A CRISPR/LbCas12a system for Borrelia burgdorferi sensu stricto detection in blacklegged ticks

Abstract

CRISPR/Cas systems have the potential to revolutionize DNA detection of vector-borne pathogens with highly specific and user-friendly assays. One such system, named DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR), uses a guide RNA (gRNA) and Cas enzyme to bind to and cut DNA targets. Following cutting, Cas12a exhibits non-specific collateral cleavage of single-stranded DNA (ssDNA). A ssDNA reporter in the reaction allows the trans-cleavage activity to be harnessed as an amplified output signal upon recognition of the target by the Cas12a/gRNA complex. We developed a DETECTR assay to detect Borrelia burgdorferi sensu stricto, the primary Lyme disease pathogen in the United States, in blacklegged ticks (Ixodes scapularis) collected from forests in southern Vermont. We compared DETECTR to gel electrophoresis of PCR-amplified products and used quantitative real-time PCR (qPCR) of a different B. burgdorferi primer set for independent confirmation. We found that 123/125 of the samples had identical results for DETECTR and gel electrophoresis. Both assays identified the same 33 B. burgdorferi-positive samples and the same 90 B. burgdorferi-negative samples. On a subset of eight samples, we tested DETECTR using lateral flow test strips and obtained identical results to those obtained with the fluorescence-based DETECTR. The sensitivity of DETECTR was lower than qPCR, which detected nine additional B. burgdorferi-positive samples. When qPCR is not available, the DETECTR assay offers a robust alternative to gel electrophoresis that is more user-friendly and requires less time. Due to the highly specific nature of the assay, DETECTR provides additional confidence that a B. burgdorferi target is present.

Introduction

The surveillance of vector-borne pathogens in natural communities is critical both to determine where and when people are at risk for pathogen exposure and to model spatiotemporal patterns of disease risk (Eisen and Paddock 2021). Inexpensive and user-friendly assays of pathogen detection have the potential to improve predictive models of vector-borne diseases by increasing their adoption. A more accessible pathogen detection assay for Borrelia burgdorferi sensu stricto, the primary agent of Lyme Borreliosis (“Lyme disease”) in the United States, may aid in the modeling of disease risk by expanding surveillance programs. Lyme disease is an illness affecting an estimated 476,000 people annually (Kugeler et al. 2021), and the causative agents are vectored by Ixodes pacificus (the western blacklegged tick) in the western United States and Ixodes scapularis (the blacklegged tick) in the eastern United States. These vectors are distributed widely, hindering effective data collection on their infection prevalence, especially for blacklegged ticks in the eastern United States, which are responsible for most cases of Lyme disease. In southern Vermont, Lyme disease reporting is consistently among the highest in the United States on a per capita basis, and information about vector infection prevalence in southern Vermont is limited (but see Serra et al. 2013, Allen et al. 2019, Landesman et al. 2019, Baldwin et al. 2022).

Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated proteins (CRISPR/Cas for short) have been adopted for a diversity of nucleic acid sensing applications (Kellner et al. 2019, Aman et al. 2020, Wu et al. 2021, Mao et al. 2023). One such application utilizes the Cas12a enzyme, in combination with a guide RNA (gRNA), to bind to a 20 to 23 nt section of double-stranded DNA and make a double-stranded cut that is distal to a four-nucleotide protospacer adjacent motif (PAM), present on the complementary target strand. After this cut is made, the Cas12a enzyme exhibits non-specific collateral trans cleavage of single-stranded DNA. This feature of the Cas12a enzyme is harnessed to develop a reporter molecule that may be detected by a fluorescent plate reader (eg Cheng et al. 2024) or lateral flow strips (eg Kanitchinda et al. 2020, Ooi et al. 2021, Muriuki et al. 2024). The requirement of specific gRNA-ds DNA pairing and a PAM site (TTTV) allows for highly specific nucleic acid detection, while the trans cleavage of a reporter increases the readout signal. This CRISPR/Cas detection system has been named “DNA Endonuclease Targeted CRISPR Trans Reporter” or DETECTR for short (Chen et al. 2018).

The DETECTR protocol has been utilized for a diversity of applications pertaining to infectious diseases, such as for the detection of human respiratory viruses (Qian et al. 2021, Hu et al. 2024, Wang et al. 2024), improved diagnosis of bacterial infections (eg Tu et al. 2023, Cheng et al. 2024, Compiro et al. 2025, Fu et al. 2025), detection of wildlife pathogens (Pérez et al. 2024) and agricultural pathogens (Kanitchinda et al. 2020, Liu et al. 2021, Sukonta et al. 2022, Major et al. 2023). The DETECTR system has additionally been applied to the detection of vector-borne disease agents such as Leishmania spp. (Peng et al. 2025) as well as for insect and disease vector identification when standard microscopic approaches are not feasible (Rafferty et al. 2024, Shashank et al. 2024). Recently, a CRISPR-Cas12a assay was developed for the detection of Theileria parva, a tick-borne agent of East Coast fever that affects cattle in sub-Saharan Africa (Muriuki et al. 2024).

The objective of this study is to design a DETECTR assay for Borrelia burgdorferi sensu stricto in blacklegged ticks amplified by endpoint PCR and to compare the assay to detection by gel electrophoresis. We demonstrate that DETECTR provides identical results to gel electrophoresis with a more user-friendly and highly specific assay.

Materials and Methods

Sample Preparation

We tested the DETECTR assay on 125 DNA extracts from I. scapularis nymphs (N = 99), female adults (N = 10), and male adults (N = 16) collected in Rutland County, Vermont, from six forests on private and state-owned lands. Ticks were collected from 2020 to 2023 by the drag cloth method and either placed in 100% ethanol (2020–2022 samples) or stored live with a single blade of glass (2023 samples) and then stored in a −30 °C freezer. Prior to DNA extraction, ticks were surface sterilized with 10% bleach to minimize surface contamination with microbial DNA, identified to the genus level with a Zeiss Stemi 508 stereomicroscope, and stored in individual 2 ml sample tubes at −60 °C. Following the deep freeze, ticks were disrupted on a Qiagen Tissue Lyser LT (Alameda, CA) at 40 Hz for 2 min, with a sterile 5 mm steel bead, and treated with proteinase K at 56 °C overnight. We used the QIAamp DNA Micro Kit for DNA extraction. The samples were eluted in either 80 μl (for nymphs) or 100 μl (adults) of Qiagen’s buffer AE. Quantification was performed with the Qubit ds DNA broad range kit on a 2.0 Qubit fluorometer (Life Technologies, Carlsbad, CA).

B. burgdorferi infection status was determined by quantitative real-time PCR (qPCR), with Taqman chemistry, as described by Landesman et al. (2019). Primers and probe targeted a region of the 16S gene (Barbour et al. 2009), and amplification was performed on a Qiagen Rotor Gene Q PCR thermal cycler using the Quantinova mastermix. Each qPCR run included a standard generated from serial dilutions (76–76,000 copies per μl) of linearized plasmid containing the 16S amplicon (Landesman et al. 2019). Samples with a Ct value of <38.5 were considered positive for B. burgdorferi. DNA extractions were performed with sample blanks that contained a sterile 5 mm bead but no tick (“bead blanks”).

DETECTR Assay

The DETECTR assay was performed on sample amplicons and confirmed by both a fluorescence-based readout and by agarose gel electrophoresis. This testing was performed on the previously described DNA extracts used for qPCR analysis but with a primer set that targeted a 631 nt 5S to 23S interspace region (5SrRNArc-23SrRNA3′D2; Fwd: CCCTGGTGGTTAAAGAAAAG, Rev: TTATTACAGACTAAGCCTAAACGTC; Bugrysheva et al. 2011). PCR was performed on 5 to 100 ng extracted DNA with Phusion High Fidelity Mastermix (ThermoFisher Scientific, Waltham, MA) on a BioRad T100 thermocycler (Hercules, CA). The PCR cycle included initial denaturation at 98 °C for 30 s followed by 30 cycles of 10 s at 98 °C, 30 s at 59.5 °C, 19 s at 72 °C, and a final extension for 7 min at 72 °C.

For the DETECTR assay, we designed a 23 nt gRNA targeting the 5S to 23S amplicon (Guide #1; 5′-GCTCGCCACTA|CTAAGGGAATCT-3′) with a 5′TTTC PAM. This guide was selected using Geneious Prime software v2025.0.3 (Auckland, New Zealand) and predicted for cutting efficiency in silico with DeepCpf1 (https://deepcrispr.info; Kim et al. 2018). The Cas12a enzyme was derived from the Lachnospiraceae bacterium ND2006 from New England Biolabs (Ipswich, MA). The reporter molecule (5′6FAM-TTATT-BHQ1-3′) contained a 5′ FAM fluorophore (6-carboxylfluorescein) and 3′ Iowa Black quencher, obtained from Integrated DNA Technologies Inc. (Coralville, IA). The guide-enzyme complex was formed at room temperature for 10 min by combining equimolar concentrations of gRNA and LbCas12a. The gRNA/LbCas12a complex makes a double-stranded cut in the B. burgdorferi amplicon between positions 110 to 111 and 114 to 115, resulting in expected fragment sizes of 519 bp and 115 bp.

We tested different incubation temperatures (room temperature vs. 37 °C) for gRNA/LbCas12a complex formation. A subset of samples with poor endpoint PCR amplification were re-tested with a second guide (Guide #2; 5′-TGTTGTATAAATAAATTGGCAAA-3′ with an adjacent TTTA PAM) that had a lower GC content (25%) and a somewhat lower DeepCpf1 score (64.8). Prior to using Guide #2, we compared its performance to Guide #1 on a subset of 16 samples.

The DETECTR reaction mixture contained 500 nM forward and reverse primers, 83 nM of gRNA, 83 nM of LbCas12a, 100 nM of reporter, and a 1× NEBuffer r2.1 in a final volume of 30 μl. For each sample assay, we combined 26 μl of the reaction mixture with 4 μl of PCR amplification product on an OptiPlate 96½-well plate (Revvity Health Sciences Inc., Waltham, MA). Fluorescence was detected on a BioTek Synergy HTX Multimode Reader (Agilent Technologies, Inc., Santa Clara, CA) at 37 °C. We used visual analysis of an increase in fluorescence to identify samples positive for B. burgdorferi. This interpretation was guided by the results of qPCR data, which provided a priori knowledge of infection status. For selected samples, LbCas12a cutting was confirmed by visualizing cut products (519 bp and 110 bp fragments, as predicted by Geneious software) on 3% agarose gels after treatment with proteinase K.

We assessed the accuracy of the DETECTR assay by comparing the results of fluorescence detection to agarose gel electrophoresis (1.2% gels run at 120 V for 45 min). Gels were stained with ethidium bromide and visualized on a BioRad Gel Doc XR Molecular Imaging System. Bands near the 600 bp fragment of an Invitrogen 100 bp ladder were considered positive for B. burgdorferi. Samples that were positive by DETECTR, but negative by gel electrophoresis, were re-analyzed with a 36-cycle endpoint PCR in an attempt to increase the sensitivity of gel electrophoresis. The results of DETECTR and gel electrophoresis were additionally compared to qPCR for independent confirmation of results. In addition to the 125 tick samples, we tested DNA extracts from 10 bead blanks with our qPCR, gel electrophoresis, and DETECTR protocols to test for sample contamination.

We compared calculations of specificity, sensitivity, positive predictive value (PPV), and negative predictive value (NPV) for DETECTR and gel electrophoresis (Shreffler and Huecker 2025). Specificity is calculated as the ratio of true positives to the sum of true positives and false negatives. Sensitivity is calculated as the ratio of true negatives to the sum of true negatives and false positives. We used the qPCR results as the “true” estimate of a positive or negative result. PPV was calculated as the ratio of true positives to the sum of true and false positives, and NPV was calculated as the ratio of negatives to the sum of true and false negatives.

On a subset of samples (N = 8) that included a mixture of B. burgdorferi-positive (three) and -negative (five) samples, we experimented with HybriDetect lateral flow test strips from Milenia Biotec (Giessen, Germany) as an alternative approach to the fluorescence-based DETECTR. The reporter molecule used with the test strips contained a 5′ FAM dye, which binds to anti-FITC antibody, and a 3′ Biotin molecule that is bound to gold nanoparticles. During a negative reaction, the reporter molecule binds to streptavidin on the control line. When LbCas12a cutting occurs (ie when B. burgdorferi amplicons are present), the gold nanoparticle + FAM flows upstream to the test line, where it binds to an anti-gt antibody. Uncut reporter continues to bind to the control line, and a positive result is indicated by the presence of two bands on the test strip (eg Kanitchinda et al. 2020, Qian et al. 2021, Sukonta et al. 2022, Tu et al. 2023).

Results

Among the 125 ticks that were tested, 41 were B. burgdorferi-positive by qPCR, 35 were positive by gel electrophoresis, and 33 were positive by DETECTR. The percentage of B. burgdorferi-infected adult ticks was 73% (19/26) by qPCR, which was higher than by gel electrophoresis (14/26; 54%) and DETECTR (13/26; 50%). The nymphal infection percentages were 22.2% (22/99) by qPCR, 21.2% (21/99) by gel electrophoresis, and 20.2% (20/99) by DETECTR. We found 98.4% (123/125) agreement between gel electrophoresis and DETECTR in their ability to detect the results of endpoint PCR amplification (Table 1). Both assays identified the same 33 B. burgdorferi-positive samples and the same 90 B. burgdorferi-negative samples. A comparison of the output of DETECTR and gel electrophoresis is provided in Fig. 1 (left and middle panels), and fluorescence data for all samples are provided as Supplementary Data. There were two samples for which a visible band was present on gels, but no fluorescence signal was observed with DETECTR. These two samples were positive by qPCR. There were 12 samples for which there was disagreement between qPCR and endpoint PCR. This includes nine samples that were only positive by qPCR and not by either endpoint PCR assay. All nine of these samples had Ct values >30 (Supplementary Fig. S1). Three samples were negative by qPCR but positive by both gel electrophoresis and DETECTR. There were 111 samples with perfect agreement among all three assays (ie all three were either B. burgdorferi-positive or B. burgdorferi-negative). Five samples were positive by two of the three tests. This includes two samples that were only negative by DETECTR and three samples that were only negative by qPCR (Supplementary Table S1).

Table 1.

Comparison of DETECTR and gel electrophoresis for detection of B. burgdorferi sensu stricto

DETECTR/Gel	Frequency
+/+	33/125 (26.4%)
−/−	90/125 (72%)
+/−	0/125 (0%)
−/+	2/125 (1.6%)
Overall	123/125 (98.4%)

The symbols + and − indicate whether the assay was positive or negative for B. burgdorferi.

Fig. 1.

Detection of PCR amplification products by agarose gel electrophoresis (left), DETECTR using a fluorescence plate reader (middle), and DETECTR using lateral flow test strips (right). The same eight samples were tested by each method.

Prior to re-testing with the 36-cycle PCR, DETECTR and gel electrophoresis had identical sensitivities (0.79) and almost identical specificity values (0.98 and 0.97 for electrophoresis and DETECTR, respectively). The assays had identical NPVs (0.88) and very similar PPVs (0.95 and 0.93 for electrophoresis and DETECTR, respectively). The 36-cycle PCR resulted in three additional samples that were positive by gel electrophoresis. For gel electrophoresis, this resulted in a slightly higher sensitivity value (0.82), a slightly lower specificity value (0.97), and a slightly higher NPV (0.90).

All 10 bead blanks were negative by qPCR and gel electrophoresis. However, 1 of the 10 bead blanks had a positive DETECTR result, despite being negative for qPCR and gel electrophoresis. We repeated the endpoint PCR and DETECTR assay for this sample and found the same result.

A DETECTR signal in B. burgdorferi-positive samples was usually detected within 10 min (Fig. 2). Several samples reached fluorescence saturation (ie the maximum detectable signal) before the end of the analysis, and while the signal continued to rise. When the gain on the plate reader was lowered sufficiently to prevent saturation, the fluorescence signal of B. burgdorferi-positive samples usually leveled off after approximately 60 min (Fig. 2), indicating the approximate time at which most cutting was complete. Changing the incubation temperature for gRNA/LbCas12a complex formation (room temperature vs. 37 °C) had no detectable effect on the results (Supplementary Fig. S2). The comparison of the fluorescence signal in B. burgdorferi-positive samples for Guides #1 and #2 yielded similar results, with Guide #1 exhibiting a somewhat stronger signal (Supplementary Fig. S3).

Fig. 2.

Sample plate reader output, showing the time at which B. burgdorferi-positive samples plateau (H258, H257, H261, and H260), which corresponds to the time at which most LbCas12a cutting was completed.

We confirmed CRISPR/LbCas12a cutting on three B. burgdorferi-positive samples by performing gel electrophoresis on cut vs. uncut PCR amplification products. On the uncut samples, we observed a fragment size slightly above the 600 bp ladder (Fig. 3), consistent with the expected PCR fragment length of 631 bp. On the CRISPR/LbCas12a-cut product, we observed two bands: one between the 500 bp and 600 bp ladder and a very faint band between 100 bp and 200 bp. These fragments were consistent with the 519 bp and 115 bp fragments expected to be generated based on the location at which the gRNA binds to the amplicon.

Fig. 3.

Comparison of CasLb12a cut vs. uncut 5S to 23S amplicons. Three B. burgdorferi-positive samples are shown with the uncut product to the left of the cut product. L to R: H252, H287, H289. CasLb12a cuts for H287 are not visible, likely due to poor PCR amplification resulting in insufficient production of fragments. However, H287 was positive by fluorescence-based DETECTR and, upon reanalysis at a later date, by gel electrophoresis. A very faint band at 100 bp was present for H252 and H289 (not detectable in this image).

The eight PCR amplification products tested with lateral flow test strips yielded identical results as the plate reader output and electrophoresis gel for the samples tested, identifying the same three B. burgdorferi-positive samples and the same five B. burgdorferi-negative samples (Fig. 1, right panel). All test strip samples had strong bands at the control line, indicating correct functioning of the strips. Samples with a positive result had a strong band at the test line, and samples with a negative result had faint bands at the test line. A faint band at the test line is the expected pattern for a negative test (eg Kanitchinda et al. 2020, Qian et al. 2021, Sukonta et al. 2022, Tu et al. 2023). The test strip results took approximately 20 min to appear.

Discussion

Estimates of the B. burgdorferi infection prevalence, when combined with I. scapularis population densities, may be used to measure the risk of pathogen transmission to humans (Ostfeld et al. 2002). These estimates additionally provide a key metric for modeling of B. burgdorferi transmission within ecological communities (Brunner et al. 2008, Vuong et al. 2017, Ratti et al. 2021). We demonstrate that the DETECTR assay expands the toolkit available for acquiring this critically needed metric. It may be used as a robust alternative to gel electrophoresis for the detection of PCR amplification of B. burgdorferi in blacklegged ticks. The results of gel electrophoresis and DETECTR were nearly identical, with 98.4% (123/135) overall agreement (Table 1). The presence of a fluorescence signal during the DETECTR assay (Fig. 1) is an indication that LbCas12a performed non-specific cleavage of the ssDNA reporter molecule, activity that is triggered after the enzyme cleaves its dsDNA target. Cutting of our dsDNA target molecule (Fig. 3) provides additional confidence that the target molecule, and thus B. burgdorferi, were present in the sample.

There were three samples that were initially positive by DETECTR, and negative by gel electrophoresis, for which the electrophoresis results changed following the 36-cycle PCR. The 36-cycle PCR resulted in bands near the 600 bp ladder, indicating agreement by gel electrophoresis for a positive result. However, increasing the cycle number resulted in additional non-specific bands, making gel interpretation ambiguous. The presence of both a positive DETECTR result and a positive qPCR test gave us additional confidence that we correctly interpreted the gel electrophoresis bands on the 36-cycle PCR test.

The DETECTR assay was less sensitive than qPCR, which detected nine additional B. burgdorferi-positive samples. This difference may be attributed to the higher cycle number used for qPCR (40 cycles vs. 30 cycles for endpoint PCR; Supplementary Fig. S1). However, there were 10 additional samples with Ct values above 30 that were detected by endpoint PCR, suggesting that further refinements to the endpoint protocol could resolve some additional differences between qPCR and endpoint PCR. The sensitivity of CRISPR/Cas assays may be increased by coupling the reaction to a more sensitive amplification method, such as loop-mediated isothermal amplification or recombinase polymerase amplification. These methods are commonly used in conjunction with CRISPR/Cas12a for the detection of infectious pathogens (Broughton et al. 2020, Kanitchinda et al. 2020, Qian et al. 2021, Muriuki et al. 2024).

Our comparison revealed a small number of ambiguities among the assays. For example, there were two samples that were positive by qPCR and gel electrophoresis, but negative by DETECTR (Supplementary Table S1), including after re-testing the samples. Consequently, while estimates of sensitivity and NPV were very similar, these differences resulted in slightly higher values for gel electrophoresis. While this may suggest that the DETECTR results were false negatives, these samples had Ct values of 33.1 and 36.2 by qPCR, which raises uncertainty about whether they were truly amplified by the 5S to 23S primers (Supplementary Fig. S1). The negative DETECTR results may alternatively point to the presence of a B. burgdorferi sensu stricto variant that was a mismatch for our gRNA or that the observed gel electrophoresis bands represent off-target amplification.

An additional source of ambiguity arose with three samples for which there was a negative qPCR but positive results by gel electrophoresis and DETECTR (Supplementary Table S1). This may suggest the presence of a different Borrelia species, such as B. miyamotoi, which has been reported in frequencies of 2.4% and 2.2% of adult and nymphal-stage I. scapularis, respectively, in the nearby states of Connecticut and Rhode Island (Connally et al. 2025). Additionally, B. miyamotoi was detected at a site near our study region (1/84 samples tested; Guang Xu, personal communication). In order to determine the likelihood of cross-reaction between our primers and B. miyamotoi, we tested five B. miyamotoi-positive DNA extracts from I. scapularis (provided by the New England Center of Excellence in Vector-borne Diseases) with the 5S to 23S primer set and found no electrophoresis bands. Thus, we speculate that this disagreement between qPCR and endpoint PCR for three samples may point to the presence of a different variant of B. burgdorferi sensu stricto.

For our analysis, we relied upon visual interpretation of the DETECTR signal, which presents a limitation that is similar to the interpretation of electrophoresis gels. A more quantitative and unbiased approach to the interpretation of DETECTR would be to look for a positive slope between zero and 45 min. Such an analysis would capture the majority of positive tests and should be confirmed by visual analysis. Future experiments should include a non-template control that could be used for baseline subtraction, contributing to improved interpretation. Importantly, our interpretation of endpoint PCR results—both by DETECTR and electrophoresis—may have been biased by having knowledge of the qPCR results, and our accuracy might have been slightly lower had we made the endpoint determination without the use of the qPCR data. Our results indicate that qPCR was the more sensitive test and, in contrast to endpoint PCR, may be completed in a single step. The DETECTR assay does not provide quantitative information about pathogen load. However, DETECTR has several benefits over gel-based detection of PCR products, including less preparation time (ie if gels are cast in-house), less waste generation and a faster detection time. In contrast to gel electrophoresis, the assay may be left unattended, and a fluorescent plate reader is a more versatile machine that may be utilized for many additional applications (eg cell viability, Enzyme-linked immunosorbent assays, DNA and protein quantification, etc). As an alternative to a plate reader, the DETECTR assay may be performed with lateral flow test strips (Fig. 1), further reducing the need for expensive machinery and technical expertise. When combined with an isothermal amplification approach, there is the potential for developing a field deployable assay, allowing for “just in time” testing, as has been performed for detection of other vector-borne disease agents (eg Muriuki et al. 2024, Peng et al. 2025).

A key advantage of the DETECTR assay is that it is highly specific, reducing the ambiguity that may arise with the interpretation of electrophoresis gels. The assay may be used as described here, or the gRNA can be re-tuned to detect amplification products of other gene regions, provided there is a PAM site (TTTV) adjacent to a target-specific 20 to 23 nt DNA sequence. Although our analysis focused on Borrelia burgdorferi sensu stricto, DETECTR has the potential to simplify the detection of species within the Borrelia burgdorferi sensu lato complex (Rudenko et al. 2011), a process that typically utilizes a combination of DNA amplification, DNA sequencing, and bioinformatics (Hojgaard et al. 2020). The assay has the potential to be multiplexed, as has been done for other CRISPR/Cas systems (eg Kellner et al. 2019).

There are other primer sets, such as those targeting the Outer Surface Protein C gene (OspC; Di et al. 2018), that may exhibit greater specificity for Borrelia burgdorferi and that allow for increased sensitivity (ie by using a higher PCR cycle number). However, due to the high variability of the OspC gene, there is no single gRNA that can be used for general B. burgdorferi testing with DETECTR. There are at least 17 known OspC variants of B. burgdorferi in the United States, as determined by DNA sequencing (Seinost et al. 1999, Wang et al. 1999, Di et al. 2018). The study of these OspC variants provides insights into the evolutionary history of B. burgdorferi, tick feeding preference (Brisson and Dykhuizen 2004), and strains associated with disseminated cases of Lyme disease (Seinost et al. 1999, Dykhuizen et al. 2008, Wormser et al. 2008). It may be possible to harness the high specificity of gRNA–target binding and Cas12a cutting to design gRNAs that allow for DETECTR-based OspC variant detection. This is a promising application of CRISPR-Cas12a detection for studying the epidemiology of B. burgdorferi.

Supplementary Material

Supplementary material is available at Journal of Medical Entomology online.