Sappanchalcone suppresses NSCLC by oxidative stress-driven DNA damage and ER stress activation through PIEZO1 modulation

Weiyu Wu; Ren Zhang; Geer Chen; Ziyu Chen; Zicong Lin; Yin Chen; Jiaqi Li; Weilin Liao; Junyi Wang; Xiaoxuan Wang; Junhao Huang; Lijuan Ma; Haijie Yu

doi:10.1016/j.isci.2025.114057

. 2025 Nov 14;28(12):114057. doi: 10.1016/j.isci.2025.114057

Sappanchalcone suppresses NSCLC by oxidative stress-driven DNA damage and ER stress activation through PIEZO1 modulation

Weiyu Wu ^1,², Ren Zhang ², Geer Chen ², Ziyu Chen ², Zicong Lin ², Yin Chen ², Jiaqi Li ², Weilin Liao ², Junyi Wang ², Xiaoxuan Wang ², Junhao Huang ^2,³, Lijuan Ma ^2,^∗, Haijie Yu ^2,^4,^∗∗

PMCID: PMC12702247 PMID: 41399507

Summary

Natural compounds are valuable templates for anticancer drug development. Through high-throughput screening of 1880 natural compounds and structure-activity analysis, we identified sappanchalcone (SC) as a potent agent that induces intracellular calcium elevation and causes G2/M phase arrest in H1975, H1299, and A549 cells. Transcriptomic and protein-protein interaction network analyses revealed multi-target effects of SC, involving oxidative stress, cell cycle dysregulation, and ion homeostasis perturbation. Mechanistically, SC induced ROS accumulation, upregulated the DNA damage, and enhanced the expression of P21 and GADD45α, thereby suppressing the CDK1/Cyclin B1 complex. SC also activated ER stress pathways by phosphorylating IRE1α and PERK. Notably, SC downregulated the mechanosensitive ion channel PIEZO1, and its inhibitor ruthenium red (RR) significantly reversed SC-induced proliferation inhibition and G2/M arrest. This study delineates an antitumor mechanism of SC mediated via a calcium-ER stress-cell cycle axis with translational potential for non-small cell lung cancer (NSCLC) cells therapy.

Subject areas: Pharmacology, Molecular biology, Cell biology

Graphical abstract

Highlights

•
Sappanchalcone from a library screen elevates calcium and inhibits NSCLC proliferation
•
Sappanchalcone triggers ROS accumulation and DNA damage
•
Sappanchalcone induces ER stress and modulates PIEZO1 signaling

Pharmacology; Molecular biology; Cell biology

Introduction

Cancer development is a complex process influenced by a combination of genetic mutations, epigenetic dysregulation, and alterations in the tumor microenvironment. It is characterized by dysregulated proliferation and apoptosis of cancer cells resulting from disrupted cell cycle control, as well as enhanced neovascularization and evasion of immune surveillance. Targeting cell cycle dysregulation has emerged as a key strategy in anticancer therapy. For instance, the EGFR inhibitor gefitinib disrupts the G1/S phase transition by inhibiting tyrosine kinase activity, suppressing the RAS/RAF/MEK/ERK and PI3K/AKT/mTOR pathways, and reducing Cyclin D expression.¹^,² Palbociclib, a CDK4/6 inhibitor, induces senescence-associated secretory phenotype (SASP) by specifically targeting the G1/S phase checkpoint to suppress cell proliferation.³^,⁴ Paclitaxel induces G2/M phase arrest and activates caspase-dependent apoptosis by stabilizing microtubules and interfering with spindle assembly.⁵^,⁶ Furthermore, the endoplasmic reticulum (ER) stress pathway plays a role in cell cycle regulation by initiating the unfolded protein response (UPR) through three signaling axes: PERK, IRE1α, and ATF6. Short-term stress facilitates damage repair by inhibiting Cyclin D1 and upregulating molecular chaperones, while prolonged stress activates the CHOP/JNK pathway, leading to cell cycle arrest and clearance.⁷^,⁸^,⁹

Calcium, a crucial cytosolic second messenger,¹⁰ plays a significant role in cancer development by affecting ER-plasma membrane and cell cycle progression.¹¹ Research indicates that calcium channels, such as the TRP channel family and ORAI channel, can influence key cell cycle regulators.¹²^,¹³^,¹⁴^,¹⁵ Additionally, PIEZO1 channel can enhance Cyclin B protein expression and facilitate cell division.¹⁶ Interestingly, calcium is closely linked to endoplasmic reticulum (ER) stress; for example, thapsigargin (TG) increases intracellular calcium level by inhibiting endoplasmic reticulum calcium pumps, activating the PERK/ATF4/CHOP pathway, and inducing apoptosis.⁸ Given the intricate nature of the ion channel network, targeting ion channels has emerged as a novel approach in anticancer therapy. Inhibition of the Kv_1.3 channel in A549 lung cancer cells resulted in a decrease in the expression of CDK4 and Cyclin D3, effectively blocking cell cycle progression.¹⁷ These findings offer valuable insights into utilizing ion channels as therapeutic targets to regulate abnormal cancer cell proliferation.

Chalcone is a natural product with multiple biological activities. It inhibits NF-κB signaling, regulates Bcl-2/Bax protein balance, and activates mitochondrial apoptosis to exert anticancer effects.¹⁸ Sappanchalcone (SC), a chalcone compound extracted from Biancaea sappan L., has many biological functions. It can induce apoptosis in esophageal and colon cancer cells by increasing reactive oxygen species (ROS).¹⁹^,²⁰ However, its interaction with cell cycle regulation, ER stress, and ion channels has not been elucidated.

In this study, we investigated the impact of SC on NSCLC cells. Our results revealed that SC increased intracellular calcium level, suppressed cell proliferation in a dose-dependent manner, and induced a G2/M phase arrest. Moreover, SC triggered the ROS accumulation, leading to DNA damage and alterations in the expression of cell cycle regulatory proteins. Additionally, SC activated the ER stress pathway and disrupted calcium signaling. Our analysis suggests that the dysregulated expression of PIEZO1 channel protein may play a pivotal role in mediating SC’s effects. These findings provide valuable insights into the potential anticancer mechanisms of SC.

Results

Screening of natural compounds and sappanchalcone selection

Natural compounds have demonstrated significant potential in cancer therapy due to their diverse biological activities. In this study, intracellular calcium signaling was dynamically monitored using the genetically encoded calcium indicator GCaMP6s, coupled with high-throughput screening of the 1880 compounds (TargetMol Natural Compound Library) via the FLIPR-Tetra fluorescence detection system (Figure 1A). Three structurally similar compounds, including Butein, Licochalcone A (Lico A), and Licochalcone B (Lico B), were identified to induce significant calcium rise (Figure 1B) and cell death (Figure 1D). To explore structure-activity relationship, we selected 19 structurally related compounds (Figure 1E) based on the structure of Butein, which has two aryl moieties bridged via an α, β-unsaturated carbonyl group. The benzene ring adjacent to the carbonyl group is defined as the “A-ring” and the distal benzene ring as the “B-ring” (Figure 1C). These compounds were categorized into five groups: (i) benzylideneacetone-type compounds mimicking the B-ring of Butein; (ii) 2’,4’-dihydroxybutyrophenone derivatives representing A-ring analogs; (iii) 2,3,4,4’-tetrahydroxybenzophenone, a Butein analog lacking the α, β-unsaturated bond; (iv) flavonoids as chalcone-derived structures; and (v) chalcones with varied hydroxyl and methoxy substitutions on the benzene rings (Figure 1F). We evaluated the cytotoxic effects of these 19 compounds at 50 μM against three NSCLC cell lines after 48 h treatment (Figures 1G–1I). Compounds 12, 13, 15, and 19, along with Butein, Lico A, and Lico B, exhibited marked cytotoxicity.

Screening of natural compounds

(A) Flow chart for compound screening. High-throughout fluorescence screening using the FLIPR-Tetra system and the H1975 cells stably transfected with GCaMP6s fluorescent protein identified compounds with similar structures exhibiting a significant calcium response from a compound library. The chemicals with analogous structures to the above identified compounds were further investigated for stronger efficacy in calcium mobilization and cell proliferation inhibition.

(B) Real-time monitoring of calcium signaling induced by the identified library compounds was determined using the FLIPR Tetra system. The concentration of Butein, Licochalcone A, and Licochalcone B were 10 μM, Data were acquired every 2 s for a total duration of 1 h (mean ± SEM, biological replicates n = 3).

(C) Chemical structures of Butein, Licochalcone A, and Licochalcone B. The benzene ring adjacent to the carbonyl group is defined as the “A-ring” and the distal benzene ring as the “B-ring.” Substitute positions are indicated.

(D) H1975, A549, and H1299 NSCLC cells were treated with 50 μM Butein, Lico A, or Lico B, respectively, for 48 h. Cell viability was assessed using the sulforhodamine B (SRB) assay. (mean ± SD, biological replicates n = 3).

(E) The information on chemicals with analogous structures to Butein and related compounds.

(F) Structural formulas of similar compounds selected using Butein and related compounds as references. Compounds were grouped into five classes based on their structural features.

(G–I) Cell viability of H1975 (G), A549 (H), and H1299 (I) NSCLC cell lines was determined using the SRB assay following a 48 h exposure to 50 μM of each of 19 structurally similar compounds (mean ± SD, biological replicates n = 3).

We also measured their calcium dynamics using GCaMP6s as calcium indicators and found that several compounds triggered calcium responses (Figures 2A and 2B). Notably, Sappanchalcone (SC, Compound 19) displayed both potent cytotoxicity and a strong calcium mobilization response (Figure 2C), prompting its selection as the primary focus for subsequent mechanistic investigations (Figure 2D). Using the same calcium measurement method, we found that SC dose-dependently induced an elevation of cytosolic calcium level (Figure 2E) and that the pre-treatment of cells with different concentrations of SC revealed a dose-dependent inhibition of the TG-evoked calcium mobilization response (Figure 2F).

Sappanchalcone selection

(A and B) Real-time monitoring of calcium signaling induced by 10 μM compounds was determined using the FLIPR-Tetra system. Data were acquired every 2 s for a total duration of 1 h (mean ± SEM, biological replicates n = 3).

(C) Dot plot of calcium responses and cell viability in H1975 cells. The concentration of compounds in calcium measurement experiments was 10 μM. Cell viability was examined after treatment with 50 μM of different compounds for 48 h.

(D) Structural formulas of Sappanchalcone. The benzene ring adjacent to the carbonyl group is defined as the “A-ring” and the distal benzene ring as the “B-ring.” Substitute positions are indicated.

(E) Real-time monitoring of calcium signaling induced by 1, 3, 10, 30, 50 μM SC was determined using the FLIPR-Tetra system. Data were acquired every 2 s for a total duration of 1 h (mean ± SEM, biological replicates n = 3).

(F) Real-time monitoring of calcium signaling induced by 2 μM TG, cells were pretreated with different concentrations SC, and data were determined using the FLIPR Tetra-system. Data were acquired every 2 s for a total duration of 1000 s (mean ± SEM, biological replicates n = 3).

Sappanchalcone suppresses cellular proliferation via G2/M phase arrest and apoptosis induction

SC, a naturally occurring chalcone compound isolated from the Biancaea sappan L., exhibits diverse biological activities. The effects of SC on the proliferation of three NSCLC cell lines (H1975, H1299, and A549) were assessed via sulforhodamine B (SRB) assay. Following 48 h treatment, dose-dependent growth inhibition was observed in all three cell lines. The IC₅₀ values were 0.8 ± 0.16 μM (mean ± SD, n = 3) for H1299 (Figure 3A), 2.2 ± 0.24 μM (mean ± SD, n = 3) for A549 (Figure 3B), and 0.78 ± 0.12 μM (mean ± SD, n = 3) for H1975 (Figure 3C). Furthermore, 24 h SC treatment induced G2/M phase arrest in a dose-dependent manner in H1975 cells (Figures 3D–3F), H1299 cells (Figures 3G–3I) and A549 cells (Figures 3J–3L). This observation is consistent with prior reports of SC-mediated cell cycle blockade in other cellular models.²¹ In addition, we found that SC can cause apoptosis in H1975 cells in a dose-dependent manner (Figures 3M and 3N).

Molecular pathways targeted by sappanchalcone: Cell cycle, reactive oxygen species, endoplasmic reticulum stress, and calcium signal

To investigate the mechanism by which SC inhibits cell proliferation, we performed transcriptome analysis on H1299 cells treated with 2 μM SC for 24 h versus untreated controls. Significant alterations in gene expression were observed in SC-treated cells (Figure 4A). Gene Ontology (GO) enrichment analysis revealed that differentially expressed genes (DEGs) were prominently enriched in pathways related to cell cycle arrest and oxidative stress response (Figure 4B), consistent with our prior observation that SC induced G2/M phase arrest. Analysis of cell cycle-associated genes identified marked differential expression of GADD45A, CDKN1A, and CCNB1, alongside changes in the DNA damage marker H2AX (Figure 4C). Further analysis demonstrated significant modulation of ROS-associated genes (e.g., CYP1B1 and CYP1A1) and genes in the ER stress signaling pathway, including EIF2AK3 (PERK), ERN1 (IRE1), ATF6, and HSPA5 (GRP78) (Figure 4D). Since ER is an important intracellular calcium store and SC elevates cytosolic calcium level, we observed altered expression in calcium signalling-related genes and identified the altered expression of ER-localized calcium channels (ITPRs; inositol 1,4,5-trisphosphate receptors), ER Ca²⁺-ATPases (ATP2As/SERCAs), and store-operated calcium entry (SOCE) components (ORAIs) (Figure 4E). STRING protein-protein interaction (PPI) analysis categorized DEGs into three functional modules: cell cycle regulation, ER stress pathway, and ion channel activity, providing a general framework for SC’s mechanistic action (Figure 4F). The mRNA validation in H1299 cells confirmed the SC-induced regulation of CDKN1A, GADD45A, and SFN, as well as the modulation of ER calcium channels (ITPR3) and calcium pumps (ATP2A1, ATP2A2). Collectively, the results indicate that SC may trigger cell death through coordinated multi-pathway interactions involving cell cycle, ROS, ER stress, and calcium signal.

Molecular pathways targeted by sappanchalcone: cell cycle, ROS, ER stress, and calcium signal

(A) Volcano plot of differentially expressed genes in H1299 cells treated with 2 μM SC for 24 h compared to control cells. Right side and left side dots represent significantly upregulated and downregulated genes, respectively (|log2FC| > 1, p < 0.05).

(B) GO functional enrichment analysis results, showing that SC significantly affects biological processes such as reactive oxygen species metabolism, cell cycle regulation, and endoplasmic reticulum stress response.

(C) Heatmap of differentially expressed genes related to the cell cycle.

(D) Heatmap of differentially expressed genes related to the reactive oxygen species and endoplasmic reticulum stress.

(E) Heatmap of differentially expressed genes related to ion channels.

(F) Protein-protein interaction (PPI) network of differentially expressed genes constructed using the STRING database. Major functional modules include genes related to cell cycle regulation (green), endoplasmic reticulum stress (cyan), and ion channels (red).

(G) Time-dependent mRNA expression changes of key genes validated by RT-qPCR. mRNA expression levels were measured in H1299 cells treated with 2 μM SC for 0, 1, 3, and 8 h (mean ± SD, biological replicates n = 3, unpaired one-way ANOVA, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).

Sappanchalcone triggers G2/M arrest by impairing the function of the Cyclin B-CDK1 complex

The G2/M transition is tightly regulated by the Cyclin B-CDK1 complex. Inhibition of this complex, either through the Thr14/Tyr15 phosphorylation of CDK1 or cyclin degradation, triggers G2/M arrest. To elucidate the mechanism by which SC regulates the G2/M phase of the cell cycle, we examined the cell cycle related proteins in cells treated with SC for 24 h. While low concentrations of SC did not alter CDC2 (CDK1) phosphorylation at Tyr15 or total CDC2 levels, Cyclin B expression was significantly reduced at higher concentrations (Figures 5A and 5B). This implies impaired formation of the CDK1/Cyclin B complex.²² The expression levels of γ-H2AX, P21, and GADD45α increased in a concentration-dependent manner following SC treatment in H1299 cells (Figures 5C and 5D). Upregulation of γ-H2AX, a hallmark of DNA damage, indicated SC-induced genomic instability.²³ Elevated P21 and GADD45α expression suggested activation of stress signaling pathways and suppression of CDK1/Cyclin B complex.²⁴^,²⁵ In A549 cells, SC similarly induced dose-dependent upregulation of γ-H2AX and P21 (Figures 5E and 5F). Although CDC2 phosphorylation decreased with escalating SC doses, indicating increased kinase activity, Cyclin B expression concurrently declined (Figures 5G and 5H), suggesting that G2/M arrest in A549 cells may also arise from defective CDK1/Cyclin B complex assembly. These findings align with the SC-induced G2/M arrest in prior flow cytometry data.

Sappanchalcone triggers G2/M arrest by impairing the function of Cyclin B-CDK1 complex

(A) Western blot analysis of Cyclin B, CDC2, and phosphorylated CDC2 in H1299 cells treated with SC at concentrations of 0, 1, 3, 10, and 30 μM for 24 h.

(B) Quantitative analysis of Cyclin B, CDC2, and phosphorylated CDC2 protein expression levels in H1299 cells after SC treatment (mean ± SD, biological replicates n = 3, unpaired one-way ANOVA, ∗p < 0.05, ∗∗∗p < 0.001).

(C) Western blot analysis of γ-H2AX, P21, and GADD45α in H1299 cells treated with SC at concentrations of 0, 0.25, 0.5, 1, and 2 μM for 24 h.

(D) Quantitative analysis of γ-H2AX, P21, and GADD45α protein expression levels in H1299 cells after SC treatment (mean ± SD, biological replicates n = 3, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).

(E) Western blot analysis of γ-H2AX, P21, and GADD45α in A549 cells treated with SC at concentrations of 0, 0.5, 1, 2, and 4 μM for 24 h.

(F) Quantitative analysis of γ-H2AX, P21, and GADD45α protein expression levels in A549 cells after SC treatment (mean ± SD, biological replicates n = 3, unpaired one-way ANOVA, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).

(G) Western blot analysis of Cyclin B, CDC2, and phosphorylated CDC2 in A549 cells treated with SC at concentrations of 0, 0.4, 2, 10, and 50 μM for 24 h.

(H) Quantitative analysis of Cyclin B, CDC2, and phosphorylated CDC2 protein expression levels in A549 cells after SC treatment (mean ± SD, biological replicates n = 3, unpaired one-way ANOVA, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).

Sappanchalcone induces reactive oxygen species accumulation

The previous Gene Ontology (GO) enrichment analysis revealed that the significantly enriched pathway is the oxidative stress response pathway (Figure 4B), which has been linked to tumor progression.²⁶^,²⁷To find the initiator of G2/M phase arrest, real-time nuclear thioredoxin redox dynamics were quantified in H1299 cells transfected with Nuc-TrxRFP, a nuclear-targeted fluorescent protein as a thioredoxin redox sensor. SC markedly enhanced fluorescence intensity in a dose-dependent manner, confirming the SC-driven elevation of nuclear ROS levels (Figures 6A and 6B). A similar ROS accumulation was also observed in HEK293T cells transfected with the same indicator by the addition of SC (Figures 6C and 6D). Flow cytometry further revealed a significant increase in intracellular ROS in H1299 cells treated with 2 μM SC for 24 h (Figures 6E and 6F). Collectively, these results demonstrate that SC induces intracellular ROS generation, which may underlie its capacity to provoke DNA damage and cell cycle arrest at G2/M phase.

Sappanchalcone induces ROS accumulation

(A) Time-lapse imaging of H1299 cells transfected with Nuc-TrxRFP. Cells were challenged by 0, 10, 50, 100 μM SC for the indicated time. Data were acquired every 5 min for a total duration of 60 min. Red: Nuc-TrxRFP fluorescence. Blue: Hoechst staining. Scale bars, 100 μm.

(B) Fluorescence intensity of Nuc-TrxRFP in H1299 cells. The intensities were normalized to the value at the start point, the SC was added in the 0 min (mean ± SEM, biological replicates n = 15)

(C) Time-lapse imaging of HEK293T cells transfected with Nuc-TrxRFP. Cells were challenged by 50 μM SC for the indicated time. Data were acquired every 1 min for a total duration of 20 min. Red: Nuc-TrxRFP fluorescence. Blue: Hoechst staining. Scale bars, 25 μm.

(D) Fluorescence intensity of Nuc-TrxRFP in HEK293T. The intensities were normalized to the value at start point. The arrows indicate the time points for the addition of the SC. (mean ± SEM, biological replicates n = 9).

(E) Intracellular ROS levels in H1299 cells treated with SC at concentrations of 0, 0.2, and 2 μM for 24 h, were measured using a ROS-sensitive fluorescent probe combined with flow cytometry analysis.

(F) Quantitative analysis of ROS levels in H1299 cells after SC treatment (mean ± SD, biological replicates n = 3, unpaired one-way ANOVA, ∗∗p < 0.01).

Sappanchalcone triggers endoplasmic reticulum stress via the IRE1α and PERK pathway activation

Previous transcriptomic analysis revealed the activation of ER stress pathway in SC-treated cells. The expression of GRP78, a hallmark ER stress chaperone, was significantly upregulated in a dose-dependent manner following SC treatment, accompanied by the increased phosphorylation of IRE1α and PERK. Expression of PERK pathway-associated proteins ATF4 and KEAP1 also exhibited SC does-dependent modulation (Figures 7A and 7B). In contrast, ATF6 protein levels remained unaltered, suggesting selective activation of the IRE1α and PERK branches of the unfolded protein response (UPR). Co-treatment with the IRE1α-specific inhibitor 4μ8C²⁸ or the PERK-specific inhibitor GSK2606414²⁹ attenuated SC’s effects, as evidenced by combination index (CI) values > 1 (Figures 7C and 7D), confirming SC-mediated ER stress signaling through the dual activation of both IRE1α and PERK pathways. We further compared its effects with TG, a known ER stress inducer that elevates cytosolic calcium. While both SC and TG activated GRP78 and the IRE1α pathway, SC predominantly enhanced PERK phosphorylation, whereas TG primarily elevated total IRE1α and its phosphorylation protein levels and reduced PERK and ATF6 expression (Figures 7E and 7F). Combined SC and TG treatment elicited distinct expression patterns of GRP78, IRE1α/phospho-IRE1α, PERK/phospho-PERK, and KEAP1 compared to individual treatments, indicating synergistic activation of complex ER stress signaling networks. Collectively, SC robustly activates both IRE1α and PERK pathways, implicating these mechanisms in its biological activity.

Calcium signaling blockade attenuates sappanchalcone induced effects

Intracellular calcium homeostasis is intricately linked to endoplasmic reticulum (ER) function. Given that SC elevates cytosolic calcium level, calcium channels may play a pivotal role in mediating its biological effects. Ruthenium red (RR), a calcium channel inhibitor,³⁰ significantly attenuated dose-dependent cytotoxicity of SC in H1299, A549 and H1975 cells at low SC concentration, indicating that calcium signaling dysregulation dominates SC toxicity at low doses (Figures 8A–8C). Furthermore, SC-triggered G2/M phase arrest was alleviated by RR’s application in H1299 cells (Figures 8D–8F) and A549 cells (Figures 8G–8I). Transcriptomic profiling revealed that upon RR treatment, genes related to cell cycle (Figure 8J), ROS, ER Stress (Figure 8K), and calcium signaling (Figure 8L), all previously disrupted by SC, showed significant recovery toward control conditions.

PIEZO1 is important to sappanchalcone induced responses

Transcriptional profiling and GO analysis revealed significant enrichment of genes involved in mechanical stimulus responses, including PIEZO1 (Figures 4B and 8L). Protein expression of PIEZO1 was dose-dependently downregulated by SC treatment (Figures 9A and 9B). Furthermore, mRNA levels of PIEZO1 and its interacting partner PANX1³¹ exhibited time-dependent modulation in H1299 cells treated with 2 μM SC (Figure 9C). This trend was mirrored in A549 cells for both PIEZO1 and Pannexin 1 proteins (Figures 9D and 9E) and in H1975 cells for PIEZO1 protein (Figures 9F and 9G). The downregulation may arise from the degradation of membrane proteins due to prolonged activation, a well-documented phenomenon in the regulation of ion channels and GPCRs.³²^,³³^,³⁴ To investigate calcium dynamics, H1975 cells stably expressing GCaMP6s were pretreated for 30 min with 10 μM RR, 10 μM Dooku1 (a PIEZO1 inhibitor),³⁵^,³⁶ or 25 μM BAPTA-AM (a calcium chelator), followed by stimulation with 10 μM SC. Real-time monitoring showed that RR, BAPTA-AM, and Dooku1 significantly suppressed SC-induced calcium responses (Figure 9H). Consistent with this mechanism, experiments using a PIEZO1 knockout cell (PKO, Figure 9I) demonstrated a significantly attenuated response to 10 μM SC (Figures 9J and 9K). Collectively, these functional observations support a model wherein PIEZO1 activation contributes critically to SC-induced calcium signaling initiation and downstream effects.

Discussion

Natural compounds, renowned for their chemical diversity and bioactivity, hold significant promise in anticancer drug discovery.³⁷^,³⁸^,³⁹ Through screening a natural compound library, we identified chalcone derivatives as potent modulators of intracellular calcium signaling and inhibitors of NSCLC cell proliferation. Key findings include: 1. Structural Specificity. Among 1880 screened compounds, active hits (Butein, LicoA, and LicoB) shared the chalcone scaffold—a structure featuring two aryl moieties bridged by an α, β-unsaturated carbonyl group (Figures 1A–1D). 2. Superior Efficacy of Chalcones. Chalcones exhibited stronger antiproliferative effects compared to structural analogs, including A-ring or B-ring structural analogs (Figures 1E–1I). Notably, chalcone analogs lacking the α, β-unsaturated bond or flavonoid frameworks failed to inhibit proliferation, underscoring the indispensability of the conjugated enone system. Substituent positions on the chalcone aromatic rings critically influenced bioactivity.⁴⁰^,⁴¹ Ortho-hydroxyl groups, previously reported to enhance chalcone potency,⁴²^,⁴³ were corroborated here. For instance, Compound 15 (hydroxyl at ortho position) showed stronger inhibition than Compound 16 (hydroxyl at para position). The meta substituent and para substituent may also modulate the activity of chalcones, though the two appear to exert opposing effects.⁴⁴ Butein (hydroxyl at meta-position plus ortho-position on B ring) showed more effective inhibition compared to compound 16 (hydroxyl at ortho-position). Compound 17 (hydroxyl at ortho-position on B ring) showed less effectiveness compared to compound 14 (no hydroxyl group at ortho-position). In addition, Hydroxyl and methoxy substitutions at distinct positions differentially modulated antiproliferative effects.⁴⁴^,⁴⁵ In our study, Compound 19 (methoxy at the ortho position) exhibited superior cytotoxicity and calcium-modulating capacity compared to Butein (hydroxyl at the ortho position) (Figures 1E–1I). The substituent effects significantly modulate bioactivity, probably through modulating the electrophilicity of the β-carbon in the α, β-unsaturated carbonyl group, facilitating hydrogen bond formation or binding to the protein spatial conformation.

In-depth investigations into natural and synthetic chalcones have progressively elucidated their structure-activity relationships. Chalcones exhibit broad biological activities, particularly in antioxidant, anti-inflammatory, and anticancer. Chalcone derivatives enhance cellular resistance to oxidative stress—e.g., by upregulating antioxidant genes such as GCLC and HO-1 in PC12 cells exposed to H₂O₂-induced damage.⁴⁶ Cardamonin suppresses inflammatory mediators (NO, PGE₂) via NF-κB pathway inhibition, downregulating iNOS and COX-2 expression.⁴⁷ Numerous chalcones demonstrate anticancer efficacy against lung, breast, prostate, and colorectal cancers.¹⁸ A key mechanism attributes chalcone bioactivity to their role as Michael addition acceptor. The α, β-unsaturated carbonyl group in chalcones acts as an electrophile, enabling covalent interactions with soft nucleophiles—such as thiol and selenothiol groups critical for protein function—thereby modulating multiple signaling pathways.⁴⁸ This mechanism is in line with other natural products of Michael addition acceptor (e.g., curcumin,⁴⁹ flavonoids,⁵⁰ cinnamaldehyde⁵¹) that disrupt redox balance by targeting nucleophilic residues in thioredoxin reductase (TrxR). Notably, our study revealed that SC, a chalcone derivative, similarly modulates redox homeostasis. It rapidly induced nuclear perturbations of thioredoxin redox status (Figures 6A–6D) and triggered significant ROS accumulation in H1299 cells (Figures 6E and 6F). Transcriptomic analysis identified altered expression of redox-associated enzymes (e.g., CYP1A1, CYP1B1; Figure 4D), which correlated with DNA damage marker upregulation (Figure 4C). Furthermore, SC influenced the expression of KEAP1 (Figure 7A), a protein whose sulfhydryl groups are susceptible to Michael addition acceptor.⁵² These findings suggest that SC may exert pleiotropic effects through its Michael addition acceptor properties, forming “redox switches” via interactions with thiol/selenothiol groups to regulate diverse signaling cascades.

Our findings demonstrated that SC suppressed the proliferation of NSCLC cells (Figures 3A–3C) via at least two critical signaling pathways: cell cycle regulation and the ER stress pathway. SC treatment induced DNA damage, as evidenced by elevated γ-H2AX expression (Figures 5C and 5E), and triggered G2/M phase arrest (Figures 3D–3L). The master regulator of G2/M transition and mitotic entry is the CDK1/Cyclin B complex, whose activity is tightly controlled by DNA damage signals, phosphorylation dynamics, and cyclin degradation. While SC reduced the inhibitory phosphorylation of CDK1 at Thr15, a modification typically associated with kinase activation. It concurrently downregulated Cyclin B expression (Figures 5A and 5G). Furthermore, SC upregulated P21 and GADD45α at both transcriptional (Figure 4G) and protein levels (Figures 5C–5F) in a time- and dose-dependent manner.²⁴ These factors collectively suppressed CDK1/Cyclin B complex activity, culminating in G2/M arrest. Studies of other chalcone compounds have also found that they inhibit cell proliferation and arrest cells at the G2/M stage.⁵³ As the ER serves as a primary intracellular calcium reservoir and orchestrates protein folding, we investigated SC’s effects on ER calcium signaling and stress pathways. Transcriptomic profiling (Figure 4E), mRNA (Figure 4G), and protein expression (Figure 7) analyses collectively revealed SC-induced activation of ER calcium signaling and ER stress response. Among the three ER stress response branches, SC selectively activates the IRE1α and PERK pathways (Figures 7A and 7B). Antagonists of IRE1α and PERK pathways also pharmacologically reversed SC’s effects (CI > 1; Figures 7C and 7D). ER stress responses induced by TG, a canonical ER stressor, were also modulated by SC. Notably, the high GSH/GSSG ratio⁵⁴ required for ER protein folding may render ER-resident proteins, particularly those with nucleophilic thiol groups, susceptible to electrophilic chalcones such as SC, which act as Michael addition acceptors due to their α, β-unsaturated carbonyl moiety. This interaction may underlie SC’s disruption of ER homeostasis. Studies have reported that the ER stress signaling pathway arrests cells in the G2/M phase through GADD45α and P21,⁵⁵^,⁵⁶ so SC-induced cellular arrest may operate downstream of the ER stress pathway. Further studies are required to delineate causal relationships between these pathways.

Calcium flux emerged as a pivotal factor in SC’s bioactivity (Figures 2E and 2F), with the ion channel inhibitor ruthenium red rescuing SC-induced cell death (Figures 8A–8C) and reversing G2/M arrest (Figures 8D–8I). These findings underscore ion channels as critical mediators of SC’s cellular effects. We prioritized PIEZO1 for mechanistic investigation based on transcriptomic sequencing, mRNA expression, and protein level analyses, which collectively demonstrated SC-driven downregulation of PIEZO1 (Figures 9A–9G). Much research shows that PIEZO1 activation promotes G2/M transition¹⁶ and localizes to centrosomes.⁵⁷ Chalcones are also documented to target β-tubulin and mitotic spindles.⁵⁸^,⁵⁹ Notably, Pannexin1, a PIEZO1-interacting partner, was also affected by SC (Figures 9C–9E). PIEZO1 inhibitors (such as Dooku1 and ruthenium red) can suppress SC-induced calcium responses. To further validate PIEZO1’s essential role in SC’s mechanism, we utilized PIEZO1-knockout (KO) cells. These experiments demonstrated that the genetic ablation of PIEZO1 significantly attenuated SC-induced upregulation of the DNA damage marker γ-H2AX (Figures 9J and 9K), functionally linking PIEZO1 activation to SC’s DNA damaging effects. However, our study faced key technical limitations: the lack of highly specific inhibitors beyond Dooku1/RR for PIEZO1 inhibition, and we could not determine whether SC interacts directly with PIEZO1. Conducting direct binding experiments would unequivocally establish it as a direct target and provide crucial molecular evidence. Furthermore, the observed PIEZO1 downregulation mediated by SC likely results from agonist-induced internalization and degradation, a common feedback mechanism to limit excessive channel activation,³²^,³³^,³⁴ though the specific degradation pathways (e.g., ubiquitination/lysosomal routes) require further investigation using tools such as ubiquitin ligase inhibitors or lysosomal disruptors.

In summary, while chalcones generally associate with oxidative/ER stress,⁶⁰^,⁶¹ our screening of natural compounds pinpointed SC as a potent cytotoxic agent in NSCLC cells, acting via a unique PIEZO1-ER Stress-Cell cycle signaling axis. Specifically, SC functionally activated the PIEZO1, disrupts calcium homeostasis, to induce ER stress, trigger aberrant ROS accumulation leading to DNA damage (Figure 10), and consequently dysregulate cell cycle proteins—representing the first reported instance of this mechano-calcium cascade for any chalcone derivative. Despite published evidence of SC’s bioavailability and non-cancer efficacy (e.g., anti-inflammatory effects at 10 mg/kg), the direct extrapolation of this distinct, SC-driven in vitro mechanism to tumor models requires empirical verification. These findings unveil a novel multi-target network through which SC exerts antitumor effects, providing a theoretical foundation for developing innovative therapeutic strategies targeting ion channel-oxidative stress crosstalk.

A schematic illustration of the present study

We identify sappanchalcone (SC) as a PIEZO1-mediated regulator of cellular stress signaling. SC triggers dysregulation of calcium homeostasis and ROS accumulation, which induce DNA damage and ER stress, ultimately disrupting cell cycle progression through G2/M arrest in NSCLC cells.

Limitations of the study

One limitation of this study is the scarcity of highly specific PIEZO1 inhibitors beyond Dooku1 and ruthenium red. More importantly, whether SC interacts directly with the PIEZO1 channel remains unclear, as direct binding assays were not performed. The lack of such evidence prevents the definitive identification of PIEZO1 as a direct target of SC. Additionally, the proposed PIEZO1-ER stress-cell cycle axis, through which SC exerts its antitumor effects, was primarily established using in vitro models. Further validation in animal studies is needed to determine the relevance of this mechanism in vivo.

Resource availability

Lead contact

Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Haijie Yu (hjyu@must.edu.mo).

Materials availability

This study did not generate new unique reagents.

Data and code availability

All data reported in this article will be shared by the lead contact upon request. Original Western blot images have been deposited at Mendeley and are publicly available as of the date of publication. The DOI is listed in the key resources table. This article does not report original code. Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.

Acknowledgments

This work was supported by the Macau Science and Technology Development Fund, Macau, China (Project code: 0132/2024/RIA2, 0091/2024/RIB2 and 006/2023/SKL) and the Guangdong Basic and Applied Basic Research Foundation, Guangdong, China (Project code: 2023A1515012011). This is an open project of Dr. Neher’s Biophysics Laboratory for Innovative Drug Discovery funded by Macau Science and Technology Development Fund (Macau University of Science and Technology, 002/2023/ALC).

Author contributions

Conceptualization, W.W., H.Y., and L.M.; formal analysis, W.W., H.Y., and L.M.; funding acquisition, H.Y., L.M., and J.H.; investigation, W.W., R.Z., G.C., Z.C., Z.L., Y.C., J.L., W.L., J.W., X.W., L.M., and H.Y.; methodology, W.W., H.Y., and L.M.; supervision, H.Y. and L.M.; writing – original draft, W.W., H.Y., and L.M.; writing – review and editing, all authors.

Declaration of interests

The authors declare no conflict of interest with regard to the publication of this article.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies

anti-p-Histone H2A.X	Santa Cruz	Cat#sc-517348; RRID: AB_2783871
anti-p21	Santa Cruz	Cat#sc-817; RRID: AB_2783871
anti-GADD45α	Santa Cruz	Cat#sc-6850; RRID: AB_627653
anti-GAPDH	Santa Cruz	Cat#sc-47724; RRID: AB_627678
anti-CDC2	Cell Signaling Technology	Cat#9116; RRID: AB_2074795
anti-Phospho-CDC2 (Tyr15)	Cell Signaling Technology	Cat#4539; RRID: AB_560953
anti-Cyclin B1	Cell Signaling Technology	Cat#12231; RRID: AB_2783553
anti-KEAP1	Cell Signaling Technology	Cat#7705; RRID: AB_10860422
β-ACTIN	Cell Signaling Technology	Cat#3700S; RRID: AB_2242334
anti-GRP78/BIP	HuaBio	Cat#HA722202; RRID: AB_3718306
anti-ERN1	HuaBio	Cat#ER190290; RRID: AB_3069473
anti-Phospho-IRE1(S724)	HuaBio	Cat#HA721980; RRID: AB_3096844
anti-PERK	HuaBio	Cat#HA721510; RRID: AB_3072626
anti-ATF6	HuaBio	Cat#HA601321; RRID: AB_3718311
anti-ATF4	HuaBio	Cat#ET161237; RRID: AB_3070110
anti-DDIT3	HuaBio	Cat#ET170305; RRID: AB_3070363
anti-XBP1	HuaBio	Cat#ET170323; RRID: AB_3070380
anti-FAM38A/PIEZO1	HuaBio	Cat#HA601100; RRID: AB_3071822
anti-Pannexin1	HuaBio	Cat#HA721629; RRID: AB_3072742
anti-Vinculin	HuaBio	Cat#ET170594; RRID: AB_3070622
anti-Phospho-PERK (Thr982)	Solarbio	Cat#K010157P; RRID: AB_3718274
Goat Anti-mouse IgG-HRP	abmart	Cat#M21001; RRID: AB_2713950
Goat Anti-rabbit IgG-HRP	abmart	Cat#M21002; RRID: AB_2713951

Chemicals, peptides, and recombinant proteins

4-Allylpyrocatechol	Macklin	Cat#A868304
Benzylideneacetone	Macklin	Cat#P820144
2’,4’-Dihydroxybutyrophenone	Macklin	Cat#D893187
2,3,4,4’-Tetrahydroxybenzophenone	Macklin	Cat#T859844
Liquiritigenin	Macklin	Cat#L812556
Naringenin	Macklin	Cat#N875513
Naringetol	Macklin	Cat#768164
Butin	Macklin	Cat#B878831
Chalcone	Macklin	Cat#C830765
Pinocembrin chalcone	Macklin	Cat#P879084
Naringenin chalcone	Macklin	Cat#N914633
Okanin	Macklin	Cat#O917126
Sappanchalcone	Macklin	Cat#S876252
4μ8C	Macklin	Cat#C872514
2,2’,4’-Trihydroxychalcone	Merck	Cat#IDF00061
Ruthenium Red	Merck	Cat#R2751
2,4-dihydroxybenzoic acid	Aladdin	Cat#D104371
2’,4’-Dihydroxypropiophenone	Aladdin	Cat#D154234
4’-Hydroxychalcone	Aladdin	Cat#H157052
Isoliquiritigenin	Aladdin	Cat#I111284
GSK2606414	Aladdin	Cat#G125654
Butein	Desite	Cat#DST210311
Licochalcone A	Abphyto	Cat#AB0548
Licochalcone B	Abphyto	Cat#ABL0547
Osmundacetone	Gelatins	Cat#YZ-111888
Homobutein	Extrasynthese	Cat#YZ-1117S
Thapsigargin	Invitrogen	Cat#1922965
TargetMol L6000-Natural Compound Library	Targetmol	Cat#L6000
FITC Annexin V Apoptosis Detection Kit	BD Biosciences	Cat#556547
Reactive Oxygen Species Assay Kit	Beyotime	Cat#S0033
TRIzol® reagent	Invitrogen	Cat#15596026
PerfectStartTM Green qPCR SuperMix (+Dye I/+Dye II)	TransGen Biotech	Cat#AQ601-01-V2
TransScript® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal)	TransGen Biotech	Cat#AT341-01

Deposited data

Original Western Blots	This paper, in Mendeley data	https://doi.org/10.17632/vffmxyn7cy.1

Experimental models: Cell lines

A549	ATCC	Cat#CCL-185
NCI-H1299	ATCC	Cat#CRL-5803
NCI-H1975	ATCC	Cat#CRL-5908
HEK293T	ATCC	Cat#CRL-11268
HEK293T-PIEZO1 KO	Ubigene Biosciences	Cat#YKO-HJ085

Oligonucleotides

SFN-F: GTGTGTGCGACACCGTACT	Sangon Biotech	N/A
SFN-R: CTCGGCTAGGTAGCGGTAG	Sangon Biotech	N/A
CDKN1A-F: CCCGTGAGCGATGGAACT	Sangon Biotech	N/A
CDKN1A-R: CCCGTGGGAAGGTAGAGC	Sangon Biotech	N/A
GADD45A-F: CCCTGATCCAGGCGTTTTG	Sangon Biotech	N/A
GADD45A-R: GATCCATGTAGCGACTTTCCC	Sangon Biotech	N/A
ITPR3-F: CCAAGCAGACTAAGCAGGACA	Sangon Biotech	N/A
ITPR3-R: ACACTGCCATACTTCACGACA	Sangon Biotech	N/A
ATP2A1-F: AAACCACGGAGGAATGTTTGG	Sangon Biotech	N/A
ATP2A1-R: AGCTCATTGAGGCCGTATTTC	Sangon Biotech	N/A
ATP2A2-F: CATCAAGCACACTGATCCCGT	Sangon Biotech	N/A
ATP2A2-R: CCACTCCCATAGCTTTCCCAG	Sangon Biotech	N/A
PIEZO1-F: CAGGCCTATGAGGAGCTGTC	Sangon Biotech	N/A
PIEZO1-R: TTGTAGAGCTCCCGCTTCAT	Sangon Biotech	N/A
PANX1-F: CCACGGAGTACGTGTTCTCG	Sangon Biotech	N/A
PANX1-R: CCGCCCAGCAATATGAATCC	Sangon Biotech	N/A
GAPDH-F: CAGTCAGCCGCATCTTCTTTTG	Sangon Biotech	N/A
GAPDH-R: GCCCAATACGACCAAATCCGTT	Sangon Biotech	N/A

Recombinant DNA

pNuc-TrxRFP1	Addgene	Cat#98998

Software and algorithms

FlowJo software	FlowJo LLC.	N/A
GraphPad Prism software	GraphPad Software, Inc.	N/A
ImageJ	NIH ImageJ	N/A
Microsoft Excel	Microsoft	N/A
SoftWoRx 7.0	Cytiva	N/A
LightCycler 480 Software	Roche	N/A
CompuSyn software	ComboSyn Incorporated	N/A

Open in a new tab

Experimental model and study participant details

Cell lines and culture

The human non-small cell lung cancer (NSCLC) cell lines A549, NCI-H1299, NCI-H1975, and the human embryonic kidney cell line HEK293T were purchased from the American Type Culture Collection (ATCC, VA, USA). The HEK293T-PIEZO1 knockout (KO) cell line was generated and purchased from Ubigene Biosciences (Guangzhou, China).

All cell lines were authenticated by the vendors using short tandem repeat (STR) profiling prior to shipment. To prevent potential mycoplasma contamination, all cell cultures were routinely maintained with the supplementation of Mycoplasma Prophylactic and Elimination Reagent I (Beyotime, C0292). Throughout the course of this study, no signs of mycoplasma contamination were observed.

A549, NCI-H1299, and NCI-H1975 cells were cultured in RPMI-1640 Medium (GIBCO, 31800022) supplemented with 10% fetal bovine serum (FBS, GIBCO, 10270106) , 1% Penicillin-Streptomycin-Glutamine (GIBCO, 10378016) and 0.2% Mycoplasma Prophylactic and Elimination Reagent I (Beyotime, C0292). HEK293T and HEK293T-PIEZO1 KO cells were maintained in DMEM medium (GIBCO, 12800017) supplemented with 10% FBS, 1% Penicillin-Streptomycin-Glutamine and 0.2% Mycoplasma Prophylactic and Elimination Reagent I (Beyotime, C0292). All cells were cultured in a humidified incubator at 37°C with 5% CO₂.

Method details

Chemical reagents and compounds

A comprehensive list of all compounds used in this study, including their sources and catalog information, is provided in the key resources table. Briefly, the initial high-throughput screening was performed using the TargetMol L6000-Natural Compound Library (Targetmol, MA, USA). Subsequent experiments utilized compounds purchased from various suppliers, including: 4-Allylpyrocatechol (CAS: 1126-61-0), Benzylideneacetone (CAS: 1896-62-4), 2’,4’-Dihydroxybutyrophenone (CAS: 4390-92-5), 2,3,4,4’-Tetrahydroxybenzophenone (CAS: 31127-54-5), Liquiritigenin (CAS: 578-86-9), Naringenin (CAS: 480-41-1), Naringetol (CAS: 67604-48-2), Butin (CAS: 492-14-8), Chalcone (CAS: 614-47-1), Pinocembrin chalcone (CAS: 4197-97-1), Naringenin chalcone (CAS: 73692-50-9), Okanin (CAS: 484-76-4), Sappanchalcone (CAS: 94344-54-4) , 4μ8C (IRE1α inhibitor, CAS: 14003-96-4) were purchased from Macklin (Shanghai, China).

2,4-dihydroxybenzoic acid (CAS: 89-86-1), 2’,4’-Dihydroxypropiophenone (CAS: 5792-36-9), 4’-Hydroxychalcone (CAS: 2657-25-2), Isoliquiritigenin (CAS: 961-29-5), GSK2606414 (PERK inhibitor, CAS: 1337531-36-8) were purchased from Aladdin (Shanghai, China).

2,2’,4’-Trihydroxychalcone (CAS: 26962-50-5), Ruthenium Red (CAS: 12790-48-6) were purchased from Merck (Darmstadt, Germany). Butein (CAS: 487-52-5) was purchased from Desite (Chengdu, China). Licochalcone A (CAS: 58749-22-7) and Licochalcone B (CAS: 58749-23-8) were purchased from Abphyto (Chengdu, China).Osmundacetone was purchased from Gelatins, Osmundacetone (CAS: 37079-84-8) was purchased from Gelatins (Jiangxi, China). Homobutein (CAS: 34000-39-0) was purchased from Extrasynthese (Z.I Lyon Nord, France). Thapsigargin (CAS: 67526-95-8) was purchased from Invitrogen (CA, USA).

High-throughput drug screening

H1975-GCaMP6s were seeded at a density of 1.3 × 10⁵ cells per well in Corning #3603 plates. After 24 hours of culture, the medium was replaced with phenol red-free HBSS (H1025, Solarbio) containing calcium and magnesium. The plates were then incubated at 37°C in a 5% CO₂ incubator for 30 minutes to balance. Subsequently, the FLIPR-Tetra system (Molecular Devices, CA, USA) was used to add drug diluted in HBSS to the wells, achieving a final concentration of 10 μM, and fluorescence signals were detected using the recommended settings. Baseline readings were taken for 1 minute before drug addition, followed by readings for 1 h post-treatment. The initial screening employed a collection of 1880 natural compounds from TargetMol. Subsequent screenings utilized an additional nineteen compounds sourced from other vendors.

Cell viability assay

Cells were plated onto 96-well plates at a density of 3 - 3.5 × 10³ cells per well and incubated overnight, followed by the cells being treated with various dilutions of the compounds for 48 hours. Cell viability was assessed using the SRB assay described in the literature. The optical density (OD) at 515 nm was measured using a microplate reader. The IC₅₀ values were determined using GraphPad software (GraphPad Software Inc., San Diego, CA, USA).

Cell cycle measurement by flow cytometry

Cells were collected, washed with PBS, and resuspended. The cell suspension was then added dropwise into vortexing anhydrous ethanol to achieve a final fixation solution of 75% ethanol. The cells were fixed at -20°C for 30 min. After fixation, the cells were resuspended in PBS and treated with RNase A (Roche, USA) and propidium iodide to final concentrations of 100 μg/mL and 50 μg/mL, respectively. Following a 30 min incubation in the dark for staining, the cells were analysed using a flow cytometer (Beckman CytoFLEX S, USA). Propidium iodide fluorescence was measured by PE channel. Cell cycle distribution (G0/G1, S, G2/M phases) was quantified using FlowJo software with DeanJetFox model (version 10.8.1). Data from three independent experiments were expressed as mean percentages ± standard deviation (SD).

Cell apoptosis analysis by flow cytometry

Apoptosis was analyzed by flow cytometry using the FITC Annexin V Apoptosis Detection Kit (BD Biosciences, USA) following manufacturer guidelines. Briefly, harvested cells were trypsinized and centrifuged at 1000 × g for 5 min, followed by washing with 1 mL of 4°C PBS and centrifugation at either 350 × g for 5 min or 400 × g for 3 min. Binding Buffer was prepared by diluting the 10× concentrate to 1× working concentration in PBS. Subsequently, cells were resuspended in 100 μL of 1× Binding Buffer per sample tube, stained with 2.5 μL Annexin V-FITC and 2.5 μL propidium iodide through gentle pipetting, and incubated for 15 min at room temperature protected from light prior to immediate flow cytometric analysis.

Intracellular ROS measurement by flow cytometry

In total, 3 × 10⁵ cells were seeded according to the recommended protocol, and ROS levels in the cells were measured using the DCFH-DA fluorescence indicator (Beyotime, S0033). The cells were incubated with DCFH-DA at 37°C for 30 min. Then, the cells were washed with PBS three times and collected. The cells were suspended in the serum-free medium and analyzed using a Beckman Coulter CytoFLEX (Beckman Coulter, USA).

Transient transfection

The Nuc-TrxRFP (Addgene, Plasmid #98998) plasmid was purchase from Addgene Plasmid (MA, USA). Plasmid transfections were performed using UltraFection 3.0 reagent (Beijing 4A Biotech, China) typically on a 6-well scale with a 1 μg:3 μl ratio of DNA to Ultra Fection reagent according to the manufacturer’s instruction. Cells were transfected with plasmid at 50 - 70% confluency. After 6 hours of transfection, fresh medium exchange is required. Cells will be examined 24 hours after transfection.

Live cell fluorescence microscopy assay

Coverslips were coated with poly-l-lysine for 1 h, using deionized water wash and dry. After 24 h transfection, cells were cultured in petri dish with several coverslips overnight. Coverslips containing cells were placed in an imaging chamber and perfused with Ringer buffer (2 mM CaCl₂, 2.5 mM KCl, 145 mM NaCl, 1 mM MgCl₂, 10 mM glucose, 10 mM Hepes, pH 7.4). And cells were treated with Bisbenzimide Hoechst 33342 (Merck, Darmstadt, Germany) for 5 min before the addition of 50 μM SC treatment. Subsequently, a photograph was taken at the first minute after adding SC, followed by taking one photo per minute thereafter. All images and videos were taken by API Delta Vision Live-cell Imaging System (GE Healthcare Company, CA, USA) using 20× and 40× flat-field apochromatic mirrors. The time interval for data collection was 1min with a 0.08 s exposure time. All captures were acquired with SoftWoRx 7.0 software.

RT-qPCR

Total RNA was extracted from whole-cell lysates using TRIzol® reagent (Invitrogen, California, USA) according to the manufacturer’s protocol. RNA purity and concentration were determined by measuring the absorbance at 260/280 nm using a NanoDrop™ 2000c spectrophotometer (Thermo Fisher Scientific, California, USA). First-strand complementary DNA (cDNA) was synthesized from 1 μg of total RNA using the TransScript® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (TransGen Biotech, Beijing, China).

For qPCR analysis, cDNA samples were mixed PerfectStartTM Green qPCR SuperMix (+Dye I / +Dye II) (TransGen Biotech, Beijing, China) in a total volume of 20 μl. Amplification was performed on a ViiA™ 7 Real-Time PCR System (Applied Biosystems) under the following conditions: initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Melting curve analysis (60 - 95°C) was conducted to confirm primer specificity. Data were analyzed using LightCycler® 480 Software (version 1.5.1, Roche), and relative gene expression was calculated via the 2^−ΔΔCt method. All experiments included triplicate biological replicates.

Combination therapy assays

Cells were treated with SC with 4μ8C and GSK2600414 individually or in combination at a fixed ratio with serial concentrations for 48 hours. The drugs’ effects on cell proliferation were assessed by SRB assay. The combination index (CI) value and DRI value were calculated and analyzed by CompuSyn software (The ComboSyn, Inc, Cambridge, UK) as described⁶² CI values < 1, = 1 and > 1 denote synergistic, additive and antagonistic effects, respectively.

Protein immunoblot analysis

Cells (3 × 10⁵ cells/well) were seeded into a 6-well plate and treated with different concentrations of compounds. Cell proteins were extracted using RIPA buffer (Cell Signaling Technology, #9806S) supplemented with an inhibitor cocktail (Roche, #4693132001), and the protein concentration was measured using the Dye Reagent Concentrate protein assay (Bio-Rad Laboratories, #5000002). Protein samples were electrophoresed on 7.5%, 10% and 12.5% SDS-PAGE gels and transferred to Nitrocellulose Transfer Membrane. 5% lipid milk prepared by Tris-buffered saline solution (TBS) containing 0.1% Tween 20 was used for 1 h membrane blocking at room temperature, and the membranes were incubated with primary antibodies overnight at 4°C in shaker. After washing 3 times for 5 min each time with TBST, the membranes were incubated with secondary antibodies for 2 h at room temperature. Protein bands images were acquired by ECL reagents and Amersham Imager 800 (GE Healthcare, CA, USA), software ImageJ (NIH, Bethesda, USA) was used for images processing and quantified.

RNA transcription sequencing

H1299 cells seeded onto a 60 mm dish (4 × 10⁵ cells/dish) were cultured for 24 hours and treated with 2 μM SC for 24 h. Total RNA was extracted using Trizol, and RNA integrity was assessed using Nano Drop 2000c spectrophotometer (Thermo Science, California, USA). RNA libraries were prepared using Hieff NGS™ MaxUp Dual-mode mRNA Library Prep Kit for Illumina® following the manufacturer’s instructions. Sequencing was performed on the DNBSEQ-T7 platform to generate paired-end reads. Raw sequencing data were quality-assessed using FastQC, and low-quality reads were trimmed using Trimmomatic to obtain high-quality clean data. Gene expression levels were quantified using StringTie in conjunction with a reference gene model. Weighted Gene Co-expression Network Analysis (WGCNA) was employed to explore gene co-expression patterns, and sample comparisons were performed based on the expression matrix. Differential gene expression analysis was conducted using DESeq2, and the volcano map, GO analysis and heatmap were plotted by https://www.bioinformatics.com.cn (last accessed on 10 Dec 2024), an online platform for data analysis and visualization. The PPI network was determined using the STRING website tool.

Quantification and statistical analysis

Data are presented as the mean ± SEM or mean ± SD from at least three biological independent experiments, the statistical information for individual experiments is detailed in the corresponding figure legends. Detailed methodologies for the quantification of data from high-throughout screening, flow cytometry, western blotting, and RT-qPCR are described in the method details section. The statistical information for individual experiments is detailed in the corresponding figure legends. Unpaired one-way ANOVA was used for three or more groups’ data analysis. GraphPad Prism 9.0 software (GraphPad Software, USA) was used for the statistical analysis. The significance level was set at ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.

Published: November 14, 2025

Contributor Information

Lijuan Ma, Email: ljma@must.edu.mo.

Haijie Yu, Email: hjyu@must.edu.mo.

References

1.Hirata A., Hosoi F., Miyagawa M., Ueda S.i., Naito S., Fujii T., Kuwano M., Ono M. HER2 overexpression increases sensitivity to gefitinib, an epidermal growth factor receptor tyrosine kinase inhibitor, through inhibition of HER2/HER3 heterodimer formation in lung cancer cells. Cancer Res. 2005;65:4253–4260. doi: 10.1158/0008-5472.CAN-04-2748. [DOI] [PubMed] [Google Scholar]
2.Phuchareon J., McCormick F., Eisele D.W., Tetsu O. EGFR inhibition evokes innate drug resistance in lung cancer cells by preventing Akt activity and thus inactivating Ets-1 function. Proc. Natl. Acad. Sci. USA. 2015;112:E3855–E3863. doi: 10.1073/pnas.1510733112. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Goel S., DeCristo M.J., Watt A.C., BrinJones H., Sceneay J., Li B.B., Khan N., Ubellacker J.M., Xie S., Metzger-Filho O., et al. CDK4/6 inhibition triggers anti-tumour immunity. Nature. 2017;548:471–475. doi: 10.1038/nature23465. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Yoshida A., Lee E.K., Diehl J.A. Induction of Therapeutic Senescence in Vemurafenib-Resistant Melanoma by Extended Inhibition of CDK4/6. Cancer Res. 2016;76:2990–3002. doi: 10.1158/0008-5472.CAN-15-2931. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Chew Y.M., Cross R.A. Taxol acts differently on different tubulin isotypes. Commun. Biol. 2023;6:946. doi: 10.1038/s42003-023-05306-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Khing T.M., Choi W.S., Kim D.M., Po W.W., Thein W., Shin C.Y., Sohn U.D. The effect of paclitaxel on apoptosis, autophagy and mitotic catastrophe in AGS cells. Sci. Rep. 2021;11 doi: 10.1038/s41598-021-02503-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Lau M.Y., Han H., Hu J., Ji C. Association of cyclin D and estrogen receptor alpha36 with hepatocellular adenomas of female mice under chronic endoplasmic reticulum stress. J. Gastroenterol. Hepatol. 2013;28:576–583. doi: 10.1111/jgh.12084. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Lindner P., Christensen S.B., Nissen P., Møller J.V., Engedal N. Cell death induced by the ER stressor thapsigargin involves death receptor 5, a non-autophagic function of MAP1LC3B, and distinct contributions from unfolded protein response components. Cell Commun. Signal. 2020;18:12. doi: 10.1186/s12964-019-0499-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Xu C., Bailly-Maitre B., Reed J.C. Endoplasmic reticulum stress: cell life and death decisions. J. Clin. Investig. 2005;115:2656–2664. doi: 10.1172/JCI26373. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Endo M. Calcium ion as a second messenger with special reference to excitation-contraction coupling. J. Pharmacol. Sci. 2006;100:519–524. doi: 10.1254/jphs.cpj06004x. [DOI] [PubMed] [Google Scholar]
11.Yu F., Hubrack S.Z., Chakraborty S., Sun L., Alcantara-Adap E., Kulkarni R., Billing A.M., Graumann J., Taylor C.W., Machaca K. Remodeling of ER-plasma membrane contact sites but not STIM1 phosphorylation inhibits Ca(2+) influx in mitosis. Proc. Natl. Acad. Sci. USA. 2019;116:10392–10401. doi: 10.1073/pnas.1821399116. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Chen Y.F., Chiu W.T., Chen Y.T., Lin P.Y., Huang H.J., Chou C.Y., Chang H.C., Tang M.J., Shen M.R. Calcium store sensor stromal-interaction molecule 1-dependent signaling plays an important role in cervical cancer growth, migration, and angiogenesis. Proc. Natl. Acad. Sci. USA. 2011;108:15225–15230. doi: 10.1073/pnas.1103315108. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Ding X., He Z., Zhou K., Cheng J., Yao H., Lu D., Cai R., Jin Y., Dong B., Xu Y., Wang Y. Essential role of TRPC6 channels in G2/M phase transition and development of human glioma. J. Natl. Cancer Inst. 2010;102:1052–1068. doi: 10.1093/jnci/djq217. [DOI] [PubMed] [Google Scholar]
14.Faouzi M., Hague F., Potier M., Ahidouch A., Sevestre H., Ouadid-Ahidouch H. Down-regulation of Orai3 arrests cell-cycle progression and induces apoptosis in breast cancer cells but not in normal breast epithelial cells. J. Cell. Physiol. 2011;226:542–551. doi: 10.1002/jcp.22363. [DOI] [PubMed] [Google Scholar]
15.Chen X., Li J., Zhang R., Zhang Y., Wang X., Leung E.L.H., Ma L., Wong V.K.W., Liu L., Neher E., Yu H. Suppression of PD-L1 release from small extracellular vesicles promotes systemic anti-tumor immunity by targeting ORAI1 calcium channels. J. Extracell. Vesicles. 2022;11 doi: 10.1002/jev2.12279. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Gudipaty S.A., Lindblom J., Loftus P.D., Redd M.J., Edes K., Davey C.F., Krishnegowda V., Rosenblatt J. Mechanical stretch triggers rapid epithelial cell division through Piezo1. Nature. 2017;543:118–121. doi: 10.1038/nature21407. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Jang S.H., Choi S.Y., Ryu P.D., Lee S.Y. Anti-proliferative effect of Kv1.3 blockers in A549 human lung adenocarcinoma in vitro and in vivo. Eur. J. Pharmacol. 2011;651:26–32. doi: 10.1016/j.ejphar.2010.10.066. [DOI] [PubMed] [Google Scholar]
18.Mahapatra D.K., Bharti S.K., Asati V. Anti-cancer chalcones: Structural and molecular target perspectives. Eur. J. Med. Chem. 2015;98:69–114. doi: 10.1016/j.ejmech.2015.05.004. [DOI] [PubMed] [Google Scholar]
19.Kwak A.W., Lee M.J., Lee M.H., Yoon G., Cho S.S., Chae J.I., Shim J.H. The 3-deoxysappanchalcone induces ROS-mediated apoptosis and cell cycle arrest via JNK/p38 MAPKs signaling pathway in human esophageal cancer cells. Phytomedicine. 2021;86 doi: 10.1016/j.phymed.2021.153564. [DOI] [PubMed] [Google Scholar]
20.Seo H.W., No H., Cheon H.J., Kim J.K. Sappanchalcone, a flavonoid isolated from Caesalpinia sappan L., induces caspase-dependent and AIF-dependent apoptosis in human colon cancer cells. Chem. Biol. Interact. 2020;327 doi: 10.1016/j.cbi.2020.109185. [DOI] [PubMed] [Google Scholar]
21.Zhang Q., Liu J.L., Qi X.M., Qi C.T., Yu Q. Inhibitory activities of Lignum Sappan extractives on growth and growth-related signaling of tumor cells. Chin. J. Nat. Med. 2014;12:607–612. doi: 10.1016/s1875-5364(14)60092-3. [DOI] [PubMed] [Google Scholar]
22.Draetta G., Luca F., Westendorf J., Brizuela L., Ruderman J., Beach D. Cdc2 protein kinase is complexed with both cyclin A and B: evidence for proteolytic inactivation of MPF. Cell. 1989;56:829–838. doi: 10.1016/0092-8674(89)90687-9. [DOI] [PubMed] [Google Scholar]
23.Kuo L.J., Yang L.X. Gamma-H2AX - a novel biomarker for DNA double-strand breaks. In Vivo. 2008;22:305–309. [PubMed] [Google Scholar]
24.Zhan Q., Antinore M.J., Wang X.W., Carrier F., Smith M.L., Harris C.C., Fornace A.J., Jr. Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 1999;18:2892–2900. doi: 10.1038/sj.onc.1202667. [DOI] [PubMed] [Google Scholar]
25.Zhao H., Jin S., Antinore M.J., Lung F.D., Fan F., Blanck P., Roller P., Fornace A.J., Jr., Zhan Q. The central region of Gadd45 is required for its interaction with p21/WAF1. Exp. Cell Res. 2000;258:92–100. doi: 10.1006/excr.2000.4906. [DOI] [PubMed] [Google Scholar]
26.Jin P., Feng X.D., Huang C.S., Li J., Wang H., Wang X.M., Li L., Ma L.Q. Oxidative stress and cellular senescence: Roles in tumor progression and therapeutic opportunities. Medcomm-Oncol. 2024;3 doi: 10.1002/mog2.70007. [DOI] [Google Scholar]
27.Peng P., Qin S., Li L., He Z., Li B., Nice E.C., Zhou L., Lei Y. Epigenetic remodeling under oxidative stress: Mechanisms driving tumor metastasis. Medcomm-Oncol. 2024;3 doi: 10.1002/mog2.70000. [DOI] [Google Scholar]
28.Cross B.C.S., Bond P.J., Sadowski P.G., Jha B.K., Zak J., Goodman J.M., Silverman R.H., Neubert T.A., Baxendale I.R., Ron D., Harding H.P. The molecular basis for selective inhibition of unconventional mRNA splicing by an IRE1-binding small molecule. Proc. Natl. Acad. Sci. USA. 2012;109:E869–E878. doi: 10.1073/pnas.1115623109. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Mahameed M., Wilhelm T., Darawshi O., Obiedat A., Tommy W.S., Chintha C., Schubert T., Samali A., Chevet E., Eriksson L.A., et al. The unfolded protein response modulators GSK2606414 and KIRA6 are potent KIT inhibitors. Cell Death Dis. 2019;10:300. doi: 10.1038/s41419-019-1523-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Gottlieb P.A., Sachs F. Piezo1: properties of a cation selective mechanical channel. Channels. 2012;6:214–219. doi: 10.4161/chan.21050. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Desplat A., Penalba V., Gros E., Parpaite T., Coste B., Delmas P. Piezo1-Pannexin1 complex couples force detection to ATP secretion in cholangiocytes. J. Gen. Physiol. 2021;153 doi: 10.1085/jgp.202112871. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Foot N., Henshall T., Kumar S. Ubiquitination and the Regulation of Membrane Proteins. Physiol. Rev. 2017;97:253–281. doi: 10.1152/physrev.00012.2016. [DOI] [PubMed] [Google Scholar]
33.Rajagopal S., Shenoy S.K. GPCR desensitization: Acute and prolonged phases. Cell. Signal. 2018;41:9–16. doi: 10.1016/j.cellsig.2017.01.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Krshnan L., van de Weijer M.L., Carvalho P. Endoplasmic Reticulum-Associated Protein Degradation. Cold Spring Harb. Perspect. Biol. 2022;14 doi: 10.1101/cshperspect.a041247. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Evans E.L., Cuthbertson K., Endesh N., Rode B., Blythe N.M., Hyman A.J., Hall S.J., Gaunt H.J., Ludlow M.J., Foster R., Beech D.J. Yoda1 analogue (Dooku1) which antagonizes Yoda1-evoked activation of Piezo1 and aortic relaxation. Br. J. Pharmacol. 2018;175:1744–1759. doi: 10.1111/bph.14188. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Qu J., Zong H.F., Shan Y., Zhang S.C., Guan W.P., Yang Y., Zhao H.L. Piezo1 suppression reduces demyelination after intracerebral hemorrhage. Neural Regen. Res. 2023;18:1750–1756. doi: 10.4103/1673-5374.361531. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Chen G., Zhu X., Li J., Zhang Y., Wang X., Zhang R., Qin X., Chen X., Wang J., Liao W., et al. Celastrol inhibits lung cancer growth by triggering histone acetylation and acting synergically with HDAC inhibitors. Pharmacol. Res. 2022;185 doi: 10.1016/j.phrs.2022.106487. [DOI] [PubMed] [Google Scholar]
38.Li J., Wu Z., Chen G., Wang X., Zhu X., Zhang Y., Zhang R., Wu W., Zhu Y., Ma L., Yu H. Formosanin C inhibits non-small-cell lung cancer progression by blocking MCT4/CD147-mediated lactate export. Phytomedicine. 2023;109 doi: 10.1016/j.phymed.2022.154618. [DOI] [PubMed] [Google Scholar]
39.Liao W., Zhang R., Chen G., Zhu X., Wu W., Chen Z., Jiang C., Lin Z., Ma L., Yu H. Berberine synergises with ferroptosis inducer sensitizing NSCLC to ferroptosis in p53-dependent SLC7A11-GPX4 pathway. Biomed. Pharmacother. 2024;176 doi: 10.1016/j.biopha.2024.116832. [DOI] [PubMed] [Google Scholar]
40.Zhou B., Xing C. Diverse Molecular Targets for Chalcones with Varied Bioactivities. Med. Chem. 2015;5:388–404. doi: 10.4172/2161-0444.1000291. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Zhuang C., Zhang W., Sheng C., Zhang W., Xing C., Miao Z. Chalcone: A Privileged Structure in Medicinal Chemistry. Chem. Rev. 2017;117:7762–7810. doi: 10.1021/acs.chemrev.7b00020. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Dinkova-Kostova A.T., Abeygunawardana C., Talalay P. Chemoprotective properties of phenylpropenoids, bis(benzylidene)cycloalkanones, and related Michael reaction acceptors: correlation of potencies as phase 2 enzyme inducers and radical scavengers. J. Med. Chem. 1998;41:5287–5296. doi: 10.1021/jm980424s. [DOI] [PubMed] [Google Scholar]
43.Dinkova-Kostova A.T., Massiah M.A., Bozak R.E., Hicks R.J., Talalay P. Potency of Michael reaction acceptors as inducers of enzymes that protect against carcinogenesis depends on their reactivity with sulfhydryl groups. Proc. Natl. Acad. Sci. USA. 2001;98:3404–3409. doi: 10.1073/pnas.051632198. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Srinivasan B., Johnson T.E., Lad R., Xing C. Structure-activity relationship studies of chalcone leading to 3-hydroxy-4,3',4',5'-tetramethoxychalcone and its analogues as potent nuclear factor kappaB inhibitors and their anticancer activities. J. Med. Chem. 2009;52:7228–7235. doi: 10.1021/jm901278z. [DOI] [PubMed] [Google Scholar]
45.Gan F.F., Kaminska K.K., Yang H., Liew C.Y., Leow P.C., So C.L., Tu L.N.L., Roy A., Yap C.W., Kang T.S., et al. Identification of Michael acceptor-centric pharmacophores with substituents that yield strong thioredoxin reductase inhibitory character correlated to antiproliferative activity. Antioxid. Redox Signal. 2013;19:1149–1165. doi: 10.1089/ars.2012.4909. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Wu J.Z., Cheng C.C., Shen L.L., Wang Z.K., Wu S.B., Li W.L., Chen S.H., Zhou R.P., Qiu P.H. Synthetic chalcones with potent antioxidant ability on H(2)O(2)-induced apoptosis in PC12 cells. Int. J. Mol. Sci. 2014;15:18525–18539. doi: 10.3390/ijms151018525. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Israf D.A., Khaizurin T.A., Syahida A., Lajis N.H., Khozirah S. Cardamonin inhibits COX and iNOS expression via inhibition of p65NF-kappaB nuclear translocation and Ikappa-B phosphorylation in RAW 264.7 macrophage cells. Mol. Immunol. 2007;44:673–679. doi: 10.1016/j.molimm.2006.04.025. [DOI] [PubMed] [Google Scholar]
48.Liang S.T., Chen C., Chen R.X., Li R., Chen W.L., Jiang G.H., Du L.L. Michael acceptor molecules in natural products and their mechanism of action. Front. Pharmacol. 2022;13 doi: 10.3389/fphar.2022.1033003. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Fang J., Lu J., Holmgren A. Thioredoxin reductase is irreversibly modified by curcumin: a novel molecular mechanism for its anticancer activity. J. Biol. Chem. 2005;280:25284–25290. doi: 10.1074/jbc.M414645200. [DOI] [PubMed] [Google Scholar]
50.Lu J., Papp L.V., Fang J., Rodriguez-Nieto S., Zhivotovsky B., Holmgren A. Inhibition of Mammalian thioredoxin reductase by some flavonoids: implications for myricetin and quercetin anticancer activity. Cancer Res. 2006;66:4410–4418. doi: 10.1158/0008-5472.CAN-05-3310. [DOI] [PubMed] [Google Scholar]
51.Chew E.H., Nagle A.A., Zhang Y., Scarmagnani S., Palaniappan P., Bradshaw T.D., Holmgren A., Westwell A.D. Cinnamaldehydes inhibit thioredoxin reductase and induce Nrf2: potential candidates for cancer therapy and chemoprevention. Free Radic. Biol. Med. 2010;48:98–111. doi: 10.1016/j.freeradbiomed.2009.10.028. [DOI] [PubMed] [Google Scholar]
52.Dinkova-Kostova A.T., Holtzclaw W.D., Cole R.N., Itoh K., Wakabayashi N., Katoh Y., Yamamoto M., Talalay P. Direct evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc. Natl. Acad. Sci. USA. 2002;99:11908–11913. doi: 10.1073/pnas.172398899. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Ouyang Y., Li J., Chen X., Fu X., Sun S., Wu Q. Chalcone Derivatives: Role in Anticancer Therapy. Biomolecules. 2021;11 doi: 10.3390/biom11060894. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Chen X., Cubillos-Ruiz J.R. Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nat. Rev. Cancer. 2021;21:71–88. doi: 10.1038/s41568-020-00312-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Lee D., Hokinson D., Park S., Elvira R., Kusuma F., Lee J.M., Yun M., Lee S.G., Han J. ER Stress Induces Cell Cycle Arrest at the G2/M Phase Through eIF2alpha Phosphorylation and GADD45alpha. Int. J. Mol. Sci. 2019;20 doi: 10.3390/ijms20246309. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Mlynarczyk C., Fåhraeus R. Endoplasmic reticulum stress sensitizes cells to DNA damage-induced apoptosis through p53-dependent suppression of p21(CDKN1A) Nat. Commun. 2014;5:5067. doi: 10.1038/ncomms6067. [DOI] [PubMed] [Google Scholar]
57.David L., Martinez L., Xi Q., Kooshesh K.A., Zhang Y., Shah J.V., Maas R.L., Wu H. Piezo mechanosensory channels regulate centrosome integrity and mitotic entry. Proc. Natl. Acad. Sci. USA. 2023;120 doi: 10.1073/pnas.2213846120. [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Zhou B., Jiang P., Lu J., Xing C. Characterization of the Fluorescence Properties of 4-Dialkylaminochalcones and Investigation of the Cytotoxic Mechanism of Chalcones. Arch. Pharm. 2016;349:539–552. doi: 10.1002/ardp.201500434. [DOI] [PubMed] [Google Scholar]
59.Zhou B., Yu X., Zhuang C., Villalta P., Lin Y., Lu J., Xing C. Unambiguous Identification of beta-Tubulin as the Direct Cellular Target Responsible for the Cytotoxicity of Chalcone by Photoaffinity Labeling. ChemMedChem. 2016;11:1436–1445. doi: 10.1002/cmdc.201600150. [DOI] [PubMed] [Google Scholar]
60.Kim H.K., Lee H.Y., Riaz T.A., Bhattarai K.R., Chaudhary M., Ahn J.H., Jeong J., Kim H.R., Chae H.J. Chalcone suppresses tumor growth through NOX4-IRE1alpha sulfonation-RIDD-miR-23b axis. Redox Biol. 2021;40 doi: 10.1016/j.redox.2021.101853. [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Liu Z., Wang M., Huang R., Hu T., Jing Y., Huang X., Hu W., Cao G., Wang H. Novel Indole-Chalcone Derivative-Ligated Platinum(IV) Prodrugs Attenuate Cisplatin Resistance in Lung Cancer through ROS/ER Stress and Mitochondrial Dysfunction. J. Med. Chem. 2023;66:4868–4887. doi: 10.1021/acs.jmedchem.2c02036. [DOI] [PubMed] [Google Scholar]
62.Chou T.C. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol. Rev. 2006;58:621–681. doi: 10.1124/pr.58.3.10. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

[bib1] 1.Hirata A., Hosoi F., Miyagawa M., Ueda S.i., Naito S., Fujii T., Kuwano M., Ono M. HER2 overexpression increases sensitivity to gefitinib, an epidermal growth factor receptor tyrosine kinase inhibitor, through inhibition of HER2/HER3 heterodimer formation in lung cancer cells. Cancer Res. 2005;65:4253–4260. doi: 10.1158/0008-5472.CAN-04-2748. [DOI] [PubMed] [Google Scholar]

[bib2] 2.Phuchareon J., McCormick F., Eisele D.W., Tetsu O. EGFR inhibition evokes innate drug resistance in lung cancer cells by preventing Akt activity and thus inactivating Ets-1 function. Proc. Natl. Acad. Sci. USA. 2015;112:E3855–E3863. doi: 10.1073/pnas.1510733112. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib3] 3.Goel S., DeCristo M.J., Watt A.C., BrinJones H., Sceneay J., Li B.B., Khan N., Ubellacker J.M., Xie S., Metzger-Filho O., et al. CDK4/6 inhibition triggers anti-tumour immunity. Nature. 2017;548:471–475. doi: 10.1038/nature23465. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib4] 4.Yoshida A., Lee E.K., Diehl J.A. Induction of Therapeutic Senescence in Vemurafenib-Resistant Melanoma by Extended Inhibition of CDK4/6. Cancer Res. 2016;76:2990–3002. doi: 10.1158/0008-5472.CAN-15-2931. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib5] 5.Chew Y.M., Cross R.A. Taxol acts differently on different tubulin isotypes. Commun. Biol. 2023;6:946. doi: 10.1038/s42003-023-05306-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib6] 6.Khing T.M., Choi W.S., Kim D.M., Po W.W., Thein W., Shin C.Y., Sohn U.D. The effect of paclitaxel on apoptosis, autophagy and mitotic catastrophe in AGS cells. Sci. Rep. 2021;11 doi: 10.1038/s41598-021-02503-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib7] 7.Lau M.Y., Han H., Hu J., Ji C. Association of cyclin D and estrogen receptor alpha36 with hepatocellular adenomas of female mice under chronic endoplasmic reticulum stress. J. Gastroenterol. Hepatol. 2013;28:576–583. doi: 10.1111/jgh.12084. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib8] 8.Lindner P., Christensen S.B., Nissen P., Møller J.V., Engedal N. Cell death induced by the ER stressor thapsigargin involves death receptor 5, a non-autophagic function of MAP1LC3B, and distinct contributions from unfolded protein response components. Cell Commun. Signal. 2020;18:12. doi: 10.1186/s12964-019-0499-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib9] 9.Xu C., Bailly-Maitre B., Reed J.C. Endoplasmic reticulum stress: cell life and death decisions. J. Clin. Investig. 2005;115:2656–2664. doi: 10.1172/JCI26373. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib10] 10.Endo M. Calcium ion as a second messenger with special reference to excitation-contraction coupling. J. Pharmacol. Sci. 2006;100:519–524. doi: 10.1254/jphs.cpj06004x. [DOI] [PubMed] [Google Scholar]

[bib11] 11.Yu F., Hubrack S.Z., Chakraborty S., Sun L., Alcantara-Adap E., Kulkarni R., Billing A.M., Graumann J., Taylor C.W., Machaca K. Remodeling of ER-plasma membrane contact sites but not STIM1 phosphorylation inhibits Ca(2+) influx in mitosis. Proc. Natl. Acad. Sci. USA. 2019;116:10392–10401. doi: 10.1073/pnas.1821399116. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib12] 12.Chen Y.F., Chiu W.T., Chen Y.T., Lin P.Y., Huang H.J., Chou C.Y., Chang H.C., Tang M.J., Shen M.R. Calcium store sensor stromal-interaction molecule 1-dependent signaling plays an important role in cervical cancer growth, migration, and angiogenesis. Proc. Natl. Acad. Sci. USA. 2011;108:15225–15230. doi: 10.1073/pnas.1103315108. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib13] 13.Ding X., He Z., Zhou K., Cheng J., Yao H., Lu D., Cai R., Jin Y., Dong B., Xu Y., Wang Y. Essential role of TRPC6 channels in G2/M phase transition and development of human glioma. J. Natl. Cancer Inst. 2010;102:1052–1068. doi: 10.1093/jnci/djq217. [DOI] [PubMed] [Google Scholar]

[bib14] 14.Faouzi M., Hague F., Potier M., Ahidouch A., Sevestre H., Ouadid-Ahidouch H. Down-regulation of Orai3 arrests cell-cycle progression and induces apoptosis in breast cancer cells but not in normal breast epithelial cells. J. Cell. Physiol. 2011;226:542–551. doi: 10.1002/jcp.22363. [DOI] [PubMed] [Google Scholar]

[bib15] 15.Chen X., Li J., Zhang R., Zhang Y., Wang X., Leung E.L.H., Ma L., Wong V.K.W., Liu L., Neher E., Yu H. Suppression of PD-L1 release from small extracellular vesicles promotes systemic anti-tumor immunity by targeting ORAI1 calcium channels. J. Extracell. Vesicles. 2022;11 doi: 10.1002/jev2.12279. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib16] 16.Gudipaty S.A., Lindblom J., Loftus P.D., Redd M.J., Edes K., Davey C.F., Krishnegowda V., Rosenblatt J. Mechanical stretch triggers rapid epithelial cell division through Piezo1. Nature. 2017;543:118–121. doi: 10.1038/nature21407. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib17] 17.Jang S.H., Choi S.Y., Ryu P.D., Lee S.Y. Anti-proliferative effect of Kv1.3 blockers in A549 human lung adenocarcinoma in vitro and in vivo. Eur. J. Pharmacol. 2011;651:26–32. doi: 10.1016/j.ejphar.2010.10.066. [DOI] [PubMed] [Google Scholar]

[bib18] 18.Mahapatra D.K., Bharti S.K., Asati V. Anti-cancer chalcones: Structural and molecular target perspectives. Eur. J. Med. Chem. 2015;98:69–114. doi: 10.1016/j.ejmech.2015.05.004. [DOI] [PubMed] [Google Scholar]

[bib19] 19.Kwak A.W., Lee M.J., Lee M.H., Yoon G., Cho S.S., Chae J.I., Shim J.H. The 3-deoxysappanchalcone induces ROS-mediated apoptosis and cell cycle arrest via JNK/p38 MAPKs signaling pathway in human esophageal cancer cells. Phytomedicine. 2021;86 doi: 10.1016/j.phymed.2021.153564. [DOI] [PubMed] [Google Scholar]

[bib20] 20.Seo H.W., No H., Cheon H.J., Kim J.K. Sappanchalcone, a flavonoid isolated from Caesalpinia sappan L., induces caspase-dependent and AIF-dependent apoptosis in human colon cancer cells. Chem. Biol. Interact. 2020;327 doi: 10.1016/j.cbi.2020.109185. [DOI] [PubMed] [Google Scholar]

[bib21] 21.Zhang Q., Liu J.L., Qi X.M., Qi C.T., Yu Q. Inhibitory activities of Lignum Sappan extractives on growth and growth-related signaling of tumor cells. Chin. J. Nat. Med. 2014;12:607–612. doi: 10.1016/s1875-5364(14)60092-3. [DOI] [PubMed] [Google Scholar]

[bib22] 22.Draetta G., Luca F., Westendorf J., Brizuela L., Ruderman J., Beach D. Cdc2 protein kinase is complexed with both cyclin A and B: evidence for proteolytic inactivation of MPF. Cell. 1989;56:829–838. doi: 10.1016/0092-8674(89)90687-9. [DOI] [PubMed] [Google Scholar]

[bib23] 23.Kuo L.J., Yang L.X. Gamma-H2AX - a novel biomarker for DNA double-strand breaks. In Vivo. 2008;22:305–309. [PubMed] [Google Scholar]

[bib24] 24.Zhan Q., Antinore M.J., Wang X.W., Carrier F., Smith M.L., Harris C.C., Fornace A.J., Jr. Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 1999;18:2892–2900. doi: 10.1038/sj.onc.1202667. [DOI] [PubMed] [Google Scholar]

[bib25] 25.Zhao H., Jin S., Antinore M.J., Lung F.D., Fan F., Blanck P., Roller P., Fornace A.J., Jr., Zhan Q. The central region of Gadd45 is required for its interaction with p21/WAF1. Exp. Cell Res. 2000;258:92–100. doi: 10.1006/excr.2000.4906. [DOI] [PubMed] [Google Scholar]

[bib26] 26.Jin P., Feng X.D., Huang C.S., Li J., Wang H., Wang X.M., Li L., Ma L.Q. Oxidative stress and cellular senescence: Roles in tumor progression and therapeutic opportunities. Medcomm-Oncol. 2024;3 doi: 10.1002/mog2.70007. [DOI] [Google Scholar]

[bib27] 27.Peng P., Qin S., Li L., He Z., Li B., Nice E.C., Zhou L., Lei Y. Epigenetic remodeling under oxidative stress: Mechanisms driving tumor metastasis. Medcomm-Oncol. 2024;3 doi: 10.1002/mog2.70000. [DOI] [Google Scholar]

[bib28] 28.Cross B.C.S., Bond P.J., Sadowski P.G., Jha B.K., Zak J., Goodman J.M., Silverman R.H., Neubert T.A., Baxendale I.R., Ron D., Harding H.P. The molecular basis for selective inhibition of unconventional mRNA splicing by an IRE1-binding small molecule. Proc. Natl. Acad. Sci. USA. 2012;109:E869–E878. doi: 10.1073/pnas.1115623109. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib29] 29.Mahameed M., Wilhelm T., Darawshi O., Obiedat A., Tommy W.S., Chintha C., Schubert T., Samali A., Chevet E., Eriksson L.A., et al. The unfolded protein response modulators GSK2606414 and KIRA6 are potent KIT inhibitors. Cell Death Dis. 2019;10:300. doi: 10.1038/s41419-019-1523-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib30] 30.Gottlieb P.A., Sachs F. Piezo1: properties of a cation selective mechanical channel. Channels. 2012;6:214–219. doi: 10.4161/chan.21050. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib31] 31.Desplat A., Penalba V., Gros E., Parpaite T., Coste B., Delmas P. Piezo1-Pannexin1 complex couples force detection to ATP secretion in cholangiocytes. J. Gen. Physiol. 2021;153 doi: 10.1085/jgp.202112871. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib32] 32.Foot N., Henshall T., Kumar S. Ubiquitination and the Regulation of Membrane Proteins. Physiol. Rev. 2017;97:253–281. doi: 10.1152/physrev.00012.2016. [DOI] [PubMed] [Google Scholar]

[bib33] 33.Rajagopal S., Shenoy S.K. GPCR desensitization: Acute and prolonged phases. Cell. Signal. 2018;41:9–16. doi: 10.1016/j.cellsig.2017.01.024. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib34] 34.Krshnan L., van de Weijer M.L., Carvalho P. Endoplasmic Reticulum-Associated Protein Degradation. Cold Spring Harb. Perspect. Biol. 2022;14 doi: 10.1101/cshperspect.a041247. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib35] 35.Evans E.L., Cuthbertson K., Endesh N., Rode B., Blythe N.M., Hyman A.J., Hall S.J., Gaunt H.J., Ludlow M.J., Foster R., Beech D.J. Yoda1 analogue (Dooku1) which antagonizes Yoda1-evoked activation of Piezo1 and aortic relaxation. Br. J. Pharmacol. 2018;175:1744–1759. doi: 10.1111/bph.14188. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib36] 36.Qu J., Zong H.F., Shan Y., Zhang S.C., Guan W.P., Yang Y., Zhao H.L. Piezo1 suppression reduces demyelination after intracerebral hemorrhage. Neural Regen. Res. 2023;18:1750–1756. doi: 10.4103/1673-5374.361531. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib37] 37.Chen G., Zhu X., Li J., Zhang Y., Wang X., Zhang R., Qin X., Chen X., Wang J., Liao W., et al. Celastrol inhibits lung cancer growth by triggering histone acetylation and acting synergically with HDAC inhibitors. Pharmacol. Res. 2022;185 doi: 10.1016/j.phrs.2022.106487. [DOI] [PubMed] [Google Scholar]

[bib38] 38.Li J., Wu Z., Chen G., Wang X., Zhu X., Zhang Y., Zhang R., Wu W., Zhu Y., Ma L., Yu H. Formosanin C inhibits non-small-cell lung cancer progression by blocking MCT4/CD147-mediated lactate export. Phytomedicine. 2023;109 doi: 10.1016/j.phymed.2022.154618. [DOI] [PubMed] [Google Scholar]

[bib39] 39.Liao W., Zhang R., Chen G., Zhu X., Wu W., Chen Z., Jiang C., Lin Z., Ma L., Yu H. Berberine synergises with ferroptosis inducer sensitizing NSCLC to ferroptosis in p53-dependent SLC7A11-GPX4 pathway. Biomed. Pharmacother. 2024;176 doi: 10.1016/j.biopha.2024.116832. [DOI] [PubMed] [Google Scholar]

[bib40] 40.Zhou B., Xing C. Diverse Molecular Targets for Chalcones with Varied Bioactivities. Med. Chem. 2015;5:388–404. doi: 10.4172/2161-0444.1000291. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib41] 41.Zhuang C., Zhang W., Sheng C., Zhang W., Xing C., Miao Z. Chalcone: A Privileged Structure in Medicinal Chemistry. Chem. Rev. 2017;117:7762–7810. doi: 10.1021/acs.chemrev.7b00020. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib42] 42.Dinkova-Kostova A.T., Abeygunawardana C., Talalay P. Chemoprotective properties of phenylpropenoids, bis(benzylidene)cycloalkanones, and related Michael reaction acceptors: correlation of potencies as phase 2 enzyme inducers and radical scavengers. J. Med. Chem. 1998;41:5287–5296. doi: 10.1021/jm980424s. [DOI] [PubMed] [Google Scholar]

[bib43] 43.Dinkova-Kostova A.T., Massiah M.A., Bozak R.E., Hicks R.J., Talalay P. Potency of Michael reaction acceptors as inducers of enzymes that protect against carcinogenesis depends on their reactivity with sulfhydryl groups. Proc. Natl. Acad. Sci. USA. 2001;98:3404–3409. doi: 10.1073/pnas.051632198. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib44] 44.Srinivasan B., Johnson T.E., Lad R., Xing C. Structure-activity relationship studies of chalcone leading to 3-hydroxy-4,3',4',5'-tetramethoxychalcone and its analogues as potent nuclear factor kappaB inhibitors and their anticancer activities. J. Med. Chem. 2009;52:7228–7235. doi: 10.1021/jm901278z. [DOI] [PubMed] [Google Scholar]

[bib45] 45.Gan F.F., Kaminska K.K., Yang H., Liew C.Y., Leow P.C., So C.L., Tu L.N.L., Roy A., Yap C.W., Kang T.S., et al. Identification of Michael acceptor-centric pharmacophores with substituents that yield strong thioredoxin reductase inhibitory character correlated to antiproliferative activity. Antioxid. Redox Signal. 2013;19:1149–1165. doi: 10.1089/ars.2012.4909. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib46] 46.Wu J.Z., Cheng C.C., Shen L.L., Wang Z.K., Wu S.B., Li W.L., Chen S.H., Zhou R.P., Qiu P.H. Synthetic chalcones with potent antioxidant ability on H(2)O(2)-induced apoptosis in PC12 cells. Int. J. Mol. Sci. 2014;15:18525–18539. doi: 10.3390/ijms151018525. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib47] 47.Israf D.A., Khaizurin T.A., Syahida A., Lajis N.H., Khozirah S. Cardamonin inhibits COX and iNOS expression via inhibition of p65NF-kappaB nuclear translocation and Ikappa-B phosphorylation in RAW 264.7 macrophage cells. Mol. Immunol. 2007;44:673–679. doi: 10.1016/j.molimm.2006.04.025. [DOI] [PubMed] [Google Scholar]

[bib48] 48.Liang S.T., Chen C., Chen R.X., Li R., Chen W.L., Jiang G.H., Du L.L. Michael acceptor molecules in natural products and their mechanism of action. Front. Pharmacol. 2022;13 doi: 10.3389/fphar.2022.1033003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib49] 49.Fang J., Lu J., Holmgren A. Thioredoxin reductase is irreversibly modified by curcumin: a novel molecular mechanism for its anticancer activity. J. Biol. Chem. 2005;280:25284–25290. doi: 10.1074/jbc.M414645200. [DOI] [PubMed] [Google Scholar]

[bib50] 50.Lu J., Papp L.V., Fang J., Rodriguez-Nieto S., Zhivotovsky B., Holmgren A. Inhibition of Mammalian thioredoxin reductase by some flavonoids: implications for myricetin and quercetin anticancer activity. Cancer Res. 2006;66:4410–4418. doi: 10.1158/0008-5472.CAN-05-3310. [DOI] [PubMed] [Google Scholar]

[bib51] 51.Chew E.H., Nagle A.A., Zhang Y., Scarmagnani S., Palaniappan P., Bradshaw T.D., Holmgren A., Westwell A.D. Cinnamaldehydes inhibit thioredoxin reductase and induce Nrf2: potential candidates for cancer therapy and chemoprevention. Free Radic. Biol. Med. 2010;48:98–111. doi: 10.1016/j.freeradbiomed.2009.10.028. [DOI] [PubMed] [Google Scholar]

[bib52] 52.Dinkova-Kostova A.T., Holtzclaw W.D., Cole R.N., Itoh K., Wakabayashi N., Katoh Y., Yamamoto M., Talalay P. Direct evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc. Natl. Acad. Sci. USA. 2002;99:11908–11913. doi: 10.1073/pnas.172398899. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib53] 53.Ouyang Y., Li J., Chen X., Fu X., Sun S., Wu Q. Chalcone Derivatives: Role in Anticancer Therapy. Biomolecules. 2021;11 doi: 10.3390/biom11060894. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib54] 54.Chen X., Cubillos-Ruiz J.R. Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nat. Rev. Cancer. 2021;21:71–88. doi: 10.1038/s41568-020-00312-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib55] 55.Lee D., Hokinson D., Park S., Elvira R., Kusuma F., Lee J.M., Yun M., Lee S.G., Han J. ER Stress Induces Cell Cycle Arrest at the G2/M Phase Through eIF2alpha Phosphorylation and GADD45alpha. Int. J. Mol. Sci. 2019;20 doi: 10.3390/ijms20246309. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib56] 56.Mlynarczyk C., Fåhraeus R. Endoplasmic reticulum stress sensitizes cells to DNA damage-induced apoptosis through p53-dependent suppression of p21(CDKN1A) Nat. Commun. 2014;5:5067. doi: 10.1038/ncomms6067. [DOI] [PubMed] [Google Scholar]

[bib57] 57.David L., Martinez L., Xi Q., Kooshesh K.A., Zhang Y., Shah J.V., Maas R.L., Wu H. Piezo mechanosensory channels regulate centrosome integrity and mitotic entry. Proc. Natl. Acad. Sci. USA. 2023;120 doi: 10.1073/pnas.2213846120. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib58] 58.Zhou B., Jiang P., Lu J., Xing C. Characterization of the Fluorescence Properties of 4-Dialkylaminochalcones and Investigation of the Cytotoxic Mechanism of Chalcones. Arch. Pharm. 2016;349:539–552. doi: 10.1002/ardp.201500434. [DOI] [PubMed] [Google Scholar]

[bib59] 59.Zhou B., Yu X., Zhuang C., Villalta P., Lin Y., Lu J., Xing C. Unambiguous Identification of beta-Tubulin as the Direct Cellular Target Responsible for the Cytotoxicity of Chalcone by Photoaffinity Labeling. ChemMedChem. 2016;11:1436–1445. doi: 10.1002/cmdc.201600150. [DOI] [PubMed] [Google Scholar]

[bib60] 60.Kim H.K., Lee H.Y., Riaz T.A., Bhattarai K.R., Chaudhary M., Ahn J.H., Jeong J., Kim H.R., Chae H.J. Chalcone suppresses tumor growth through NOX4-IRE1alpha sulfonation-RIDD-miR-23b axis. Redox Biol. 2021;40 doi: 10.1016/j.redox.2021.101853. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib61] 61.Liu Z., Wang M., Huang R., Hu T., Jing Y., Huang X., Hu W., Cao G., Wang H. Novel Indole-Chalcone Derivative-Ligated Platinum(IV) Prodrugs Attenuate Cisplatin Resistance in Lung Cancer through ROS/ER Stress and Mitochondrial Dysfunction. J. Med. Chem. 2023;66:4868–4887. doi: 10.1021/acs.jmedchem.2c02036. [DOI] [PubMed] [Google Scholar]

[bib62] 62.Chou T.C. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol. Rev. 2006;58:621–681. doi: 10.1124/pr.58.3.10. [DOI] [PubMed] [Google Scholar]

PERMALINK

Sappanchalcone suppresses NSCLC by oxidative stress-driven DNA damage and ER stress activation through PIEZO1 modulation

Weiyu Wu

Ren Zhang

Geer Chen

Ziyu Chen

Zicong Lin

Yin Chen

Jiaqi Li

Weilin Liao

Junyi Wang

Xiaoxuan Wang

Junhao Huang

Lijuan Ma

Haijie Yu

Summary

Graphical abstract

Highlights

Introduction

Results

Screening of natural compounds and sappanchalcone selection

Figure 1.

Figure 2.

Sappanchalcone suppresses cellular proliferation via G2/M phase arrest and apoptosis induction

Figure 3.

Molecular pathways targeted by sappanchalcone: Cell cycle, reactive oxygen species, endoplasmic reticulum stress, and calcium signal

Figure 4.

Sappanchalcone triggers G2/M arrest by impairing the function of the Cyclin B-CDK1 complex

Figure 5.

Sappanchalcone induces reactive oxygen species accumulation

Figure 6.

Sappanchalcone triggers endoplasmic reticulum stress via the IRE1α and PERK pathway activation

Figure 7.

Calcium signaling blockade attenuates sappanchalcone induced effects

Figure 8.

PIEZO1 is important to sappanchalcone induced responses

Figure 9.

Discussion

Figure 10.

Limitations of the study

Resource availability

Lead contact

Materials availability

Data and code availability

Acknowledgments

Author contributions

Declaration of interests

STAR★Methods

Key resources table

Experimental model and study participant details

Cell lines and culture

Method details

Chemical reagents and compounds

High-throughput drug screening

Cell viability assay

Cell cycle measurement by flow cytometry

Cell apoptosis analysis by flow cytometry

Intracellular ROS measurement by flow cytometry

Transient transfection

Live cell fluorescence microscopy assay

RT-qPCR

Combination therapy assays

Protein immunoblot analysis

RNA transcription sequencing

Quantification and statistical analysis

Contributor Information

References

Associated Data

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases