KLF10-IN-1 Attenuates RPE Cell Apoptosis and Experimental Diabetic Retinopathy Via the KLF10/PERK/eIF2α/ATF4/CHOP Pathway

Abstract

Purpose

To investigate the roles of Krüppel-like factor 10 (KLF10) and its inhibitor KLF10-IN-1 in regulating high-glucose/hypoxia-induced RPE cell apoptosis and their involvement in diabetic retinopathy (DR).

Methods

A DR mouse model was established using a high-fat, high-glucose diet and streptozotocin. An RPE cell model of high-glucose/hypoxia injury was constructed by culturing cells under high-glucose (30 mM) conditions in the presence of cobalt chloride (200 µM). KLF10 expression, apoptosis, and endoplasmic reticulum (ER) stress levels were assessed. KLF10 expression was modulated with small interfering RNA and overexpression plasmids. Dual luciferase reporter assays were used to evaluated the regulatory effect of KLF10 on PERK. The PERK pathway was activated by CCT020312 and inhibited by GSK2606414 for rescue experiments. The protective effects of KLF10-IN-1 were validated in vitro and in vivo.

Results

KLF10 was highly expressed in RPE cells in DR model mice. After 48 hours of high-glucose/hypoxia exposure, hypoxia, inflammation, ER stress, and apoptosis were significantly exacerbated, accompanied by KLF10 upregulation. KLF10 knockdown suppressed apoptosis and ER stress, whereas KLF10 overexpression had the opposite effect. Western blotting confirmed KLF10 regulated PERK phosphorylation, and dual luciferase assays revealed that KLF10 transcriptionally activates PERK. KLF10 mediated apoptosis through the PERK/eIF2α/ATF4/CHOP pathway. Inhibiting this pathway with KLF10-IN-1 reduced high-glucose/hypoxia-induced damage to RPE cells and ameliorated retinal damage in diabetic mice.

Conclusions

KLF10 is upregulated in DR model mice and high-glucose/hypoxia-exposed RPE cells and modulates apoptosis and ER stress through the PERK/eIF2α/ATF4/CHOP pathway. KLF10-IN-1 has protective effects, suggesting its potential for early DR treatment.

Diabetic retinopathy (DR) is a common microvascular complication of diabetes and a leading cause of visual impairment and blindness.¹ Retinal pigment epithelial (RPE) cells play a crucial role in DR progression by maintaining the outer blood–retinal barrier (oBRB) and supporting photoreceptor cell stability and metabolic homeostasis.² In the early stages of DR, hyperglycemia, hypoxia, and inflammation trigger complement activation and disrupt glucose and lipid metabolism in RPE cells.³ As DR progresses, these factors worsen RPE cell damage and death, leading to the loss of RPE layer integrity, oBRB disruption, and neovascularization, further damaging the retina.^2–4 Additionally, RPE cells interact with Müller cells and microglia through proinflammatory cytokines, promoting neuroretinal injury.^5,6 Thus, preserving and restoring RPE cell function are vital for delaying DR progression and represent a potential therapeutic strategy.

The endoplasmic reticulum (ER) in RPE cells is responsible for protein synthesis, folding, and transport, calcium regulation, and lipid biosynthesis and for maintaining metabolic balance and cellular function.⁷ In DR, metabolic disturbances such as hyperglycemia, oxidative stress, and inflammation disrupt ER homeostasis, inducing ER stress and the accumulation of misfolded proteins. Persistent ER stress leads to cellular dysfunction and apoptosis, contributing to RPE degeneration, oBRB disruption, and pathological neovascularization, further damaging the retina.^8,9

Members of the Krüppel-like factor (KLF) family, a group of zinc finger transcription factors, play key roles in cellular homeostasis and regulate processes such as proliferation, differentiation, apoptosis, and stress responses.¹⁰ Previous studies have shown that specific KLF members regulate ER stress by modulating related gene expression or affecting cellular responses to protein misfolding and oxidative injury.^11,12 Abnormal expression of KLFs (KLF6, KLF7, and KLF9) in the context of diabetes has been linked to DR.^13–15 However, the role of KLFs in ER stress within RPE cells had not been explored systematically.

In this study, bioinformatics analysis of transcriptomic data from RPE cells cultured under high glucose conditions for 72 hours revealed that KLF10 is a key gene linked to ER stress. In vitro and in vivo experiments were performed to investigate the expression, function, and mechanisms of action of KLF10. The therapeutic potential of the KLF10 inhibitor KLF10-IN-1 for DR was also assessed.

Materials and Methods

Online Analysis of Datasets

Transcriptomic data for RPE cells (GSE233164) were retrieved from the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo). GEO2R was used to compare samples from different groups and to identify differentially expressed genes. An ER stress-related gene set was obtained from GeneCards (www.genecards.org). Differentially expressed genes were subsequently compared with KLF family members (KLF1–KLF18) to identify overlapping genes for further experimental studies.

ARPE-19 Cell Culture

ARPE-19 cells (Procell Life Technology, Wuhan, China) were cultured in DMEM/F12 supplemented (Procell) with 10% fetal bovine serum (Gibco, Brisbane, Australia) and 1% penicillin-streptomycin (ThermoFisher Scientific, Waltham MA, USA) at 37°C in a 5% CO₂ atmosphere. DR was modeled in vitro as described in previous studies.^16,17 Cells were treated with 30 mM glucose and 200 µM cobalt chloride (CoCl₂, Merck, Darmstadt, Germany) for 48 hours (high-glucose/hypoxia group) on the basis of preliminary viability and inflammatory factor assays (Supplementary Fig. S1). The control groups included the normal glucose (NG, 5.5 mM), mannitol (5.5 mM glucose plus 24.5 mM mannitol), transfection control, and DMSO groups.

Cell Counting Kit-8 (CCK-8) Assay

Cells were seeded in 96-well plates at 3000 to 5000 cells per well and cultured at 37°C with 5% CO₂. The incubation time (24, 48, or 72 hours) was adjusted as needed. At the end of each incubation period, 10 µL of CCK-8 solution (APE BIO, Houston, TX, USA) was added to each well and incubated for 1.5 hours. The absorbance was measured at 450 nm using a multiwavelength (SPARK 10M, TECAN, Männedorf, Switzerland).

Cell Transfection

KLF10-specific small interfering RNA (RIBOBIO, Guangdong, China) and an overexpression plasmid (MiaoLingBio, Shanghai, China) were used in this study. Once ARPE-19 cells reached 60% to 70% confluence, they were transfected using Lipofectamine 2000 (ThermoFisher Scientific). Four to 6 hours after transfection, the medium was replaced with fresh medium, and the cells were cultured for 48 hours before further experiments. The small interfering RNAs used were siKLF10#1: 5′-GTGACCATTTGACCAAGCA-3′, siKLF10#2: 5′-CAACCCTGTTGTGACAACA-3′, and siKLF10#3: 5′-CAAAGGCGCTGTCATGTTT-3′, and siKLF10#1 and siKLF10#3 were selected for the knockdown experiments (Supplementary Fig. S2). The overexpression plasmid pCMV-KLF10 (Homo)-3 × FLAG-Neo (CMV-F: CGCAAATGGGCGGTAGGCGTG) was validated for effectiveness (Supplementary Fig. S2).

qRT-PCR

Total RNA was extracted at room temperature using TRIzol reagent (Invitrogen, Waltham, MA, USA) and either reverse transcribed immediately or stored at −80°C. cDNA was synthesized using the FastKing RT Kit with gDNase (TIANGEN Biotech, Beijing, China), and amplification was performed with gene-specific primers (SANGON, Shanghai, China). qRT-PCR was conducted on the ABI PRISM 145 system (ThermoFisher Scientific) using Quick Start General SYBR Green (Servicebio, Wuhan, China). Ct values were determined, and relative gene expression were calculated using the 2^−ΔΔCt method. The primer sequences are listed in Table 1.

Table 1.

Primer Sequences

Genes	Forward Primers	Reverse Primers
Homo-GRP78	GAACGTCTGATTGGCGATGC	ACCACCTTGAACGGCAAGAA
Homo-IRE1α	GCCACCCTGCAAGAGTATGT	GATCTTGCCGTGTGCATTGG
Homo-ATF6	CCTAGTGTGAGCCCTGCAAA	AGCACCATCAGGGCTTTGTC
Homo-PERK	GTCCCAAGGCTTTGGAATCTGTC	CCTACCAAGACAGGAGTTCTGG
Homo-CHOP	GGTATGAGGACCTGCAAGAGGT	CTTGTGACCTCTGCTGGTTCTG
Homo-XBP1	ACTGCCTGGAGGATAGCAGA	CCTTGGACTGCTGGATGTCA
Homo-KLF10	CACATCTGTAGCCACCCAGG	AGAACGGGCAAACCTCCTTT
Homo-ICAM-1	AGCGGCTGACGTGTGCAGTAAT	TCTGAGACCTCTGGCTTCGTCA
Homo-VEGF	TTGCCTTGCTGCTCTACCTCCA	GATGGCAGTAGCTGCGCTGATA
Homo-HIF-1α	TATGAGCCAGAAGAACTTTTAGGC	CACCTCTTTTGGCAAGCATCCTG
Homo-Actin	TCTCCCAAGTCCACACAGG	GGCACGAAGGCTCATCA
Mus-ICAM-1	CGGAGCCAATTTCTCATGCC	GGATGGTAGCTGGAAGATCGAA
Mus-VEGF	GCCTCCGAAACCATGAACTT	GTCTCAATCGGACGGCAGTA
Mus-HIF-1α	CCTGCACTGAATCAAGAGGTTGC	CCATCAGAAGGACTTGCTGGCT
Mus-KLF10	GCACAGTGTCCGATGGTGAT	AAGGAGCTGGCTGAGACCTA
Mus-Actin	GCACCGCAAATGCTTCTAGG	GCCTTCACCGTTCCAGTTTT

Homo, human gene; Mus, mice gene.

Western Blotting Analysis

Retinal tissue or cells were lysed with RIPA buffer (Boster, Wuhan, China), and protein concentrations were measured using the BCA assay (Beyotime, Shanghai, China). Protein samples were mixed with 5× SDS-PAGE loading buffer (New Cell & Molecular Biotech, Suzhou, China) and denatured by boiling at 100°C for 10 minutes. The proteins were separated on 10% or 15% SDS-PAGE gels, transferred to PVDF membranes (Millipore, Blarney, Ireland), and blocked with 5% skim milk for 2 hours. After three TBST washes, the membranes were incubated with primary antibodies overnight at 4°C, followed by a 1-hour incubation with secondary antibodies (anti-mouse or anti-rabbit IgG; Boster, China) at room temperature and three washes in TBST. The protein bands were detected using chemiluminescence (Yeasen Biotechnology, Shanghai, China) and visualized with an imaging system (ImageQuant LAS 500). The antibody details are listed in Table 2.

Table 2.

Antibodies and Antigen Dilutions

Antibody	Catalog No.	Vendor	Antigen Dilution
KLF10	ab184182	Abcam	1:10,000
KLF10	29709-1-AP	Proteintech	1:10,000, 1:200*
GRP78	11587-1-AP	Proteintech	1:8000
PERK	24390-1-AP	Proteintech	1:2000, 1:200*
Phospho-PERK (Thr982)	340846	Zenbio	1:750
eIF2α	R24185	Zenbio	1:750
Phospho-eIF2α (Ser51)	310073	Zenbio	1:750
ATF4	R381426	Zenbio	1:750
CHOP (DDIT3)	381679	Zenbio	1:750
BCL-2	381702	Zenbio	1:750
BAX	R380709	Zenbio	1:750
Caspase 3	R22811	Zenbio	1:750
Cleaved-Caspase 3 p17	341034	Zenbio	1:1000
RPE65	TA381025S	Origene	1:100*

^*Indicates the dilution used for immunofluorescence staining.

Immunofluorescence Staining

Retinal tissue or cells were fixed in 4% paraformaldehyde (Servicebio) and permeabilized with 0.1% Triton X-100 (Servicebio). Nonspecific binding was blocked with 5% BSA (Servicebio). The samples were incubated with primary antibodies overnight at 4°C, followed by a 1-hour incubation with fluorescent secondary antibodies at room temperature. The nuclei were counterstained with DAPI (Servicebio). After washes in TBST, the samples were mounted and visualized using a confocal laser scanning microscope (Stellaris 5, Cologne, Germany). The antibody details are listed in Table 2.

ER-Tracker Red Staining

ER-Tracker Red (Beyotime Biotechnology), a membrane-permeable red fluorescent probe, selectively labels the ER in live cells. The working solution was prepared by diluting 1 µL of stock in 3 mL of diluent and prewarming to 37°C. After 48 hours of treatment, cells on coverslips were rinsed with Hanks’ balanced salt solution (with Ca²⁺ and Mg²⁺, Beyotime Biotechnology), incubated with the working solution at 37°C for 30 minutes, and then washed three times with buffer. The cells were fixed in 4% paraformaldehyde at 37°C for 2 minutes, washed again, counterstained with DAPI, and mounted with antifade medium. Fluorescence images were acquired using a confocal laser scanning microscope (Stellaris 5).

Flow Cytometry

The culture supernatant of ARPE-19 cells was collected, and the cells were digested with trypsin (without EDTA, New Cell & Molecular Biotech, Suzhou, China) for 1 to 2 minutes. The mixture was subsequently centrifuged at 500×g and 4°C for 5 minutes, after which the cells were washed twice with precooled PBS. The cells were resuspended in 1× binding buffer (Servicebio) at a concentration of 5 × 10⁵/mL. A 100-µL aliquot was mixed with 5 µL of Annexin V-FITC (Servicebio) and 5 µL of propidium iodide ( Servicebio) and incubated at room temperature in the dark for 10 minutes. After 400 µL of precooled 1× binding buffer was added, apoptotic cells were analyzed using a flow cytometer (NovoCyte D3000, China). Apoptosis was quantified using FlowJo software (version 10.9.0; Ashland, OR, USA).

Correlation Between the Levels of KLF10 and Markers of ER Stress

Normal TCGA datasets were retrieved from the GEPIA database (http://gepia.cancer-pku.cn/index.html). Correlations between the levels of KLF10 and key ER stress markers (IRE-1α, XBP1, PERK, CHOP, and ATF6) were assessed to guide further exploration of KLF10-regulated pathways (Supplementary Fig. S3).

Dual Luciferase Reporter Gene Assay

The PERK promoter sequence in FASTA format was retrieved from the Ensembl database (www.ensembl.org). KLF10 transcripts were screened using the JASPAR platform, and the PERK promoter was analyzed with a profile score threshold of 80% to identify the optimal binding site. The wild-type plasmid pEIF2AK3(Homo)-Fluc and the mutant plasmids pEIF2AK3(Homo)-mut1-Fluc and pEIF2AK3(Homo)-mut2-Fluc were synthesized by Miaoling Bio (Miaoling, China). These sequences were cloned, inserted into a luciferase reporter vector (pGL4.10 promoter), and cotransfected into HEK-293T cells (Procell, Wuhan, China) with KLF10 overexpression or control plasmids. Relative luciferase activity (firefly/Renilla) was measured.

Activation and Inhibition of PERK Phosphorylation

CCT020312 is a selective PERK activator that binds to the regulatory domain of PERK, promoting its phosphorylation.¹⁸ GSK2606414 is a potent, cell-permeable PERK inhibitor that targets the adenosine triphosphate-binding site within the kinase domain, blocking PERK phosphorylation and downstream signalling.¹⁹ In this study, 4 µM CCT020312 or 7 nM GSK2606414 (MedChemExpress, Monmouth Junction, NJ, USA) was applied for 48 hours to activate or inhibit PERK phosphorylation, respectively (Supplementary Fig. S4).

Pharmacological Inhibitor of KLF10

KLF10-IN-1 is a KLF10 inhibitor that blocks KLF10-DNA binding and the transcriptional activity of KLF10.²⁰ In this study, 20 µM KLF10-IN-1 was administered for 48 hours, which effectively inhibited KLF10 expression (Supplementary Fig. S5).

Animal Experiments

Male C57BL/6J mice (6 weeks, Hangzhou Ziyuan Laboratory Animal Technology Co., Hangzhou, China) were acclimatized for 7 days and randomly assigned to normal or diabetic groups. Normal mice received a low-fat diet and water, and diabetic mice were fed a high-fat diet (60%) and 10% sucrose for 7 weeks. Diabetes was induced in the diabetic group by intraperitoneal injection streptozotocin (STZ, 50 mg/kg; Sigma-Aldrich, St. Louis, MO, USA) for 5 days after a 10-hour fast, with controls receiving citrate buffer. Mice whose fasting glucose concentration was greater than 16.7 mmol/L after 1 week were considered diabetic. Body weight and glucose levels were monitored biweekly. Venous blood and retinal samples were collected at weeks 14 and 18, around the reported time of retinal pathology onset in diabetic mice (Supplementary Fig. S6).^21–23

In the treatment experiment, diabetic mice were divided into the DM + DMSO, DM + KLF10-IN-1L (10 µM), DM + KLF10-IN-1M (20 µM), and DM + KLF10-IN-1H (50 µM) groups. At week 14, each subgroup received 1 µL of intravitreal DMSO or KLF10-IN-1 bilaterally. Venous blood and retinal samples were collected after 2 weeks (Supplementary Fig. S7). All animal procedures were performed in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and were approved by the Institutional Animal Care and Use Committees of the First Affiliated Hospital of Nanchang University (CDYFY-IACUC-202504GR037).

Serum Biochemical Assays

Serum samples were collected via retroorbital sinus puncture. Triglyceride, total cholesterol, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol concentrations were measured using kits (Shenzhen Redu Life Science Technology, Shenzhen, China) according to the manufacturer's instructions.

Hematoxylin and Eosin Staining

Mouse eyeballs were fixed in 4% paraformaldehyde at 4°C overnight, embedded in paraffin, and sectioned into 5-µm slices. The sections were deparaffinized in graded ethanol and xylene and then stained with hematoxylin and eosin for retinal morphological assessment. Stained slides were imaged using digital pathology software (Shengqiang Technology Co., Shenzhen, China), and retinal areas approximately 1000 µm from the optic nerve head were selected for quantitative analysis.

TUNEL Staining of Retinal Tissue

Retinal sections from each group were stained with TUNEL solution according to the manufacturer's instructions (Servicebio). Stained slides were imaged using digital slide viewing software (SlideViewer, 3DHISTECH, Budapest, Hungary), and retinal areas approximately 1000 µm from the optic nerve head were selected for quantitative analysis.

Retinal Vascular Network Periodic Acid–Schiff Staining

After enucleation, retinas were isolated and digested with trypsin to remove neural cells, leaving the vascular network. The vasculature was spread onto glass slides and stained with periodic acid–Schiff to highlight glycogen and polysaccharides. Periodic acid oxidizes glycol groups to aldehydes, which react with Schiff's reagent to produce a purplish–red color. Hematoxylin counterstaining was performed to stain the cell nuclei blue. The capillary basement membrane, which is rich in carbohydrates, appears purplish–red, enabling clear visualization of the retinal vascular architecture.

Statistical Analysis

The data are presented as the mean ± SD. Statistical analyses were performed using GraphPad Prism (version 9.0, GraphPad Software, La Jolla, CA, USA). The Student t test was used for two-group comparisons, and one-way ANOVA was used for multiple group comparisons. Differences were considered significant at a P value of less than 0.05.

Results

Identification of Key KLF Genes Associated With ER Stress

The GSE233164 dataset, consisting of data for ARPE-19 cells exposed to high glucose for 72 hours (Fig. 1A), revealed 8125 differentially expressed genes (P < 0.05) (Fig. 1B). The expression of several KLF family members significantly changed (Fig. 1B). Venn analysis of 10,529 ER stress-associated genes revealed four key KLF genes: KLF4 (Log2FC: −2.18, P < 0.001), KLF6 (Log2FC: 0.35, P = 0.001), KLF10 (Log2FC: 1.91, P < 0.001), and KLF11 (Log2FC: −0.44, P = 0.015) (Figs. 1C, 1D). KLF4 and KLF10 showed the most significant differences in expression. KLF4 maintains pericyte localization and vessel stability, whereas its loss promotes pericyte migration and pathological vascular remodeling in DR.²⁴ Because of the limited knowledge about KLF10, the role of KLF10 in DR was the focus of this study.

Figure 1.

KLF10 is upregulated in ARPE-19 cells under high-glucose conditions. (A) Transcriptomic data from dataset GSE233164 after 72 hours of high-glucose exposure in ARPE-19 cells. (B) Volcano plot highlighting differentially expressed KLFs. (C) Venn diagram illustrating the overlap among differentially expressed genes, the KLF family, and ER stress-related genes. (D) Four key KLF members were identified: KLF4, KLF6, KLF10 and KLF11. *P < 0.05; **P < 0.01; ***P < 0.001.

High Glucose and Hypoxia Induce Significant Apoptosis and ER Stress in RPE Cells

The percentage of apoptotic cells significantly increased in the HG and high-glucose/hypoxia groups compared with the NG group (P < 0.05) (Fig. 2A; Supplementary Table S1). The balance between BCL-2 (antiapoptotic) and BAX (proapoptotic) levels regulates apoptosis, with decreased BCL-2 levels and increased BAX levels promoting apoptosis.²⁵ The BCL-2/BAX ratio decreased in the HG and high-glucose/hypoxia groups compared with the NG group (P < 0.05) (Fig. 2B; Supplementary Table S1). ER stress, as indicated by elevated GRP78 protein expression,⁷ was greater in the HG and high-glucose/hypoxia groups than in the NG group (P < 0.05) (Fig. 2B; Supplementary Table S1). ER fluorescence intensity also increased, reaching the highest level in the high-glucose/hypoxia group (P < 0.05) (Fig. 2C; Supplementary Table S1).

Figure 2.

High glucose and hypoxia induce significant apoptosis and ER stress in RPE cells. (A) Apoptosis was assessed by flow cytometry. (B) BCL-2, BAX, and GRP78 protein levels were detected by Western blot analysis. (C) ER fluorescence intensity was evaluated by ER-Tracker Red staining using confocal microscopy. *P < 0.05; **P < 0.01; ***P < 0.001.

Increased KLF10 Expression Under High Glucose and Hypoxia

KLF10 transcription and protein levels were significantly greater in the high glucose/hypoxia group than in the NG group (P < 0.001) (Figs. 3A, 3B; Supplementary Table S1). Immunofluorescence analysis revealed that KLF10 was localized in the nucleus (Fig. 3C).

Figure 3.

KLF10 is significantly elevated in the high-glucose- and hypoxia-induced RPE cell model. (A) qRT-PCR analysis of KLF10 mRNA levels in NG, mannitol, and high-glucose media with or without 200 µM CoCl₂. (B) Western blot analysis of KLF10 protein levels under the same conditions. (C) Immunofluorescence staining showing KLF10 subcellular localization under NG, mannitol, and high-glucose hypoxic conditions. *P < 0.05; **P < 0.01; ***P < 0.001.

Involvement of KLF10 in Apoptosis and ER Stress Regulation

Cleaved caspase-3, the activated form of caspase-3, initiates the execution phase of apoptosis. Thus, the cleaved caspase-3/caspase-3 ratio is typically used to assess apoptosis.²⁶ Compared with the negative control, siKLF10#1 and siKLF10#3 significantly reduced the apoptosis rate (P < 0.001) (Fig. 4A; Supplementary Table S2), increased the BCL-2/BAX ratio, and decreased the cleaved caspase-3/caspase-3 ratio and GRP78 levels (P < 0.01) (Fig. 4B; Supplementary Table S2), with a concomitant reduction in ER fluorescence intensity (P < 0.001) (Fig. 4C; Supplementary Table S2). In contrast, compared with the control vector, KLF10 overexpression increased the apoptosis rate (P < 0.01) (Fig. 4A; Supplementary Table S2), decreased the BCL-2/BAX ratio, and increased the cleaved caspase-3/caspase-3 ratio, GRP78 levels (P < 0.01) (Fig. 4B; Supplementary Table S2), and the ER fluorescence intensity (P < 0.001) (Fig. 4C; Supplementary Table S2). These results suggest that KLF10 critically regulates apoptosis and ER stress under high glucose and hypoxic conditions.

Figure 4.

KLF10 regulates apoptosis and ER stress in the high-glucose- and hypoxia-induced RPE cell model. (A) Apoptosis was analyzed by flow cytometry after KLF10 knockdown and overexpression. (B) Expression of BAX, BCL-2, caspase 3, cleaved caspase 3, and GRP78 was detected by Western blot. (C) ER fluorescence intensity was evaluated by ER-Tracker Red staining and confocal microscopy. *P < 0.05; **P < 0.01; ***P < 0.001.

KLF10 Promotes the Transcriptional Activation of PERK

Previous experiments have shown that KLF10 regulates the expression of GRP78, which is linked to the ER stress receptors IRE-1α, PERK, and ATF6. The relationship between KLF10 and the ER stress pathway was explored, and a database analysis revealed a significant correlation between KLF10 and PERK/ATF4/CHOP levels (Supplementary Fig. S3). qRT-PCR confirmed that KLF10 significantly modulates the transcription of PERK and CHOP (P < 0.001) (Fig. 5A; Supplementary Table S3). Protein analysis indicated that KLF10 regulates PERK phosphorylation (P < 0.01) (Fig. 5B; Supplementary Table S3). Database screening revealed two high-affinity binding sites for KLF10 in the PERK promoter (Fig. 5C), and dual-luciferase reporter assays revealed that KLF10 overexpression significantly increased PERK transcription (P < 0.001) (Fig. 5D). Immunofluorescence staining further confirmed that KLF10 overexpression increased the PERK fluorescence intensity (P < 0.001) (Fig. 5E).

Figure 5.

KLF10 transcriptionally regulates PERK. (A) qRT-PCR analysis of mRNA levels of ER stress markers following KLF10 knockdown and overexpression in the high-glucose- and hypoxia-induced RPE cell model. (B) Western blot analysis of PERK and phosphorylated PERK under the same conditions. (C) Identification of potential KLF10 binding sites within the PERK promoter using the JASPAR and Ensembl databases, followed by construction of wild-type and deletion-mutant plasmid constructs. (D) Luciferase reporter assay of wild-type and mutant PERK promoters in HEK293T cells. (E) Immunofluorescence staining and confocal imaging showing PERK distribution and fluorescence intensity outside the nucleus after KLF10 overexpression. *P < 0.05; **P < 0.01; ***P < 0.001.

KLF10 Regulates Apoptosis Via the PERK Signaling Pathway

Compared with the control, siKLF10#1 and siKLF10#3 significantly suppressed the PERK and eIF2α phosphorylation and reduced ATF4 and CHOP expression (P < 0.01) (Fig. 6A; Supplementary Table S4); these effects were attenuated by cotreatment with CCT020312 (Fig. 6A; Supplementary Table S4). siKLF10#1 and siKLF10#3 also significantly decreased the apoptosis rate, increased the BCL-2/BAX ratio, and reduced the cleaved caspase-3/caspase-3 ratio (P < 0.01) (Figs. 6A, 6B; Supplementary Table S4), and these antiapoptotic effects were weakened by CCT020312 (Figs. 6A, 6B; Supplementary Table S4). In contrast, KLF10 overexpression increased PERK and eIF2α phosphorylation and elevated ATF4 and CHOP expression (P < 0.001) (Fig. 6C; Supplementary Table S4), and these effects were mitigated by GSK2606414 (Fig. 6C; Supplementary Table S4). KLF10 overexpression also significantly increased the apoptosis rate, decreased the BCL-2/BAX ratio and increased the cleaved caspase-3/caspase-3 ratio (P < 0.01) (Figs. 6C, 6D; Supplementary Table S4), and these proapoptotic effects were attenuated by GSK2606414 (Figs. 6C, 6D; Supplementary Table S4). These results suggest that KLF10 regulates apoptosis via the PERK/eIF2α/ATF4/CHOP pathway.

Figure 6.

KLF10 modulates apoptosis in high-glucose- and hypoxia-induced RPE cells via the PERK signaling pathway (A) Expression of apoptosis-related proteins (BAX, BCL-2, caspase-3, and cleaved caspase-3) and PERK pathway–related proteins (PERK, phosphorylated PERK, eIF2α, phosphorylated eIF2α, ATF4, and CHOP) was detected by Western blot after KLF10 knockdown with or without CCT020312 treatment. (B) Apoptosis was assessed by flow cytometry under the same conditions. (C) Expression of apoptosis-related proteins (BAX, BCL-2, caspase-3, and cleaved caspase-3) and PERK pathway–related proteins (PERK, phosphorylated PERK, eIF2α, phosphorylated eIF2α, ATF4, and CHOP) was detected by Western blot after KLF10 overexpression with or without GSK2606414 treatment. (D) Apoptosis was assessed by flow cytometry under the same conditions. *P < 0.05 vs. siNC + DMSO/Vector + DMSO; **P < 0.01 vs. siNC + DMSO/Vector + DMSO; ***P < 0.001 vs. siNC + DMSO/Vector + DMSO.

Targeted Inhibition of KLF10 by KLF10-IN-1 Attenuates Apoptosis Through PERK Pathway Suppression

Previous findings have shown that elevated KLF10 expression promotes apoptosis in RPE cells, suggesting that KLF10 is a potential therapeutic target for DR. KLF10-IN-1 was used to inhibit KLF10 activity pharmacologically. Compared with DMSO treatment, KLF10-IN-1 treatment significantly reduced the apoptosis rate; increased the BCL-2/BAX ratio; decreased the cleaved caspase-3/caspase-3 ratio; suppressed PERK and eIF2α phosphorylation; downregulated GRP78, ATF4, and CHOP expression; and reduced the ER fluorescence intensity (P < 0.01) (Figs. 7A–C; Supplementary Table S5). These effects were markedly attenuated by cotreatment with CCT020312 (Figs. 7A–C; Supplementary Table S5). These results suggest that KLF10-IN-1 exerts antiapoptotic effects by modulating the PERK pathway.

Figure 7.

KLF10 inhibitor KLF10-IN-1 alleviates apoptosis by suppressing the PERK signaling pathway. (A) Apoptosis was assessed by flow cytometry with KLF10-IN-1 alone or in combination with CCT020312. (B) Western blot analysis detected apoptosis-related proteins (BAX, BCL-2, caspase-3, and cleaved caspase-3), GRP78, and PERK pathway-related proteins with KLF10-IN-1 alone or in combination with CCT020312. (C) ER-Tracker Red staining and confocal microscopy were used to evaluate ER fluorescence intensity under the same treatment conditions. *P < 0.05 vs. DMSO; **P < 0.01 vs. DMSO; ***P < 0.001 vs. DMSO.

Upregulation of KLF10 Expression in the Retinas of DR Model Mice

Compared with age-matched normal mice, both 14- and 18-week diabetic mice showed thinning of the retinal ganglion cell and RPE layers, increased retinal cell apoptosis, more acellular capillaries, and elevated inflammatory factor expression (P < 0.05) (Figs. 8A–E; Supplementary Table S6), indicating retinal pathology. Immunofluorescence colocalization analysis of KLF10 and RPE65, a specific marker of RPE cells,²⁷ revealed that KLF10 was colocalized with RPE65, indicating its localization within the RPE layer (Fig. 8F). KLF10 mRNA and protein levels were significantly higher in diabetic mice than in normal control mice at both time points (P < 0.001) (Figs. 8G, 8H; Supplementary Table S6).

Figure 8.

Establishment of the DR mouse model and detection of KLF10 expression. (A) Retinal tissues were collected at weeks 14 and 18 of the disease induction period and stained with hematoxylin and eosin, TUNEL, and periodic acid–Schiff (PAS) for retinal vasculature analysis. (B) Retinal thickness was measured across the inner limiting membrane-to-RPE (ILM-RPE), ILM-ganglion cell layer (ILM-GCL), and RPE layers. (C) The proportion of TUNEL-positive cells in the retina was quantified. (D) The number of acellular capillaries was determined. (E) Transcriptional levels of HIF-1α, VEGF, and ICAM-1 in the retinal neurosensory layer were measured by qRT-PCR. (F) Localization of KLF10 and RPE65 was determined by immunofluorescence staining. (G) Transcriptional levels of KLF10 in the retinal neurosensory layer were quantified by qRT-PCR. (H) Protein levels of KLF10 in the retinal neurosensory layer were examined by Western blot. *P < 0.05; **P < 0.01; ***P < 0.001.

Therapeutic Effect of KLF10-IN-1 in a Diabetic Mouse Model

Compared with the DM + DMSO group, the DM + KLF10-IN-1H group presented a more intact retinal structure, with reduced apoptosis between the external limiting membrane and RPE layers and fewer acellular capillaries (P < 0.001) (Figs. 9A–C; Supplementary Table S7). Western blot analysis revealed downregulation of KLF10 expression; inhibition of PERK and eIF2α phosphorylation; decreased GRP78, ATF4, and CHOP levels; an increased BCL-2/BAX ratio; and a reduced cleaved caspase-3/caspase-3 ratio (P < 0.05) (Figs. 9D; Supplementary Table S7). These findings suggest that KLF10-IN-1 protects against DR by suppressing KLF10 expression and PERK pathway activation, thereby reducing retinal cell apoptosis.

Figure 9.

Therapeutic effects of KLF10-IN-1 on retinal lesions in diabetic mice. (A) Retinal tissues were collected two weeks after treatment and stained with hematoxylin and eosin, TUNEL, and periodic acid–Schiff (PAS) to assess retinal morphology and vascular integrity. (B) Apoptotic cells between the external limiting membrane and the RPE layer were quantified. (C) The number of acellular capillaries in the retina was counted. (D) Western blot analysis was performed to evaluate the expression of KLF10, PERK-pathway-related proteins (PERK, phosphorylated PERK, eIF2α, phosphorylated eIF2α, ATF4, CHOP), and apoptosis-related proteins (BAX, BCL-2, caspase-3, and cleaved caspase-3) in the retinal neurosensory layer. *P < 0.05 vs. DMSO; **P < 0.01 vs. DMSO; ***P < 0.001 vs. DMSO.

Discussion

DR is the leading cause of blindness in diabetic patients and is characterized by microvascular damage and retinal dysfunction.² RPE cells are crucial for oBRB integrity, metabolic clearance, and photoreceptor support, and their apoptosis accelerates DR progression.² In this study, the expression of KLF10, a regulator of RPE survival, was upregulated in diabetic mice and cultured RPE cells. KLF10 promotes apoptosis through the PERK/eIF2α/ATF4/CHOP pathway. KLF10-IN-1 inhibition suppresses this pathway, reducing apoptosis, ER stress, and retinal damage. These findings highlight KLF10 as a potential therapeutic target for early DR treatment.

KLF10, a member of the KLF transcription factor family, regulates gene expression, affecting cell proliferation, differentiation, migration, apoptosis, and metabolism.^10,28–30 Previous studies have shown that hyperglycemia alters KLF10 expression, potentially upregulating it via the TGF-β/Smad pathway,³¹ whereas inflammation and nuclear factor-κB signaling also increase its expression.³² Immune dysregulation and insulin resistance may further increase KLF10 levels.^33,34 However, its role in DR remains underexplored. This study provides the first evidence of increased KLF10 expression in high-glucose/hypoxia-exposed RPE cells and the retinas of DR model mice, suggesting its involvement in DR progression.

In experiments examining the role of KLF10, KLF10 was found to significantly influence high-glucose/hypoxia-induced RPE cell apoptosis, suggesting its potential as a key regulator of RPE cell fate under diabetic stress. These findings align with those of previous studies showing the role of KLF10 in regulating cell survival in other systems.^28–30 Given the close association of KLF10 with ER stress, a major inducer of apoptosis, its role in modulating apoptosis through ER stress was further explored in this study. Notably, the relationship between KLF10 and PERK was of particular interest. KLF10 binds to the PERK promoter, increasing its transcriptional activity, which leads to increased PERK phosphorylation and activation. Ultimately, KLF10 affects RPE cells via the PERK/eIF2α/ATF4/CHOP pathway. Importantly, modulating PERK activity can alter the proapoptotic or antiapoptotic effects of KLF10, further confirming the dependence of KLF10 function on this pathway. These findings suggest that KLF10 integrates multiple stress signals to amplify the ER stress-driven apoptotic response in RPE cells. By combining transcriptional regulation and the classical ER stress pathway, this study enhances the understanding of RPE cell damage in DR and identifies KLF10 as a potential therapeutic target.

As previously noted, KLF10 may serve as a key therapeutic target for RPE cell damage under diabetic stress, which led to the development of its inhibitor, KLF10-IN-1.²⁰ Specifically, KLF10-IN-1 targets the KLF10/PERK/eIF2α/ATF4/CHOP pathway, mitigating high-glucose/hypoxia-induced RPE cell apoptosis and ER stress and showing strong cytoprotective effects. However, this protective effect is inhibited when it is combined with the PERK activator CCT020312. This attenuation is due to the different mechanisms of action at distinct levels. KLF10-IN-1 inhibits the transcriptional activity of KLF10, reducing PERK activation and suppressing its phosphorylation. In contrast, CCT020312 activates PERK, promoting its phosphorylation and counteracting the inhibitory effects of KLF10-IN-1. Thus, the inhibitory effect of KLF10-IN-1 on apoptosis is modulated by PERK pathway activation. In DR model mice, vitreous injection of KLF10-IN-1 improved retinal structure, reduced apoptosis, decreased the number of acellular capillaries, and suppressed the KLF10/PERK axis. In conclusion, KLF10-IN-1 mitigates retinal damage by targeting the KLF10/PERK pathway, suggesting a potential therapeutic approach for DR.

Currently, treatments for DR, such as anti-VEGF therapies, primarily target neovascularization, and early treatments for RPE dysfunction and RPE cell apoptosis are limited. This study investigated the protective effects of KLF10 and its inhibitor, KLF10-IN-1, against RPE cell damage under high-glucose/hypoxia and retinal injury in DR model mice. The results suggest that targeting KLF10 could serve as a potential early therapeutic strategy for DR. However, several limitations exist. First, ARPE-19 cells cultured for a short duration, which may not fully recapitulate the characteristics of mature RPE cells such as their morphology and tight junctions, potentially limiting their ability to mimic in vivo RPE cells. Second, the regulatory mechanisms between KLF10 and PERK are not fully understood. Third, the optimal concentration, duration, half-life, and long-term safety of KLF10-IN-1 in the eye remain unexplored. Finally, visual assessments, such as ERG, cannot be performed on DR model mice, limiting the evidence that can be obtained regarding the potential of KLF10-IN-1 for early-stage DR treatment. In future research, these limitations should be addressed, the findings should be validated using gene-edited models and human samples, and the role of KLF10 in other ER stress-related processes, such as calcium homeostasis and mitochondrial–ER interactions, should be explored.

Conclusions

This study demonstrates that KLF10-IN-1 can inhibit the expression of KLF10, thereby inhibiting the PERK/eIF2α/ATF4/CHOP signaling pathway and alleviating RPE cell apoptosis under high-glucose and hypoxic conditions, as well as under diabetic conditions (Fig. 10). KLF10 may play an important regulatory role in DR-related RPE cell damage and dysfunction, and it has potential as a novel biomarker for early diagnosis and as a therapeutic target for DR.

Figure 10.

Proposed model of KLF10-mediated regulation of PERK signaling and apoptosis in high-glucose- and hypoxia-induced RPE cells, and the protective effect of KLF10-IN-1.