Abstract
Background
This study aims to clarify whether Tectochrysin has a therapeutic effect on rheumatoid arthritis animal models and to explore the potential therapeutic mechanisms.
Methods
DBA mice were used to establish a collagen-induced arthritis mouse model. Then, we administered Tectochrysin via intragastric treatment at two doses of 5 mg/kg and 10 mg/kg. To evaluate the therapeutic effects, we assessed the clinical manifestations in mice, measured the levels of cytokines in mouse serum, performed pathological staining on knee and ankle joints, and analyzed bone destruction in knee and bone joints using micro-CT. Furthermore, combining molecular docking technology, we investigated the effects of Tectochrysin both in vitro and in vivo. In vitro experiments involved THP-1-induced macrophages, examining the impact of Tectochrysin on macrophages and CIA mouse peritoneal macrophages, as well as on JAK3 and STAT3 phosphorylation. We also analyzed the effects of Tectochrysin on the transcription levels of inflammatory factors in macrophages and on the migration of MH7A cells.
Results
Our study shows that Tectochrysin has a significant therapeutic effect on CIA mice. The clinical manifestations of CIA mice were alleviated after Tectochrysin administration, with reduced levels of pro-inflammatory cytokines IL-1β, IL-6, and TNF-α in the serum. Both the pathological staining of bone joints and the micro-CT results indicated less bone and cartilage damage in the Tectochrysin group. Additionally, Tectochrysin remarkably improved synovial hyperplasia and inflammatory cell infiltration in the joints of CIA mice.Molecular docking results revealed a more pronounced effect of Tectochrysin on JAK3. In both in vitro and vivo, Tectochrysin was found to inhibit the phosphorylation of JAK3 and STAT3, as well as the transcription of inflammatory cytokines in THP-1 derived macrophages.
Conclusion
Tectochrysin may be a novel RA therapeutic agent, likely acting via macrophage JAK/STAT pathway inhibition, with promising clinical potential.
Graphical abstract
Keywords: Tectochrysin, Rheumatoid arthritis, Macrophages, Inflammation, JAK/STAT signaling pathway
Introduction
Rheumatoid arthritis (RA) is a chronic inflammatory joint disease marked by progressive synovitis. It can result in irreversible cartilage and bone erosion, and cause joint destruction and functional disability. Approximately 1% of the global population is affected by RA, which predominantly occurs in elderly women [1]. If not effectively controlled, it can lead to severe pain and restricted joint movement, thereby significantly impairing the patients’ quality of life. Currently, most treatments for RA, such as NSAIDs and DEMARDs, target the symptoms of the disease [2]. They cannot cure RA completely and are associated with various adverse reactions, including immunosuppression, liver and kidney damage, and gastrointestinal reactions [3]. Thus, there is a pressing need to find effective and safe drugs for RA treatment.
A key feature of RA’s pathogenesis is the pro-inflammatory cytokines released by activated T lymphocytes, macrophages and synovial cells, such as TNF-α, IL-1 and IL-6 [4]. The synovium harbors abundant macrophages [5]. On the one hand, synovial macrophages highly express MHC-II to present antigens to CD4⁺ T cells and secrete IL-15 and IL-12, driving Th1/Th17 differentiation. In turn, the IL-1, IL-6, IFN-γ, IL-17 and other cytokines released by these T cells feedback on macrophages via the JAK/STAT pathway to sustain M1 polarization, thereby establishing a “T-cell–macrophage” positive-feedback loop that continuously amplifies inflammation [6–8]. The JAK/STAT signaling pathway, composed of the JAK and STAT families with multiple subtypes, is crucial for cytokine signal transduction. Activation of this pathway starts when cytokines bind to transmembrane receptors. The receptors undergo conformational changes, dimerize, and recruit and activate JAKs [9, 10]. Activated JAKs phosphorylate tyrosine residues on the receptor tail, creating docking sites for STATs. STATs bind via SH2 domains to these phosphorylated sites, get phosphorylated themselves, form dimers, and translocate to the nucleus [11]. There, they bind to DNA and regulate target gene transcription. Many studies indicate that various pro-inflammatory cytokines drive RA progression by activating the JAK-STAT pathway [12]. In RA patient’s synovium, fibroblasts, a major driver of inflammation, produce IL-6 upon STAT activation, leading to ongoing joint damage [13].
Traditional Chinese herbal medicine has evolved for millennia. Safer and greener than synthetic chemicals, it derives mainly from plants [14]. Tectochrysin is a flavonoid compound widely found in Zingiberaceae plants [15], Pinus species [16], and propolis [17]. Tectochrysin has been reported to possess multiple biological activities and holds potential medicinal value. Tectochrysin has been extensively reported for its roles in anti-aging [18] and anti-tumor activities [19]. Recently, it was reported that tectochrysin attenuated shrimp-tropomyosin-induced allergic airway inflammation in a murine asthma model by suppressing the Th2 response [20, 21]. In a more recent study, Zhang et al. demonstrated that tectochrysin ameliorated type 2 diabetes via activation of the insulin receptor β [22]. Additionally, Hou et al. observed that tectochrysin reduced the production of pro-inflammatory mediators in LPS-stimulated macrophages in vitro [23]. Tectochrysin is therefore likely to possess significant anti-inflammatory activity, yet its therapeutic potential for RA was unclear. In our study, we evaluated Tectochrysin’s effects on collagen-induced arthritis in mice. Through pathological staining, micro-CT, molecular docking, and western blotting, we found it might powerfully suppress inflammation by inhibiting the JAK3/STAT3 signaling pathway.
Materials and methods
Animal experiment
Forty 6-week-old male DBA/1JGpt mice were purchased from Jiangsu Jicui Pharmacol. & Healthcare Co., Ltd. and housed in the SPF-level barrier laboratory of Anhui Medical University. They were maintained under a 12-h light/dark cycle, at 20–25 ºC and 50–60% relative humidity, with free access to standard chow and water. The Animal Ethics Committee of Anhui Medical University approved all procedures (Approval No. LLSC20211321).
CIA model and drug administration
The CIA mouse model was set up as described [24]. DBA/1JGpt mice were kept for a week to acclimate. Then, hair on their tail-back was removed chiken type II collagen, mixed 1:1 with complete Freund’s adjuvant, was emulsified by grinding and injected into the tail-back skin at multiple sites [25]. A booster was given on day 21. Mice were then split into three groups of 10, group 1: vehicle control; group 2: Tectochrysin 1 mg/kg; group 3: Tectochrysin 5 mg/kg. Paw clinical signs were checked and recorded every two days. On day 26 post-primary immunization, treatment began. Tectochrysin (BidePharmatech Co., Ltd., China, Cat#BD92955) was dissolved in DMSO, then in sodium carboxymethyl cellulose solution. It was given orally at 1 and 5 mg/kg daily. The control group got the same volume of vehicle. Mice were sacrificed on day 51 for pathological analysis.
Evaluation of arthritis
To evaluate the severity of CIA mice, clinical scoring was initiated on day 27 post-prime immunization and repeated every second day, comprising arthritis index, paw swelling count and body weight. Arthritis index criteria: 0 = normal; 1 = mild erythema/edema of ankle; 2 = mild erythema/edema from ankle to metatarsophalangeal joints; 3 = moderate erythema/edema from ankle to metatarsophalangeal or metacarpophalangeal joints; 4 = severe erythema/edema extending from ankle to digits. From day 0 onward, the number of swollen paw segments was recorded every two days for each mouse (one ankle plus five-digit joints per paw). Each segment showing erythema scored 1 point, giving a maximum of 24 points per animal [26].
Cell
MH7A and THP-1 cells (Procell) were cultured in RPMI 1640 with 10% FBS (serum batch number) and 1% penicillin-streptomycin at 37 ºC, 5% CO2. Subculture was done every 48–72 h. THP-1 cells were induced into macrophages with 100 nM PMA for 24 h [27], flow cytometry analyse was employed to detect CD11b and CD68 expression, thereby confirming successful induction. Post-induction, these macrophages were seeded in 6-well plates, stimulated with 10 ng/mL IL-6 [28], and treated with Tectochrysin at 20, 50, 100 µM, or 20 µM tofacitinib as a control [29]. After 24 h, cells were collected for RT-qPCR or western blot analysis.
For Transwell assays, logarithmic-phase MH7A cells (1 × 104 per well) were seeded in Transwell chambers. After 6 h, IL-6 (20 ng/mL) and/or Tectochrysin (50 µM) were added. Post-24 h incubation, the medium was discarded, and cells were stained with 0.1% crystal violet for 10 min. non-migrated cells were removed, and migrated cells were photographed under a microscope.
ELISA
Mouse serum cytokine assay: Collect mouse blood, leave it at room temperature for 1 h, then centrifuge to obtain serum. Measure IL-1β, TNF-α, IL-6, and IL-10 levels in serum samples from different groups. THP-1 derived macrophage assay: Culture macrophages from THP-1 cells with IL-6, with or without 50 µM Tectochrysin, for 24 h. Collect supernatants to measure IL-1β and TNF-α levels. Follow the MLBIO (Shanghai, China) assay kit instructions for detailed procedures.
RT-qPCR
Total RNA was extracted from mouse splenocytes using TRIzol reagent (Biomed China, #RA101-01). cDNA was synthesized using a 5× reverse transcription system in a 20 µL reaction volume. The cDNA was diluted fourfold, and PCR amplification was performed following the manufacturer’s instructions (YEASEN, China, #11172ES). The 20 µL PCR reaction mixture was subjected to the following thermal profile: initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 35 s, and extension at 72 °C for 15 s. A melting curve analysis was performed by heating the samples to 95 °C for 15 s, cooling to 60 °C for 60 s, and then heating back to 95 °C for 15 s [24]. Target gene expression was quantified using the 2−ΔΔCT method, with β-actin as the reference gene. The primer sequences for RT-qPCR are listed in the Table 1.
Table 1.
Primers used in this article
| Gene | F/R | Sequence | |
|---|---|---|---|
| Mouse | tbet | F | TGTTCCCAGCCGTTTCTACC |
| R | GCTCGGAACTCCGCTTCATA | ||
| rorγt | F | ACCAGGCATCCTGAACTTGG | |
| R | GCATATGGTACCTCTGGGGC | ||
| ifn-γ | F | AGCAAGGCGAAAAAGGATGC | |
| R | CTCATTGAATGCTTGGCGCT | ||
| foxp3 | F | GGGGAAGCCATGGCAATAGT | |
| R | AAGGGGGTCGCATATTGTGG | ||
| gapdh | F | ACCACAGTCCATGCCATCAC | |
| R | TCCACCACCCTGTTGCTGTA | ||
| Human | il-1β | F | CTGGGAAATTCATTGGGAAGA |
| R | ACATCCAGGATTGGAGGATCT | ||
| tnf-α | F | ACCTTCTCCTTGGGACTCCT | |
| R | CTGGGTGGTTTGCTACGACG | ||
| β-actin | F | GAGGCTATCAGCTTGCGTGAC | |
| R | AGCACGGCATCGTCATGGAG |
H&E staining
To assess histopathological features, we used hematoxylin-eosin (H&E) staining. The hind limbs and spleens from the study subjects were first fixed in 4% paraformaldehyde for 24 h. After fixation, the hind limbs underwent decalcification for 30 days with fresh solution every two weeks, while the spleens were directly embedded in paraffin. We systematically evaluated inflammation and bone erosion in the knee and ankle joints by analyzing synovial hyperplasia, inflammatory cell infiltration, pannus formation, and bone/cartilage integrity. Two experienced researchers independently conducted this assessment to ensure objectivity. Additionally, another independent group of researchers performed H&E staining on spleen tissue samples and quantified the changes based on spleen morphology, germinal center presence, and white blood cell infiltration. A 0–5 ordinal scale was used, where 0 = no change and 5 = severe change [26].
Micro-CT analysis
The knee and ankle joints of mice from different groups were dissected and scanned using a micro-CT system (Pingsheng Medical Technology, China, VNC-102). The scanning conditions were as follows: radial field of view (FOV) 45 mm, maximum axial scanning range 86 mm, fastest scanning speed of 4 s/bed, reconstruction pixel size a minimum of 0.6 μm, and spatial resolution less than 4 μm @ 10% MTF. Raw images were reconstructed with the three - dimensional reconstruction software Recon. The data analysis software Avatar was used to analyze the region of interest (ROI) for all samples, ensuring that the same area was selected for analysis. The required parameter values were obtained and data were exported.
Molecular docking
Molecular docking of Tectochrysin with JAK1, JAK2, and JAK3 proteins was performed using Discovery Studio 2020 (DS 2020, Accelrys Software Inc.). The 3D crystal structures of JAKs were retrieved from the Protein Data Bank (PDB) (https://www.rcsb.org/). In the protein preparation module of DS, we removed redundant conformations of JAKs proteins, completed incomplete amino acid residues, and added hydrogens to make the protein ready for docking. Using the “From Receptor Cavities” tool in “Define Site” the active site was defined as a region within 10.8 Å of the JAKs’ active site pocket. Molecular docking was carried out using the LibDock module with default settings, treating the receptor as rigid and the ligand as flexible [30].
Western blotting
Prepare cell or tissue homogenates in lysis buffer, homogenize, and lyse on ice. Centrifuge at 4 °C and 12,000 rpm for 10 min. Collect the supernatant and determine protein concentration using the BCA method. Separate total proteins via SDS-PAGE, transfer to a PVDF membrane, and block with serum for 1 h. Incubate with primary antibodies (JAK3 (Abcam, ab45141, 1:1000), p-JAK3 (Abcam, ab278789, 1:1000), STAT3 and p-STAT3 were provided by CST#9139 and #9145(1:1000)) overnight at 4 °C. After three TBST washes, apply secondary antibodies and incubate at room temperature for 1 h. Following three more TBST washes, visualize the bands. Analyze band densities using imaging software, normalize target protein densities against control proteins for statistical analysis [31].
Statistical analyses
Data were analyzed using GraphPad Prism 8.0.2 software, and the results were presented as the mean ± SEM. Data from the experimental groups were compared using one-way analysis of variance followed by Tukey’s post hoc analysis. Comparison between the two groups was performed using the t test. Differences were considered significant at p < 0.05.
Results
Tectochrysin ameliorates clinical manifestations in CIA mice
DBA/1JGpt mice exhibited paw erythema, swelling, and weight loss from day 27 after immunization. Tectochrysin (1/5 mg/kg) was administered daily via oral gavage (Fig. 1A). We monitored paw swelling, arthritis index, body weight, and paw thickness. CIA group mice reached maximal paw swelling on day 39, followed by a decline in all indexes. In contrast, Tectochrysin-treated mice exhibited marked improvement in paw swelling and redness (Fig. 1B). Weight loss in CIA group mice was likely due to reduced food intake from joint pain. On the contrary, Tectochrysin-treated mice showed a notable increase in body weight, particularly in the 5 mg/kg group (Fig. 1C). Consistently, arthritis indexes of the 5 mg/kg group declined significantly after day 39 (Fig. 1D). Joint swelling counts confirmed that Tectochrysin reduced joint swelling in a dose dependent manner (Fig. 1E). Caliper measurements revealed increased paw thickness in CIA group mice, while the 5 mg/kg group’s paw thickness neared that of normal mice (Fig. 1F). In summary, Tectochrysin significantly improved clinical symptoms in CIA mice.
Fig. 1.
Tectochrysin alleviates clinical symptoms in CIA mice. A Schematic diagram of CIA mouse model establishment and drug administration groups; B Representative images of front and hind paws of mice at peak inflammation (day 42); C Body weight changes in mice over time; D Arthritis index changes during the inflammatory phase; E Arthritis index changes during the inflammatory phase; F Effects of Tectochrysin on paw swelling thickness in mice. n = 5, *p < 0.05, *p < 0.01. Dates were presented by mean ± SEM
Tectochrysin reduces pro-inflammatory cytokines in CIA mice
Systemic inflammation, a key feature of RA, is driven by cytokines like IL-1β (Fig. 2A), TNF-α (Fig. 2B), and IL-6 (Fig. 2C), which are produced by immune cells such as T lymphocytes and macrophages. These cytokines promote the proliferation of fibroblast-like synoviocytes, leading to bone and joint damage. In our study, serum samples from different groups of mice were collected, and ELISA was used to measure the levels of IL-1β, TNF-α, IL-6, and IL-10. Compared to the normal group, the CIA group showed significantly higher levels of pro-inflammatory cytokines and lower IL-10 levels (Fig. 2D). Tectochrysin treatment dose dependently reduced the levels of these pro- inflammatory cytokines, with the 5 mg/kg group showing the most significant decrease. Additionally, Tectochrysin increased IL-10 levels. These findings suggest that Tectochrysin may exert its therapeutic effects on CIA mice by inhibiting cytokine production.
Fig. 2.

Tectochrysin modulates cytokine levels in the serum of CIA mice. Enzyme-linked immunosorbent assay (ELISA) analysis of IL-1β (A), TNF-α (B), IL-6 (C) and IL-10 (D) in mouse serum on day 51. n = 5, *p < 0.05, **p < 0.01, ns means no significant difference. Dates were presented by mean ± SEM
Tectochrysin may regulate T cell differentiation
T cell differentiation plays a key role in RA progression, and the spleen is crucial for T lymphocyte development. We used RT-qPCR to measure the mRNA levels of tbet, rorγt, foxp3, and gate3 in mouse spleens. The CIA group showed higher tbet, rorγt, and gate3 levels and lower foxp3 levels than the normal group, indicating disordered T lymphocyte subsets. Tectochrysin treatment reduced tbet (Fig. 3A), rorγt (Fig. 3B), and gate3 (Fig. 3C) levels, with the 5 mg/kg group nearing normal levels, and upregulated foxp3 (Fig. 3D) mRNA. Thus, Tectochrysin may regulate T lymphocyte differentiation and exert immune-modulating and anti-inflammatory effects.
Fig. 3.

Tectochrysin modulates mRNA levels of immune-related genes in the spleen. RT-qPCR analysis of tbet (A), rorγt (B), ifn-γ (C) and foxp3 (D) mRNA levels in splenic tissue. n = 5, *p < 0.05, **p < 0.01, ns means no significant difference. Dates were presented by mean ± SEM
T-bet, RORγt, foxp3, and gata3 are key transcription factors for Th1, Th17, Tregs, and Th2 cell differentiation [32, 33], respectively. In the CIA group, increased t-bet and rorγt, along with decreased foxp3, suggest heightened inflammation and suppressed Tregs. Tectochrysin treatment normalized these factors, indicating potential immune-modulating and anti-inflammatory effects. Gata3 changes were less significant, implying minimal Th2 involvement, but Tectochrysin still increased its expression. The exact biological impact of Tectochrysin on Th2 cells requires further study.
Tectochrysin ameliorated pathological changes in joints and spleen of CIA mice
Inflammatory cell infiltration, synovial tissue hyperplasia, bone and cartilage destruction, and pannus formation are hallmark features of RA [34]. To evaluate the protective effect of Tectochrysin on the joints of CIA mice, knee and ankle joints from each group were subjected to H&E staining. The results confirmed intact articular surfaces with only one to two layers of synovial cells in the normal group. In contrast, CIA mice exhibited narrowed joint spaces, marked synovial hyperplasia invading the joint interface, substantial immune cell infiltration into synovial tissue, and disruption of the bone-cartilage interface. These pathological alterations were significantly ameliorated in the Tectochrysin-treated groups (Fig. 4A). Specifically, the Tectochrysin 5 mg/kg group showed only minimal immune cell infiltration, intact articular cartilage interfaces (Fig. 4B), and no significant synovial hyperplasia narrowing the joint space. Statistical analysis of inflammatory cell infiltration (Fig. 4C), synovial hyperplasia (Fig. 4D), bone/cartilage destruction, and pannus formation (Fig. 4E) further confirmed that Tectochrysin ameliorated pathological changes in CIA mice and exerted protective effects on bone and cartilage, with the 5 mg/kg dose demonstrating superior efficacy compared to the 1 mg/kg dose.
Fig. 4.
Tectochrysin protects against joint pathology in CIA mice. A Representative H&E-stained images of knee and ankle joints from different groups (magnification: ×3 and ×10; scale bars: 500 μm and 100 μm); B–E Quantitative analysis of cartilage destruction (B), immune cell infiltration (C), synovial hyperplasia (D), and pannus formation (E) in knee and ankle joints. n = 5, ns means no significant difference. Dates were presented by mean ± SEM
Compared to the control group, the CIA model group exhibited significantly aggravated congestion of the splenic red pulp, increased numbers of germinal centers. CIA induced white pulp hyperplasia, indicative of the rapid proliferation of various immune cells (e.g., T cells, B cells, macrophages) within the white pulp in response to inflammatory stimuli, contributing to immune attack and exacerbating the pathological progression. Elevated marginal zone density in the CIA group signified dense accumulation of immune cells like marginal zone lymphocytes, thereby intensifying systemic inflammation (Fig. 5A).
Fig. 5.
Tectochrysin attenuates spleen pathology in CIA mice. A Representative H&E-stained images of spleen tissue (magnification: ×3 and ×10; scale bars: 500 μm and 100 μm); B–E Quantitative analysis of red pulp congestion (B), germinal center number (C), white pulp hyperplasia (D), and marginal zone lymphatic sheath density (E) in spleen tissue. n = 5, *p < 0.05, **p < 0.01, ns means no significant difference. Dates were presented by mean ± SEM
In Tectochrysin-treated groups, red pulp congestion gradually diminished with increasing dosage, showing significant improvement at the high dose (5 mg/kg) (Fig. 5B). This indicates that Tectochrysin effectively inhibits CIA-induced red pulp congestion, likely due to improved splenic microcirculation and reduced inflammation. Tectochrysin administration reduced germinal center numbers in a dose-dependent manner (Fig. 5C), suggesting its ability to suppress germinal center formation, modulate the proliferation and differentiation of immune cells like B cells, and attenuate autoimmune responses, thereby intervening in the splenic immunopathology of CIA mice [35]. The degree of white pulp hyperplasia was reduced in all Tectochrysin dose groups, with more pronounced suppression at the high dose, demonstrating its efficacy in controlling excessive white pulp hyperplasia, maintaining splenic immune microenvironment stability, and alleviating immune-mediated tissue damage (Fig. 5D). Reduced marginal zone density in Tectochrysin-treated groups indicates its capacity to alleviate the excessive aggregation of immune cells within the marginal zone, regulate the spatial distribution of splenic immune cells, decrease inflammatory cytokine release, and ameliorate the CIA pathological state.Collectively, Tectochrysin ameliorated CIA-induced pathological changes in the spleen, including red pulp congestion, germinal center hyperplasia, white pulp hyperplasia, and abnormally elevated marginal zone density (Fig. 5E). Dose-response relationships were observed for all parameters, highlighting its significant restorative effect on splenic pathology in CIA mice and its potential as a therapeutic agent for RA.
Micro-CT revealed tectochrysin protects bone and joints in CIA mice
To investigate whether Tectochrysin protects against bone and cartilage damage in CIA mice, we performed micro-CT scans on knee and ankle joints of mice from different groups, followed by 3D reconstruction. Results showed that while control mice had intact, smooth joint structures, CIA model mice exhibited osteophyte formation, uneven joint surfaces, and narrowed joint spaces—indicating successful CIA induction and joint structural abnormalities. Tectochrysin treatment (1 and 5 mg/kg) dose-dependently reduced these pathological changes, with the higher dose showing more pronounced effects (Fig. 6A).
Fig. 6.

Tectochrysin protects against bone lesions in CIA mice. A Representative 3D micro-CT reconstructions of knee and ankle joints in CIA mice; B–E Bar charts showing quantitative analyses of BS/TV (B), BS/BV (C), Tb.Sp (D), and Tb.N (E) in mouse joints. n = 3, *p < 0.05, **p < 0.01, ns means no significant difference. Dates were presented by mean ± SEM. Abbreviations: BS/TV: Bone Surface/Tissue Volume, BS/BV: Bone Surface/Bone Volume, Tb.Sp: Trabecular Separation, Tb.N: Trabecular Number
Quantitative analysis of BS/TV, BS/BV, Tb.Sp, and Tb.N further confirmed our findings. Compared to controls, CIA mice had significantly higher BS/TV (Fig. 6B) and BS/BV (Fig. 6C), suggesting increased bone surface activity potentially linked to inflammation - induced bone metabolic disorders. Tectochrysin treatment, especially at 5 mg/kg, reduced BS/TV and BS/BV, indicating suppression of excessive bone surface activity and improved bone metabolism. Additionally, while CIA mice showed increased Tb.Sp (Fig. 6D) and decreased Tb.N (Fig. 6E) (indicative of disrupted trabecular bone structure), Tectochrysin treatment reversed these changes, enhancing trabecular bone quantity and mechanical stability. Overall, Tectochrysin improved pathological changes in knee and ankle joints of CIA mice, showing dose-dependent protective effects against bone and joint lesions.
Tectochrysin may exert therapeutic effects on CIA mice by targeting the JAK family
Systemic inflammation produces cytokines like IL-6, IL-1β, and IL-17, which activate JAK kinases by inducing conformational changes in cell—surface receptors. These JAK kinases phosphorylate specific tyrosine residues on the receptor, creating binding sites for STAT proteins. Once bound, STAT proteins are phosphorylated, form dimers, translocate to the nucleus, and regulate gene transcription to amplify synovitis.
It is hypothesized that Tectochrysin exerts anti-inflammatory effects by inhibiting the JAK family. To test this, molecular docking of Tectochrysin with JAK family crystal structures was performed using Discovery Studio. The CDocker energy and interaction energy of Tectochrysin with JAK1 were − 27.6273 and − 34.6597, respectively, indicating stable binding with energy release (Fig. 7A). Tectochrysin bound slightly less stably to JAK2 (CDocker energy: −27.0478, interaction energy: −33.9823) (Fig. 7B). However, it showed the most stable binding to JAK3 (CDocker energy: −28.2609, interaction energy: -35.4943), suggesting the strongest binding affinity. Tectochrysin interacted with amino acid residues such as LEU 828, LEU 905, and GLU 903 in JAK1, forming stable complexes through hydrogen and hydrophobic bonds. In JAK2, residues like LEU 551 and LEU 579 interacted with Tectochrysin in a different binding mode. For JAK3, residues including LEU 959, LEU 1010, LEU 881, and GLU 957 were involved, contributing to its highest binding stability (Fig. 7C).
Fig. 7.
Molecular docking reveals potential interactions between Tectochrysin and the JAKs family. A–C Representative spatial structures of the interaction sites between Tectochrysin and JAK1 (PDB ID: 6GGH), JAK2 (PDB ID: 7F7W), and JAK3 (PDB ID: 5TOZ). Molecular docking was performed using Discovery Studio 2019 Client, and the spatial structures were visualized using PyMol
In summary, molecular docking reveals that Tectochrysin binds to JAK1, JAK2, and JAK3, particularly showing strong affinity for JAK3. This suggests Tectochrysin may treat CIA mice by inhibiting JAK3 activity.
Tectochrysin suppresses the JAK3/STAT pathway and reducing inflammatory cytokine release in macrophages
To validate our hypothesis, we conducted in vitro experiments on THP-1-derived macrophages. After inducing THP-1 cells into macrophages with 100 ng/mL PMA, we stimulated them with 10 ng/mL IL-6 to activate the JAK pathway and used tofacitinib (a JAK3 inhibitor) as a positive control [36]. Western blot results showed that IL-6 increased JAK3 and STAT3 phosphorylation, but Tectochrysin reversed this in a concentration dependent manner (Fig. 8A). Notably, 100µM Tectochrysin showed a similar inhibitory effect on JAK3 and STAT3 phosphorylation as 20 µM tofacitinib, indicating strong inhibitory activity against the JAK3/STAT pathway (Fig. 8C, D).
Fig. 8.
Tectochrysin suppresses JAK3/STAT3 phosphorylation and reduces macrophage inflammatory cytokine release. A Representative western blot images of JAK3 and STAT3 phosphorylation in THP-1-derived macrophages treated with different concentrations of Tectochrysin; B Representative western blot images of JAK3 and STAT3 phosphorylation in peritoneal macrophages from CIA mice treated with Tectochrysin; C and D Quantitative analysis of JAK3 (C) and STAT3 (D) phosphorylation in THP-1-derived macrophages; E and F Quantitative analysis of JAK3 (E) and STAT3 (F) phosphorylation in peritoneal macrophages from CIA mice; G Representative images of Tectochrysin’s effect on MH7A cell migration; H Quantitative analysis of Tectochrysin’s effect on MH7A cell migration; I and J RT-qPCR analysis of IL-1β (I) and TNF-α (J) mRNA levels in THP-1-derived macrophages treated with Tectochrysin. n = 3, *p < 0.05, **p < 0.01, ns means no significant difference. Dates were presented by mean ± SEM
We also isolated peritoneal macrophages from CIA mice and found that Tectochrysin (5 and 10 mg/kg) significantly reduced p-JAK3 and p-STAT3 levels compared to the CIA group, with the 10 mg/kg dose being more effective (Fig. 8B). This supports the idea that Tectochrysin’s therapeutic effects in CIA mice may involve inhibiting JAK3 phosphorylation, making JAK3 a potential target of Tectochrysin (Fig. 8E, F).
Moreover, Transwell assays using MH7A cells demonstrated that while IL-6 promoted cell migration (Fig. 8G), 100 µM Tectochrysin significantly inhibited this effect (Fig. 8H). Since activated JAK3/STAT3 signaling drives inflammatory cytokine production, we used RT-qPCR to measure IL-1β and TNF-α mRNA levels in THP-1-derived macrophages treated with IL-6 and 100 µM Tectochrysin (Fig. 8I, J). The results confirmed that Tectochrysin suppresses the transcription of these cytokines. In summary, our findings indicate that Tectochrysin exhibits significant anti-inflammatory activity by inhibiting JAK3 and STAT3 phosphorylation, thereby reducing macrophage-derived inflammation.
Disscusion
In this study, we demonstrated for the first time that Tectochrysin, a natural flavonoid compound, exerts significant therapeutic effects in a murine model of CIA. Our findings indicate that Tectochrysin ameliorates clinical arthritis symptoms, reduces systemic and local inflammation, protects against bone and cartilage destruction, and modulates immune responses. Mechanistically, we provide compelling evidence that these beneficial effects are likely mediated through the suppression of the JAK3/STAT3 signaling pathway in macrophages, leading to reduced production of key pro-inflammatory cytokines.
The pathogenesis of RA is characterized by a self-perpetuating cycle of inflammation involving dysregulated immune cells and pro-inflammatory cytokines [37]. The JAK/STAT pathway serves as a critical hub for the signal transduction of numerous cytokines implicated in RA, such as IL-6, making it a prime therapeutic target [38–40]. Our results align with this concept. We found that Tectochrysin significantly reduced the serum levels of IL-1β, TNF-α, and IL-6 in CIA mice while promoting the anti-inflammatory cytokine IL-10. This shift in the cytokine milieu towards an anti-inflammatory state is a crucial mechanism for controlling RA progression. Furthermore, Tectochrysin administration corrected the imbalance in T helper cell subsets, as evidenced by the downregulation of t-bet (Th1) and rorγt (Th17) and the upregulation of foxp3 (Treg) in the spleen. This rebalancing of the immune response likely contributed to the observed attenuation of synovitis and splenic pathology, including reduced germinal center formation and white pulp hyperplasia.
The most significant finding of our study is the identification of the JAK3/STAT3 axis as a potential molecular target of Tectochrysin. Our molecular docking analysis predicted a strong and stable binding affinity between Tectochrysin and JAK3, even greater than its interactions with JAK1 and JAK2. This in silico prediction was robustly validated by our in vitro and ex vivo experiments. In IL-6-stimulated macrophages, Tectochrysin potently inhibited the phosphorylation of JAK3 and its downstream effector STAT3, with an efficacy comparable to the known JAK3 inhibitor tofacitinib. Consequently, this inhibition led to a marked reduction in the migration of synovial fibroblasts and the transcription of IL-1β and TNF-α. These results are consistent with a previous report that Tectochrysin reduces pro-inflammatory mediators in LPS-stimulated macrophages [23] and extend its mechanism to the JAK/STAT pathway within the context of RA. The disruption of the “T-cell–macrophage” inflammatory feedback loop, which is partly sustained via JAK/STAT signaling [41, 42], provides a plausible explanation for the broad anti-arthritic effects of Tectochrysin observed in vivo.
The functional improvement mediated by Tectochrysin was unequivocally confirmed by our pathological and radiological assessments. Histological analysis of joints revealed that Tectochrysin treatment markedly suppressed synovial hyperplasia, pannus formation, and bone/cartilage erosion. More importantly, micro-CT scans provided quantitative evidence that Tectochrysin protects against architectural joint damage, as seen in the normalization of trabecular bone parameters (Tb.Sp, Tb.N). This bone-protective effect is likely secondary to the potent suppression of inflammation, as inflammatory cytokines are known to directly activate osteoclasts [21, 43].
Despite these promising findings, our study has several limitations. First, while we identified JAK3 as a high-affinity target, the in vivo specificity of Tectochrysin for JAK3 over other JAK isoforms needs further validation, perhaps using JAK3-specific knockout models. Second, the contribution of other cell types, such as fibroblasts and osteoclasts, to the overall therapeutic effect warrants investigation. Third, the pharmacokinetic profile, long-term safety, and optimal dosing regimen of Tectochrysin remain to be fully elucidated.
Conclusion
Our study shows Tectochrysin has therapeutic effects on CIA mice, alleviating bone and cartilage damage. We report for the first time that Tectochrysin may target JAK3, inhibiting its phosphorylation, which partially explains its therapeutic effects on CIA mice. However, the exact molecular mechanism of Tectochrysin’s inhibition of JAK3 requires further study.In summary, our study explores the therapeutic effects of Tectochrysin on CIA mice and its potential mechanism, offering new insights and evidence for developing novel RA treatments.
Acknowlegements
This research was funded by the Key Natural Science Research Project of Bengbu Medical University (Grant No. 2022byzd203) and the Youth Project Fund of The Second People’s Hospital of Hefei (Grant No. 2021yqn18)and the Anhui Provincial Health Commission (Grant Number AHWJ2024Aa20414); the Hefei Municipal Health Commission Applied Medical Research Project (Grant Numbers Hwk2023zd011, Hwk2024qlgs001); Anhui Provincial Key Clinical Specialty Construction Project (No. 5 [2023] issued by the Anhui Health Commission).The authors would like to sincerely thank Mr. Tao Zhang for his valuable assistance with animal model establishment, Mr. Liangliang Luo for his contribution to data analysis and statistical processing, and Mr. Qiyu Jia for his technical support in cell culture experiments.
Author contributions
Pin Pan, Wei Huang, Shuyi Cheng: Investigation, Data curation. Tao Zhang, Liangliang Luo: Methodology, Validation. Qiyu Jia: Visualization. Lianying Hu, Jianjun Chu: Conceptualization, Supervision, Writing—review and editing.
Data availability
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.
Declarations
Ethics approval and consent to participate
The Animal Ethics Committee of Anhui Medical University approved all procedures (Approval No. LLSC20211321).
Competing interests
The authors declare no competing interests.
Informed consent
Not applicable.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Pin Pan, Wei Huang and Shuyi Cheng have contributed equally to this work.
Contributor Information
Lianying Hu, Email: 89412743@qq.com.
Jianjun Chu, Email: chujianj@mail.ustc.edu.cn.
References
- 1.Holers VM, Demoruelle KM, Buckner JH, et al. Distinct mucosal endotypes as initiators and drivers of rheumatoid arthritis. Nat Rev Rheumatol. 2024;20:601–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Zádori ZS, Király K, Al-Khrasani M et al. Interactions between NSAIDs, opioids and the gut microbiota: future perspectives in the management of inflammation and pain. Pharmacol Ther. 2023;241:108327. [DOI] [PubMed]
- 3.Makol A, Wright K, Amin S. Rheumatoid arthritis pregnancy. Drugs. 2011;71:1973–87. [DOI] [PubMed] [Google Scholar]
- 4.Weber BN, Giles JT, Liao KP. Shared inflammatory pathways of rheumatoid arthritis and atherosclerotic cardiovascular disease. Nat Rev Rheumatol. 2023;19:417–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Xu J, Zheng M, Feng Z, et al. CCL4L2 participates in tendinopathy progression by promoting macrophage inflammatory responses: a single-cell analysis. J Orthop Surg Res. 2024;19:836. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Scala P, Rehak L, Giudice V et al. Stem cell and macrophage roles in skeletal muscle regenerative medicine. Int J Mol Sci. 2021. 22. [DOI] [PMC free article] [PubMed]
- 7.Yin X, Wang Q, Tang Y, et al. Research progress on macrophage polarization during osteoarthritis disease progression: a review. J Orthop Surg Res. 2024;19:584. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Ding L, Wu L, Cao Y, et al. Modulating tumor-associated macrophage polarization by anti-maRCO mAb exerts anti-osteosarcoma effects through regulating osteosarcoma cell proliferation, migration and apoptosis. J Orthop Surg Res. 2024;19:453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Xue C, Yao Q, Gu X, et al. Evolving cognition of the JAK-STAT signaling pathway: autoimmune disorders and cancer. Signal Transduct Target Ther. 2023;8:204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Samra S, Bergerson JRE, Freeman AF, et al. JAK-STAT signaling pathway, immunodeficiency, inflammation, immune dysregulation, and inborn errors of immunity. J Allergy Clin Immunol. 2025;155:357–67. [DOI] [PubMed] [Google Scholar]
- 11.Baldini C, Moriconi FR, Galimberti S, et al. The JAK–STAT pathway: an emerging target for cardiovascular disease in rheumatoid arthritis and myeloproliferative neoplasms. Eur Heart J. 2021;42:4389–400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wang L, Yukselten Y, Nuwagaba J et al. JAK/STAT signaling pathway affects CCR5 expression in human CD4 + T cells. Sci Adv. 10:eadl0368. [DOI] [PMC free article] [PubMed]
- 13.Qin Y, Cai M-L, Jin H-Z, et al. Age-associated B cells contribute to the pathogenesis of rheumatoid arthritis by inducing activation of fibroblast-like synoviocytes via TNF-α-mediated ERK1/2 and JAK-STAT1 pathways. Ann Rheum Dis. 2022;81:1504–14. [DOI] [PubMed] [Google Scholar]
- 14.Guo X, Luo W, Wu L et al. Natural products from herbal medicine self-assemble into advanced bioactive materials. Adv Sci (Weinh). 2024;11:e2403388. [DOI] [PMC free article] [PubMed]
- 15.He B, Xu F, Yan T, et al. Tectochrysin from Alpinia oxyphylla Miq. Alleviates Aβ1–42 induced learning and memory impairments in mice. Eur J Pharmacol. 2019;842:365–72. [DOI] [PubMed] [Google Scholar]
- 16.Cuong NM, Khanh PN, Nhung LTH, et al. Acetylcholinesterase inhibitory activities of some flavonoids from the root bark of Pinus Krempfii lecomte: in vitro and in silico study. J Biomol Struct Dyn. 2024;42:4888–901. [DOI] [PubMed] [Google Scholar]
- 17.Lee S, Kim KS, Park Y, et al. In vivo anti-oxidant activities of tectochrysin. Arch Pharm Res. 2003;26:43–6. [DOI] [PubMed] [Google Scholar]
- 18.Lu M, Tan L, Zhou X-G, et al. Tectochrysin increases stress resistance and extends the lifespan of caenorhabditis elegans via FOXO/DAF-16. Biogerontology. 2020;21:669–82. [DOI] [PubMed] [Google Scholar]
- 19.Park MH, Hong JE, Park ES, et al. Anticancer effect of tectochrysin in colon cancer cell via suppression of NF-kappaB activity and enhancement of death receptor expression. Mol Cancer. 2015;14:124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Fang L, Yan Y, Xu Z, et al. Tectochrysin ameliorates murine allergic airway inflammation by suppressing Th2 response and oxidative stress. Eur J Pharmacol. 2021;902:174100. [DOI] [PubMed] [Google Scholar]
- 21.Chisari E, Rehak L, Khan WS, et al. The role of the immune system in tendon healing: a systematic review. Br Med Bull. 2020;133:49–64. [DOI] [PubMed] [Google Scholar]
- 22.Zhang J, Wu J, Shi X et al. A propolis-derived small molecule tectochrysin ameliorates type 2 diabetes in mice by activating insulin receptor β. Mol Nutr Food Res. 2024;68:e2300283. [DOI] [PubMed]
- 23.Hou R, Han Y, Fei Q et al. Dietary flavone tectochrysin exerts anti-inflammatory action by directly inhibiting MEK1/2 in LPS-primed macrophages. Mol Nutr Food Res. 2018;62. [DOI] [PubMed]
- 24.Zhang X, Zhang Z, Zhao Y, et al. Sodium chloride promotes macrophage pyroptosis and aggravates rheumatoid arthritis by activating SGK1 through GABA receptors Slc6a12. Int J Biol Sci. 2024;20:2922–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Miyoshi M, Liu S. Collagen-induced arthritis models. Methods Mol Biol. 2024;2766:3–7. [DOI] [PubMed] [Google Scholar]
- 26.Zhang F, Shu JL, Li Y, et al. CP-25, a novel anti-inflammatory and immunomodulatory drug, inhibits the functions of activated human B cells through regulating BAFF and TNF-alpha signaling and comparative efficacy with biological agents. Front Pharmacol. 2017;8:933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Pandur E, Pap R, Sipos K. Activated THP-1 macrophage-derived factors increase the cytokine, fractalkine, and EGF secretions, the invasion-related MMP production, and antioxidant activity of HEC-1A endometrium cells. Int J Mol Sci. 2024;25. [DOI] [PMC free article] [PubMed]
- 28.Strickland J, McIlmoil S, Williams BJ, et al. Interleukin-6 increases the expression of key proteins associated with steroidogenesis in human NCI-H295R adrenocortical cells. Steroids. 2017;119:1–17. [DOI] [PubMed] [Google Scholar]
- 29.Nagra D, Song K, Odia J et al. The therapeutic potential for JAK inhibitors for immune-related adverse events from checkpoint inhibitors: a review of the literature. Rheumatology (Oxford). 2025. [DOI] [PubMed]
- 30.Sun H, Wang M, Su T, et al. Ziyuglycoside I attenuates collagen-induced arthritis through inhibiting plasma cell expansion. J Ethnopharmacol. 2022;294:115348. [DOI] [PubMed] [Google Scholar]
- 31.Jin L, Zhang Z, Pan P, et al. Low-dose ethanol consumption inhibits neutrophil extracellular traps formation to alleviate rheumatoid arthritis. Commun Biol. 2023;6:1088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Ucgul AN, Bora H, Yaz Aydin G et al. Immune modulation through stereotactic radiotherapy: the role of TBX21, GATA-3, FoxP3, and RORɣt. Medicina (Kaunas). 2025;61. [DOI] [PMC free article] [PubMed]
- 33.Gharesi-Fard B, Mobasher-Nejad F, Nasri F. The expression of T-helper associated transcription factors and cytokine genes in pre-eclampsia. Iran J Immunol. 2016;13:296–308. [DOI] [PubMed] [Google Scholar]
- 34.Komatsu N, Takayanagi H. Mechanisms of joint destruction in rheumatoid arthritis—immune cell–fibroblast–bone interactions. Nat Rev Rheumatol. 2022;18:415–29. [DOI] [PubMed] [Google Scholar]
- 35.Hillion S, Miranda A, Le Dantec C, et al. Maf expression in B cells restricts reactive plasmablast and germinal center B cell expansion. Nat Commun. 2024;15:7982. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Sayoc-Becerra A, Krishnan M, Fan S, et al. The JAK-inhibitor Tofacitinib rescues human intestinal epithelial cells and colonoids from cytokine-induced barrier dysfunction. Inflamm Bowel Dis. 2020;26:407–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Chen Z, Bozec A, Ramming A, et al. Anti-inflammatory and immune-regulatory cytokines in rheumatoid arthritis. Nat Rev Rheumatol. 2019;15:9–17. 10.1038/s41584-018-0109-2. [DOI] [PubMed] [Google Scholar]
- 38.Hu L, Liu R, Zhang L. Advance in bone destruction participated by JAK/STAT in rheumatoid arthritis and therapeutic effect of JAK/STAT inhibitors. Int Immunopharmacol. 2022;111:109095. [DOI] [PubMed]
- 39.Traves PG, Murray B, Campigotto F, et al. JAK selectivity and the implications for clinical inhibition of pharmacodynamic cytokine signalling by filgotinib, upadacitinib, Tofacitinib and baricitinib. Ann Rheum Dis. 2021;80:865–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Li F, Liu Z, Xu Y, et al. Potential mechanisms of acupuncture treatment for rheumatoid arthritis: a study based on network topology and machine learning. Chin Med. 2025;20:164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Najm A, Masson FM, Preuss P, et al. MicroRNA-17-5p reduces inflammation and bone erosions in mice with collagen-induced arthritis and directly targets the JAK/STAT pathway in rheumatoid arthritis fibroblast-like synoviocytes. Arthritis Rheumatol. 2020;72:2030–9. [DOI] [PubMed] [Google Scholar]
- 42.Andia I, Atilano L, Maffulli N. Biological targets of multimolecular therapies in middle-age osteoarthritis. Sports Med Arthrosc Rev. 2022;30:141–6. [DOI] [PubMed] [Google Scholar]
- 43.Steemers E, Talbi WMI, Hogervorst JMA et al. IL-1 receptor antagonist anakinra inhibits the effect of IL-1β- mediated osteoclast formation by periodontal ligament fibroblasts. Biology (Basel). 2025;14. [DOI] [PMC free article] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.






