTRK3. Representative gel images are shown in Fig. 2B. The amplified products were purified and subjected to Sanger sequencing (dideoxy method) for sequence confirmation. Sequencing analysis was conducted by FASMAC Co., Ltd. (Kanagawa, Japan), confirming the expected ETV6::NTRK3 fusion sequences. Primer sequences, the expected product sizes, and details of the positive control are provided in Table 1.

Fig. 2.

A Genomic browser view of the ETV6::NTRK3 fusion gene. The genomic arrangement of the ETV6::NTRK3 fusion gene is shown, highlighting the breakpoint at exon 4 of ETV6 (Chr12:12,017,609) and exon 14 of NTRK3 (Chr15:88,634,291). The image depicts the precise fusion point and the surrounding genomic regions. B Agarose gel electrophoresis of PCR products for ETV6::NTRK3 fusion confirmation. Lanes: No.1_ETV6, No.1_NTRK3, No.1_ETV6-NTRK3_Fusion1, No.1_ETV6-NTRK3_Fusion2, No.1_ETV6-NTRK3_Fusion3, No.2_ETV6, No.2_NTRK3, and Ladder. No. 1 represents PCR products from the tumor RNA sample, and No.2 represents human genomic DNA as a positive control for normal ETV6 and NTRK3 sequences. Bands corresponding to all three ETV6::NTRK3 fusion transcripts were detected in the tumor RNA sample (No. 1), confirming the presence of the fusion transcripts

Table 1.

Primer sequences and expected product sizes for PCR amplification

Primer set	Forward primer (5′–3′)	Reverse primer (5′–3′)	Product size (bp)
Fusion1	CAGCAGAATTGACATCCATATTATCTA	AATACTCATCTTAGGAGAGTTGC	171
Fusion2	CATCCATATTATCTATAAAAGGAAAGTTTG	ACTCATCTTAGGAGAGTTGCTGA	156
Fusion3	CCTTGTCTACAAAAGATTAC	TTAGGAGAGTTGCTGATTTC	118
ETV6_Normal	CCATATTATCTATAAAAGGAAAGTTTG	CTTTTGTATAGGTTTGATATTTCCTG	206
NTRK3_Normal	CGGGTTCCCAATTTAGCATGG	AACAGCCAATACTCATCTTAGGAG	170

Primer sets used for the confirmation of ETV6::NTRK3 fusion transcripts and normal sequences of ETV6 and NTRK3 are listed. Forward and reverse primer sequences are shown in the 5′–3′ orientation. Expected product sizes for each primer set are indicated. Normal sequence primers were used with human genomic DNA as a positive control

Discussion

We report a case of ovarian clear cell carcinoma with ETV6::NTRK3 fusion gene, representing the first documented case of NTRK fusion in primary ovarian clear cell carcinoma to our knowledge. The molecular profile of this case provides several important insights into the pathogenesis of ovarian clear cell carcinoma. The co-occurrence of the ARID1A variant, found in 42% of primary ovarian clear cell carcinomas [1], with the novel ETV6::NTRK3 fusion suggests a complex molecular landscape. ARID1A is a component of the SWI/SNF chromatin remodeling complex which plays essential roles in differentiation, proliferation, and DNA repair [1]. ARID1A alterations are also known to decrease glutathione levels, promoting carcinogenesis through oxidative stress [7]. This mechanism may be particularly relevant in clear cell carcinomas, which are characterized by their unique metabolic adaptations. The NTRK gene family, comprising NTRK 1, 2, and 3, encodes tropomyosin receptor kinases (TRK) A, B, and C respectively. In our case, the ETV6::NTRK3 fusion likely results in constitutive activation of TRKC signaling, leading to dysregulated PI3K/AKT pathway activation. Previous studies have demonstrated that ARID1A and PIK3CA variants can cooperatively drive the development of ovarian clear cell carcinoma [2, 8, 9]. Our findings suggest a novel mechanism where the ETV6::NTRK3 fusion may provide an alternative route to PI3K/AKT pathway activation, potentially cooperating with ARID1A loss to promote tumorigenesis.

The therapeutic implications of our findings are noteworthy. TRK inhibitors such as entrectinib and larotrectinib have shown impressive response rates of 57–75% in NTRK fusion-positive malignancies [3, 10]. While our patient achieved disease-free status following standard surgical and chemotherapy treatment, the presence of the ETV6::NTRK3 fusion provides a rational basis for considering TRK inhibitors as a targeted therapeutic option should recurrence occur.

Interestingly, the pan-TRK immunostaining was not positive in this case. The positive rate for pan-TRK immunostaining has been reported to be lower in cases with NTRK3 fusions (79%) compared to those with NTRK1 or NTRK2 fusions [4]. A meta-analysis showed false-negative rate of pan-TRK immunostaining was 18% [11]. This finding underscores the importance of molecular confirmation using techniques such as PCR or next-generation sequencing, especially when immunohistochemistry results are equivocal.

These findings also raise important questions for future research. The frequency of NTRK fusion genes in ovarian clear cell carcinoma warrants investigation through larger cohort studies. In addition, understanding the potential interaction between ARID1A loss and NTRK fusion-driven signaling could provide insights into the tumorigenesis of clear cell carcinoma.

From a clinical perspective, this case supports the value of clinical molecular profiling in ovarian clear cell carcinoma, as it may reveal actionable alterations that could inform personalized treatment strategies. The identification of this novel fusion gene also suggests that screening for NTRK fusions might be warranted in recurrent or advanced ovarian clear cell carcinoma, particularly in cases where additional treatment options may be needed.

Author contributions

DO: writing introduction, case presentation and case discussion, contributing in editing and reviewing; TC: writing introduction, case presentation and case discussion, contributing in editing and reviewing; KN: writing case presentation, contributing in genomic analysis; RT: writing case presentation, contributing in genomic analysis; MJ: contributing in editing and reviewing; TS: contributing in editing and reviewing; MT: contributing in editing and reviewing; YK: contributing in editing and reviewing; SO: contributing in editing and reviewing; TY: contributing in editing and reviewing; KS: contributing in editing and reviewing; HN: contributing in genomic analysis, editing and reviewing; WY: contributing in editing and reviewing.

Funding

This work was supported by the Ministry of Education, Culture, Sports, Science, and Technology, Japan (KAKENHI 21H03079).

Data availability

The data generated in the current study are available from the corresponding author upon reasonable request.

Declarations

Conflict of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Ethics approval and consent to participate

Written informed consent was obtained from the patients for the publication of this case report and accompanying images (IRB number 20070081). A copy of the written informed consent is available for review by the Editor-in-Chief of this journal upon request.

Consent for publication

A copy of the written informed consent is available for review by the Editor-in-Chief of this journal upon request.