Abstract
Background
Respiratory syncytial virus (RSV) is the primary cause of hospitalisation due to acute bronchiolitis and viral pneumonia in infants and young children. Recently, a maternal RSV vaccine (Pfizer's Abrysvo) has been approved to protect infants from birth up to 6 months of age. However, there is currently no vaccine or antiviral therapy against RSV for children aged >6 months. Therefore, there is an urgent need for novel antiviral therapies against RSV infection for young children.
Methods
We hypothesised that blocking a host protein called B-Raf kinase would inhibit RSV replication and protect airway epithelial cells against infection. We investigated the in vitro effects of dabrafenib, a US Food and Drug Administration-approved B-Raf kinase inhibitor, against RSV. Human airway epithelial cell lines and primary nasal epithelial cells were infected with RSV and treated with dabrafenib. Real-time PCR, plaque assay, quantitative mass spectrometry, ELISA and immunofluorescence were performed.
Results
Dabrafenib impaired RSV infection and replication (p=0.0003), while protecting cells against RSV-induced lytic cell death (p<0.0001). Proteomics and PCR analyses revealed that dabrafenib decreased the expression of the interferon-stimulated genes IFIT1 (p<0.0001) and ISG15 (p<0.0001) and corresponding proteins in airway epithelial cells. Therapeutic treatment with dabrafenib differentially modulated the release of type I and III interferons.
Conclusions
Collectively, our data indicate that B-Raf kinase is involved in RSV replication, interferon-stimulated gene induction, and type I and III interferon release in airway epithelial cells following infection. We propose that repurposing dabrafenib as a host-directed antiviral against RSV may be valuable in reducing disease pathogenesis associated with RSV infection.
Shareable abstract
Targeting B-Raf kinase using dabrafenib is an effective therapeutic strategy to combat RSV infection in human airway epithelial cells. B-Raf kinase blockade reduces RSV replication and modulates host interferon responses. https://bit.ly/43NMLJR
Introduction
Respiratory syncytial virus (RSV) is the most common cause of acute lower respiratory tract infection in infants and young children and is responsible for >3 million hospitalisations and up to 100 000 deaths annually, worldwide [1, 2]. RSV infection may lead to severe consequences, especially in infants born preterm or with high-risk medical conditions, such as bronchopulmonary dysplasia, congenital heart disease or chronic lung disease [3]. Furthermore, accumulating evidence suggests an association between severe RSV disease in early life and recurrent wheezing and asthma later in life [4–7]. While there have been important advances in prophylactic therapies for high-risk infants (e.g. extended half-life monoclonal antibodies) and a maternal RSV vaccine that aims to protect infants from birth up to 6 months of age, there are currently no RSV vaccines or effective antiviral therapies for young children. Therefore, clinical treatment of RSV infection is supportive only.
RSV primarily infects ciliated epithelial cells in the airways, being detected by different pattern recognition receptors (PRRs), such as retinoic acid-inducible gene-I and toll-like receptors. Activation of these PRRs by RSV proteins or RNA in the host cell triggers an early innate immune response mediated by the transcription factors NF-κB and interferon regulatory factors-3 and -7, which leads to an antiviral response mediated by type I and III interferons (IFNs) and IFN-stimulated gene (ISG) induction [8, 9]. Type I and III IFNs, and ISGs interfere with different stages of viral infection to control viral replication and promote clearance [8].
Antiviral therapeutics can target either viral proteins directly or host cell proteins. Targeting viral proteins like proteases and polymerases can increase the likelihood of the development of drug resistance. In contrast, targeting host cell proteins or factors involved in the virus life cycle reduces resistance development risks and could have broad antiviral activities for proteins or pathways commonly used by multiple viruses [10]. Several host cell pathways have been shown to be involved in viral replication, including nucleotide-binding oligomerisation domain containing 2, receptor-interacting protein kinase 2, PI3K/Akt, different isoforms of protein kinase C, and mitogen-activated protein kinase (MAPK) [11–13]. The Raf family of serine/threonine protein kinases mediate the MAPK signal transduction cascade (Raf-MEK-ERK) and is involved in the regulation of multiple important cell functions, such as proliferation, differentiation, survival and migration [14]. RSV promotes Raf kinase activation [15] and blockade of the downstream kinase extracellular signal-regulated kinase (ERK) inhibits the translocation of RSV fusion protein to the plasma membrane, hence impairing efficient viral replication [16]. Therefore, we hypothesise that blocking Raf kinase will inhibit RSV replication and protect airway epithelial cells against RSV infection. Here we studied the effects of a US Food and Drug Administration-approved small molecule kinase inhibitor that targets B-Raf kinase, dabrafenib [17], as a potential host-directed antiviral against RSV infection of airway epithelial cells.
Materials and methods
For all sections, further details are available in the supplementary material.
Reagents and media
Dabrafenib was purchased from Cell Signaling Technology and vemurafenib from Tocris Bioscience. Minimum essential medium was from Gibco. Fetal bovine serum and penicillin/streptomycin were from Wisent, Canada. Airway Epithelial Cell Basal Medium and Bronchial Epithelial Cell Growth Kit were from the American Type Culture Collection (ATCC). PneumaCult-Ex and PneumaCult-ALI media were from StemCell Technologies, Canada. Hoechst 33342, HALT protease and phosphatase inhibitor cocktail and BCA protein assay kit were from Thermo Fisher Scientific. Mammalian protein extraction reagent lysis solution was from Pierce.
Cell lines and virus preparation
Human adenocarcinoma alveolar epithelial cell line (A549; ATCC CCL-185), human epidermoid carcinoma cell line (HEp-2; ATCC CCL-23), and immortalised human bronchial epithelial cells (HBEC3-KT; ATCC CLR-4051) were obtained from ATCC.
The recombinant strain of RSV A2 expressing green fluorescent protein (rgRSV224; RSV-GFP) was kindly provided by Mark E. Peeples (Children's Research Institute, Columbus, OH, USA) and Peter L. Collins (National Institutes of Health, Bethesda, MD, USA).
RSV-GFP infection of A549 and HBEC3-KT cells
A549 and HBEC3-KT cells were seeded to black, flat, clear-bottom 96-well plates (3×104 cells per well) overnight. Then, cells were infected with RSV-GFP (multiplicity of infection (MOI) 0.5) for 2 h under frequent agitation. Dabrafenib treatment was performed either 24 h prior to infection (prophylactic), simultaneously with infection (simultaneous) or 24 h after infection (therapeutic). At 48 h post-infection, cells were imaged using the BioTek Cytation C10 confocal imaging reader and Gen5 software.
Participants
All participants were recruited at SickKids in Toronto under a local research ethics board-approved protocol (REB 1000061106). Participants’ median age was 21.6 years; they were not actively infected at the time of nasal cell collection; and had no documented upper or lower airway disease. All participants signed an informed consent form prior to nasal sample collection for primary nasal epithelial cell culture.
Well-differentiated human primary nasal epithelial cell culture and RSV-GFP infection
Human primary nasal epithelial cells (HNECs) were cultured as described previously [18], infected apically with RSV-GFP (MOI 0.5) and imaged at 24-h intervals until 72 h post-infection on an inverted epifluorescence microscope (Nikon TE-2000), using a Hamamatsu C4742-12AG camera and Perkin Elmer Volocity software.
Quantification of RSV mRNA expression by reverse transcriptase quantitative PCR
After RSV-GFP infection, buffer RLT (Qiagen) was added onto HNECs and incubated for 5 min at room temperature. Then, HNECs were scrapped and stored at −80°C. mRNA was purified using the RNeasy mini kit (Qiagen), following the manufacturer's instructions. The primers used are listed in table 1.
TABLE 1.
Primers used in this study
| Target gene | Primer sequences |
|---|---|
|
RNAse P
(reference gene) |
F: AGATTTGGACCTGCGAGCG R: GAGCGGCTGTCTCCACAAGT |
|
GUSB
(reference gene) |
F: GCCCATTATTCAGAGCGAGTA R: GTTTTTGATCCAGACCCAGATG |
|
TBP
(reference gene) |
F: GCTCTTTAACTTCGCTTCCG R: CAGCAACTTCCTCAATTCCTTG |
| RSV NS1 | F: AGAGATGGGCAGCAATTCAT R: ACTGGCATTGTTGTGAAATTGG |
| IFIT1 | F: AGAAGCAGGCAATCACAGAAAA R: CTGAAACCGACCATAGTGGAAAT |
| ISG15 | F: TGGTGAGGAATAACAAGGGC R: CAGATTCATGAACACGGTGC |
Quantification of infectious virus production
To quantify intracellular infectious virus, RSV-GFP-infected A549 cells treated with dabrafenib were harvested, and cell lysates and supernatants were inoculated onto HEp-2 cell monolayers. To quantify newly released infectious progeny virions, the supernatants of RSV-GFP-infected A549 or HBEC3-KT cells were collected, serially diluted and inoculated onto HEp-2 cell monolayers. Viral titre was expressed as plaque-forming units per mL (PFU·mL−1).
Cell viability assay
Cell viability was determined using the CyQUANT MTT Cell Proliferation Assay Kit (Invitrogen), following the manufacturer's instructions.
Measurement of lactate dehydrogenase release
Lactate dehydrogenase (LDH) release was measured using the CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega), following the manufacturer's instructions.
Quantitative mass spectrometry
A549 cells were treated with dabrafenib (75 µM) for 2 h and infected or not with RSV (MOI 5) for 24 h. Cell pellets were lysed using a probe sonicator. Cleared supernatants were used to determine protein concentrations (Thermo Scientific Pierce Detergent Compatible Bradford Assay Kit). Per sample, 40 µg of total protein was processed using single-pot solid-phase-enhanced sample preparation (SP3) [19]. A total of 160 µg of a 1:1 (v/v) mix of two types of carboxylate-modified SeraMag Speed beads (GE Life Sciences) was added to each sample. Samples were incubated on a tube rotator and placed on a magnetic rack. Then, the supernatants were discarded, and the pellets were rinsed with 70% ethanol and 100% acetonitrile. Beads were resuspended in TRIS supplemented with trypsin at an enzyme: protein ratio of 1:25 (w/w). Samples were digested and supernatants were transferred to clean tubes. Next, beads were sonicated, and supernatants were combined with their respective tubes from the previous step. Peptide concentrations were determined using Pierce Quantitative Fluorometric Peptide Assay (Fisher Scientific). Per sample, 300 ng were analysed in randomised order by liquid chromatography–tandem mass spectrometry using an EvoSep One. Raw data were analysed using DIA-NN 1.8.2 in two-pass mode and an A549 spectral library generated in-house using FragPipe, with a total of 301 204 precursors and 11 619 proteins. 10 010 protein groups were quantified and further filtered to retain high-quality data. The final list consisted of 7588 unique proteins, which on average had been quantified in 96% of the 12 samples, with a total of 7154 proteins quantified in all 12 samples (three each of mock, RSV alone, dabrafenib alone, and RSV+dabrafenib). The proteomic pathway analyses were performed using Ingenuity Pathway Analysis and gene set enrichment analysis software to generate top RSV-, dabrafenib- and RSV+dabrafenib-induced altered cellular networks, functions and canonical pathways.
Quantification of ISG expression by reverse transcriptase quantitative PCR
Reverse transcription and cDNA amplification were performed following the manufacturer's protocols. Total RNA was extracted using the Direct-zol RNA Miniprep (Zymo Research). cDNA from total RNA was synthesised utilising Superscript IV VILO mastermix (Thermo Fisher Scientific). One-step reverse transcriptase quantitative (q)PCR was performed using QuantStudio3 (Thermo Fisher Scientific), using specific primers (table 1) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). For computing the relative expression of the qPCR amplification data, we employed the 2−ΔCt method as described previously [20].
Type I and III interferon measurements
The concentrations of IFN-α, IFN-β (PBL Assay Science) and IFN-λ1 (IL-29) (Invitrogen) in A549 and HBEC3-KT cell supernatants were determined using ELISA, following the manufacturer's instructions.
Statistical analysis
Data are presented as mean±sem. All experiments were performed in triplicate and repeated at least twice. The results obtained were analysed using GraphPad Prism 10 statistical software package. Comparisons between multiple groups were analysed using one-way ANOVA and a post hoc Tukey, Sidak or Dunnett test. Comparisons between two groups were analysed using an unpaired t-test. The level of significance was set at p≤0.05.
Results
B-Raf kinase inhibition dose-dependently impairs RSV infection of A549 cells
To evaluate whether B-Raf kinase inhibition would affect RSV infection, A549 cells were infected with RSV-GFP and treated with increasing concentrations of dabrafenib (10, 25, 50, 75 or 100 µM) at 2 h post-infection. We observed a dose-dependent inhibition of RSV-GFP, with a half-maximal inhibitory concentration of 40.17 µM (figure 1a). We also measured the effect of dabrafenib on cell viability by MTT assay and we noticed no significant differences from baseline up to 100 µM (figure 1a). As dabrafenib is an anticancer drug and interferes with cell proliferation, we quantified cell numbers after RSV infection and dabrafenib treatment, which did not decrease cell numbers relative to RSV alone (figure 1b). After 48 h of infection, RSV decreased A549 cell numbers as these cells are highly permissive to RSV and die from the infection (figure 1b). Accordingly, dabrafenib protected A549 cells from RSV-induced death as measured by LDH release, a marker of cell membrane damage (figure 1c). To determine if different treatments with dabrafenib would influence viral infection, we treated A549 cells prophylactically (24 h prior to infection), simultaneously (together with infection) or therapeutically (24 h post-infection). All treatments significantly reduced RSV-GFP expression and infection rate (figure 1d–f). These results indicate that blocking B-Raf kinase with dabrafenib reduces RSV infection without affecting cell viability and protects A549 cells from RSV-induced death.
FIGURE 1.
B-Raf kinase inhibition dose-dependently impairs respiratory syncytial virus (RSV) infection of A549 cells. A549 cells (3×104 per well) were seeded in 96-well plates overnight. a) Cells were infected or not with RSV-green fluorescent protein (GFP) (multiplicity of infection (MOI) 0.5) for 2 h. Afterwards, cells were treated with different concentrations of dabrafenib (Dab) (10, 25, 50, 75 and 100 µM). Dose-dependent inhibition of infection by dabrafenib was observed in A549 cells 48 h post-infection (hpi) (shown in red). Cell viability was quantified using an MTT assay (shown in black). b) Cells were infected with RSV-GFP (MOI 0.5) and treated with dabrafenib (75 µM) at 24 hpi. At 48 hpi cells were fixed and labelled with Hoechst 33342 (1 μg·mL−1), and cell numbers were quantified. c) Cells were treated with dabrafenib (75 µM) for 1 h and infected with RSV-GFP for 6 h. Afterwards, cell death was assessed using a lactate dehydrogenase (LDH) release assay. d, e, f) Cells were treated with dabrafenib (75 µM) d) for 24 h before RSV-GFP infection, e) simultaneously or f) 24 h after RSV-GFP infection. At 48 hpi, cells were fixed and labelled with Hoechst 33342 (1 μg·mL−1). GFP signal was visualised by fluorescence microscopy, quantified as a read-out of RSV replication using ImageJ and expressed as corrected total fluorescence intensity. Infection rate was determined in A549 cells as the ratio of nuclei within the GFP-fluorescent area to total nuclei (100×(nucleiGFP/nucleiTotal)). Data are representative of at least two independent experiments performed in triplicate and are expressed as mean±sem. Data were analysed with b) one-way ANOVA with Tukey's post hoc test, and c) one-way ANOVA with Dunnett's post hoc test or d, e, f) unpaired t-test. ****: p<0.0001.
B-Raf kinase blockade inhibits the production of infectious progeny virions
After determining the antiviral effect of dabrafenib against RSV infection of A549 cells, we sought to understand whether dabrafenib would affect virus infectivity and the release of new infectious viral particles. To evaluate virus infectivity after dabrafenib treatment, we treated A549 cells with dabrafenib either prophylactically or therapeutically, and after 48 h of infection, we isolated RSV from cell lysates and supernatants, and added isolated virus onto HEp-2 cell monolayers, as these cells are highly susceptible to RSV infection [21]. We observed that both treatments significantly reduced virus infectivity in HEp-2 cells. Moreover, the therapeutic treatment decreased RSV infectivity by 92% compared to nontreated cells (figure 2a, b), suggesting that dabrafenib is effective even when infection is established. Next, we assessed whether dabrafenib would inhibit the release of new infectious virions. Therefore, RSV-infected A549 cells were therapeutically treated with dabrafenib, and 48 h after infection cell supernatants were collected, serially diluted, added onto HEp-2 cell monolayers and a traditional plaque assay was performed. Notably, dabrafenib caused a ∼100-fold decrease in RSV titres (figure 2c, d). These data suggest that the therapeutic treatment with dabrafenib substantially decreases RSV infectivity and the release of infectious progeny virions.
FIGURE 2.
B-Raf kinase blockade inhibits the production of infectious progeny virions. a) A549 cells (3×104 per well) were seeded in 96-well plates overnight. Cells were infected with respiratory syncytial virus (RSV)-green fluorescent protein (GFP) (multiplicity of infection (MOI) 0.5). Cells were treated either prophylactically (24 h before infection) or therapeutically (24 h after infection) with dabrafenib (Dab) (75 µM). At 48 h post-infection (hpi), cell lysates and supernatants were collected and used to infect HEp-2 cell monolayers. b) Infection rate was determined in HEp-2 cells after 48 h as the ratio of nuclei within the GFP-fluorescent area to total nuclei (100×(nucleiGFP/nucleiTotal)). c, d) A549 cells (3×104 per well) were seeded in 96-well plates overnight. Cells were then infected with RSV-GFP (MOI 0.5) and treated therapeutically with dabrafenib (75 µM). At 48 hpi, cell supernatants were collected and inoculated onto HEp-2 cell monolayers. c) GFP expression was visualised by fluorescence microscopy. Scale bar=2000 µm. d) RSV titre was determined by plaque assay and expressed as plaque-forming units (PFU)·mL−1. Data are representative of at least two independent experiments performed in triplicate and are expressed as mean±sem. Data were analysed using unpaired t-test, ****: p<0.0001, #: p=0.0001.
Pharmacological blockade of B-Raf kinase confers protection against RSV infection of human immortalised bronchial epithelial cells and primary nasal epithelial cells
To extend our findings to a more physiological setting, we utilised immortalised human bronchial epithelial cells (HBEC3-KT cells). We first tested the cytotoxic effects of dabrafenib on HBEC3-KT cells and observed a significant decrease in cell viability only at the highest concentrations tested (75 and 100 µM) (figure 3a). We confirmed these results by using a second method, Trypan Blue exclusion assay (supplementary figure S1a). Dabrafenib did not decrease HBEC3-KT cell numbers compared to RSV alone (figure 3b and supplementary figure S1c). As observed for A549 cells, dabrafenib treatment significantly reduced RSV infection rate (figure 3c) and viral load in HBEC3-KT cells (figure 3d). The effect of B-Raf inhibition on RSV infection was further verified with an additional drug, vemurafenib, which blocks B-Raf by selectively binding to the ATP-binding site of B-Raf kinase, therefore inhibiting its activity [22]. Vemurafenib significantly reduced cell viability at concentrations >5 µM (figure 3e and supplementary figure S1b). However, vemurafenib at 1 µM did not significantly decrease cell numbers compared to RSV alone (figure 3f and supplementary figure S1c). Similar to dabrafenib, vemurafenib was able to reduce both RSV infection rate and viral load in HBEC3-KT cells (figure 3g, h). These results indicate that B-Raf kinase activity is important for RSV infection and replication in physiologically relevant airway cell models.
FIGURE 3.
Pharmacological blockade of B-Raf kinase protects immortalised human bronchial epithelial cells against respiratory syncytial virus (RSV) infection. Immortalised human bronchial epithelial cells (HBEC3-KT) (3×104 per well) were seeded in 96-well plates overnight. a) Cells were treated with different concentrations of dabrafenib (Dab) (10, 25, 50, 75 and 100 µM) for 48 h. Cell viability was determined by MTT assay. b, c and d) Cells were infected with RSV-green fluorescent protein (GFP) (multiplicity of infection (MOI) 0.5) and treated with dabrafenib (50 µM) at 24 h post-infection (hpi). b and c) At 48 hpi, cells were fixed and labelled with Hoechst 33342 (1 μg·mL−1). b) Cell numbers and c) infection rate were quantified. d) At 48 hpi, cell lysates and supernatants were collected and inoculated onto HEp-2 cell monolayers. RSV titre was determined by plaque assay and expressed as plaque-forming units (PFU)·mL−1. e) Cells were treated with different concentrations of vemurafenib (Vem) (0.5, 1, 5, 10 and 25 µM) for 48 h. Cell viability was determined by MTT assay. f, g and h) Cells were infected with RSV-GFP (MOI 0.5) and at 24 hpi cells were treated with vemurafenib (1 µM). f and g) At 48 hpi, cells were fixed and labelled with Hoechst 33342 (1 μg·mL−1). f) Cell numbers and g) infection rates were quantified. h) At 48 hpi, cell lysates and supernatants were collected and inoculated onto HEp-2 cell monolayers. RSV titre was determined by plaque assay and expressed as plaque-forming units (PFU)·mL−1. The infection rate was defined as the ratio of nuclei within the GFP-fluorescent number to total nuclei (100×(nucleiGFP/nucleiTotal)). a, c, d, e, g, h) Data are representative of three independent experiments performed in triplicate and are expressed as mean±sem. b, f) Data are pooled from three independent experiments and are expressed as mean±sem. Each symbol represents the average of one independent experiment performed in triplicate. Data were analysed using a, e) one-way ANOVA with Dunnett's post hoc test, b, f) Sidak's post hoc test or c, d, g, h) unpaired t-test. ****: p<0.0001, #: p<0.02, ¶: p<0.008, +: p<0.0004.
Next, we sought to investigate the anti-RSV effects of B-Raf kinase inhibition using HNECs collected from healthy volunteer donors. These cells were grown in an air–liquid interface and allowed to differentiate to form a unique cell culture system that is highly representative of the human airway epithelium [23, 24]. RSV-infected HNECs were treated with dabrafenib and imaged at 24 h-intervals for 72 h. Dabrafenib treatment markedly reduced RSV-GFP expression in HNECs, and this reduction in GFP expression is noticeable at 48 and 72 hpi (figure 4a, b). We collected cells after 72 h of infection to further confirm these findings by accessing viral mRNA expression. Dabrafenib treatment showed a trend in decreasing RSV mRNA expression in HNECs, although not significant (figure 4c). We also measured the expression of the ISGs IFIT1 and ISG15 mRNA. Dabrafenib did not significantly change IFIT1 or ISG15 mRNA expression compared to RSV alone in HNECs (figure 4d, e). Altogether, these results suggest that B-Raf kinase blockade protects human bronchial and nasal epithelial cells against RSV infection.
FIGURE 4.
B-Raf kinase blockade confers protection against respiratory syncytial virus (RSV) infection in primary human nasal epithelial cells (HNECs). HNECs cultured in an air–liquid interface (ALI) were treated with dabrafenib (Dab) (75 µM) for 1 h, infected with RSV-green fluorescent protein (GFP) (multiplicity of infection (MOI) 0.5) and imaged at 24, 48 and 72 h post-infection (hpi). a) Shown are representative images of well-differentiated HNECs after RSV-GFP infection and dabrafenib treatment. GFP was visualised by fluorescence microscopy. b) Shown are fluorescence microscopy quantified as a read-out of RSV replication using ImageJ and expressed as corrected total fluorescence intensity. c) RSV mRNA expression after 72 hpi was determined using reverse transcriptase (RT)-quantitative (q)PCR. d and e) HBEC3-KT expression of IFIT1 and ISG15 was detected by RT-qPCR. The expression of interferon-stimulated genes was normalised to geometric means of reference genes (TBP and GUSB). Individual data points are presented and expressed as mean±sem. c, d, and e) n=5. Data were analysed using c, d, e) unpaired t-test or b) two-way ANOVA with Sidak's post hoc test. ****: p<0.0001.
RSV and dabrafenib both induce changes in the airway epithelial cell proteome
To better understand the mechanisms underlying the antiviral activity of dabrafenib, we compared the cellular proteomes of RSV-infected A549 cells treated or not with dabrafenib, using quantitative mass spectrometry. We applied numerous p-value and fold-change cut-offs, with and without multiple testing correction. We relatively quantified >7580 unique proteins, 745 of which were significantly altered at least two-fold by RSV (516 altered at least two-fold at p<0.001), 946 of which were significantly altered at least two-fold by dabrafenib (592 altered at least two-fold at p<0.001), and 1301 of which were significantly altered at least two-fold by RSV+dabrafenib (898 altered at least two-fold at p<0.001). Several proteins were either downregulated (shown in green) or upregulated (shown in red) by at least two-fold by RSV alone, dabrafenib alone or RSV+dabrafenib (figure 5a). Of the upregulated proteins, we observed the expression of proteins involved in antiviral responses, such as IFIT1, IFIT3 and ISG15, by both RSV infection and dabrafenib treatment (figure 5b). A pathway-focused analysis of RSV-infected cells treated with dabrafenib revealed that the drug differentially modulated proteins involved in antiviral and inflammatory responses, and cell death-related proteins (figure 5c–e). More specifically, dabrafenib attenuated the expression of IFIT1, ISG15 and IFIT3 compared to RSV alone (figure 5c). The drug also decreased the expression of MUC5B, a protein involved in mucus secretion (figure 5d). However, dabrafenib upregulated MUC13 expression (figure 5d), suggesting that there may be a compensatory mechanism at play in RSV-infected cells treated with dabrafenib. Interestingly, dabrafenib also attenuated the expression of mixed lineage kinase domain-like (MLKL) (figure 5e), a central protein involved in necroptosis [25, 26], a pro-inflammatory mode of cell death, which suggests that dabrafenib protects airway epithelial cells from RSV-induced death. We confirmed that increasing RSV infectious doses (MOI 0.5, 1, 5) trigger lytic cell death as measured by LDH release, with an MOI of 5 being the most effective in inducing cell death (supplementary figure S2).
FIGURE 5.
Respiratory syncytial virus (RSV) and dabrafenib (Dab) both induce changes in the airway epithelial cell proteome. A549 cells (1.8×106 per dish) were seeded in 60 mm dishes overnight. Then, cells were treated with dabrafenib (75 µM) for 2 h and infected or not with RSV-green fluorescent protein (GFP) (multiplicity of infection (MOI) 5) for 24 h. Proteomics analyses were performed using quantitative mass spectrometry. a) Volcano plots showing the upregulated and downregulated proteins. b) Pairwise comparisons of RSV versus RSV plus dabrafenib. The dashed horizontal and vertical lines and grey-shaded box depict a two-fold abundance change. c, d, e) Pathway-focused analysis of proteomic data. Shown are data of increased or decreased protein expression of at least two-fold change compared to mock. Values represent averages of three replicates and were analysed with one-way ANOVA with Tukey's post hoc test. *: p<0.05, ****: p<0.0001, *****: p<0.00001, #: p<0.0019.
Dabrafenib differentially regulates RSV-induced IFN responses in airway epithelial cells
Type I (IFN-α/β) and III (IFN-λ) IFNs are key inducers of antiviral responses and promote the expression of >600 genes, collectively referred to as ISGs [27]. Many ISGs encode proteins that protect the host against viral infection by directly blocking virus replication. As our proteomics data revealed that dabrafenib attenuated the expression of IFIT1, ISG15 and IFIT3 induced by RSV in A549 cells, we measured IFIT1 and ISG15 mRNA expression levels in A549 and HBEC3-KT cells. We observed a robust induction of both IFIT1 and ISG15 by RSV in A549 and HBEC3-KT cells (figure 6a, b). Interestingly, dabrafenib did not affect IFIT1 or ISG15 mRNA expression promoted by RSV in A549 cells (figure 6a). However, it did significantly attenuate RSV-triggered IFIT1 and ISG15 mRNA expression levels in HBEC3-KT cells (figure 6b), which is consistent with the reduced RSV viral loads observed after dabrafenib treatment. To confirm that ISG expression correlates with RSV viral loads in airway epithelial cells, we analysed both IFIT1 and ISG15 expression levels with respect to the RSV viral load and found a significantly positive correlation between the levels of IFIT1 mRNA and RSV viral load (p=0.0214) (figure 6c) and between ISG15 mRNA and RSV viral load (p=0.0036) in HBEC3-KT cells (figure 6d). We next sought to determine whether dabrafenib would affect the levels of type I and III IFNs secreted by RSV-infected airway epithelial cells. We found that RSV consistently induced high levels of IFN-β and IFN-λ1 secretion from A549 cells, but it induced minimal levels of IFN-α production from these cells (figure 6e). However, dabrafenib significantly decreased RSV-promoted IFN-β and IFN-λ1 release only, not interfering with the minimal IFN-α release induced by RSV (figure 6e). While RSV was not able to induce IFN-α production from HBEC3-KT cells, the virus triggered IFN-β and IFN-λ1 release from these cells (figure 6f) and dabrafenib significantly reduced these levels (figure 6f). Taken together, these data suggest that targeting B-Raf kinase using dabrafenib attenuates ISGs expression and type I and III IFN release induced by RSV infection in airway epithelial cells, probably resulting from lower viral burden after dabrafenib treatment.
FIGURE 6.
Dabrafenib differentially regulates respiratory syncytial virus (RSV)-induced interferon responses in airway epithelial cells. A549 and HBEC3-KT cells (2×105 per well) were seeded in 24-well plates overnight. a) A549 cells were infected with RSV-green fluorescent protein (GFP) (multiplicity of infection (MOI) 0.5), and at 24 h post-infection (hpi) cells were treated with dabrafenib (75 µM). RNA was extracted 48 hpi and the expression of IFIT1 and ISG15 in A549 cells was detected by reverse transcriptase (RT)-quantitative (q)PCR. The expression of ISG genes was normalised to reference gene expression (GUSB). b) HBEC3-KT cells were infected with RSV-GFP (MOI 0.5) and at 24 hpi cells were treated with dabrafenib (50 µM). HBEC3-KT expression of IFIT1 and ISG15 was detected by RT-qPCR. The expression of interferon-stimulated genes (ISG) was normalised to geometric means of reference genes (TBP and GUSB). c) Pearson linear correlation between HBEC3-KT IFIT1 relative expression and RSV titre. d) Pearson linear correlation between HBEC3-KT ISG15 relative expression and RSV titre. e, f) A549 and HBEC3-KT cells (3×104 per well) were seeded in 96-well plates overnight. Cells were infected with RSV-GFP (MOI 0.5) and at 24 hpi cells were treated with dabrafenib (A549-75 µM and HBEC3-KT-50 µM). Cell supernatants were collected at 48 hpi and the levels of INF-α, IFN-β and IFN-λ were measured using ELISA. Data are representative of two independent experiments performed in triplicate and are expressed as mean±sem. Data were analysed using one-way ANOVA with Tukey's post hoc test. *: p<0.05, ****: p<0.0001, #: p<0.003, ¶: p<0.0009.
Discussion
RSV is the leading cause of hospitalisation due to bronchiolitis and viral pneumonia in young children and has been associated with long-term respiratory sequelae, such as recurrent wheezing and asthma [1, 2, 4–7]. However, RSV can also cause severe disease in older adults and worsen symptoms of asthma and COPD [28]. Despite recent advances in RSV interventions, such as the preventive monoclonal antibody nirsevimab for high-risk infants, and two RSV vaccines targeting older adults and pregnant people aiming to protect their babies from birth through 6 months of age [29], there are currently no vaccines or antiviral therapies for children. In this study, we investigated the antiviral activity of dabrafenib, a B-Raf kinase inhibitor, against RSV infection. We demonstrate that dabrafenib is an effective antiviral against in vitro RSV infection of both upper and lower respiratory tract epithelial cells.
The Raf-MEK-ERK pathway, also known as the classical MAPK cascade [30], regulates important cellular processes under physiological conditions [14]. As such, several viruses hijack this pathway to boost viral replication [31]. Raf-MEK-ERK activation by RSV occurs in two waves. An early activation of ERK is induced by virion attachment and is necessary for early viral gene expression [32], whereas a late activation of ERK is required for the translocation of RSV fusion protein to the plasma membrane and efficient viral replication [16]. Our results corroborate these previous findings as we demonstrate that both the prophylactic (24 h before infection) and simultaneous (together with infection) treatments with dabrafenib significantly reduce RSV infection of A549 cells. Therefore, an early blockade of B-Raf kinase may interfere with virus entry and/or the early events of RSV infection. Importantly, the therapeutic treatment with dabrafenib, administered 24 h after infection, was also able to impair RSV infection in these cells. Treating the cells therapeutically with dabrafenib was particularly effective in inhibiting virus infectivity and the release of new infectious virions, suggesting that dabrafenib is effective even when infection is established. This would be especially important for the treatment of RSV infection in children and the elderly, as patients seek medical care after symptom onset.
As the Raf-MEK-ERK pathway regulates cell proliferation and survival [14], we sought to understand whether dabrafenib would interfere with cell proliferation during RSV infection. Dabrafenib treatment did not interfere with cell numbers relative to RSV alone, which has been shown to decrease A549 cell numbers later during infection, as these cells are very susceptible and die from the infection. In fact, dabrafenib protected A549 cells from RSV-induced lytic cell death, as measured by LDH release, a marker of cell membrane damage. Lytic cell death modes, such as necroptosis, are detrimental to the host during RSV infection [33, 34]. Collectively, these data indicate that dabrafenib impairs RSV infection while protecting airway epithelial cells from inflammatory death. Dabrafenib inhibition of RSV infection was further verified in two additional cell models of the human airway epithelium, using immortalised bronchial epithelial cells and primary nasal epithelial cells grown in an air–liquid interface. Dabrafenib substantially protected both human bronchial and nasal epithelial cells against RSV infection by markedly decreasing viral titres. Interestingly, dabrafenib has the potential to be used as a broad-spectrum antiviral therapy, as it also impairs Zika virus, influenza virus and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) replication [35–37]. Moreover, influenza virus and SARS-CoV-2 replication is dependent on Raf-MEK-ERK activation [38, 39]. In an attempt to confirm the anti-RSV effects of B-Raf kinase blockade, we utilised a second B-Raf inhibitor, vemurafenib, in human bronchial epithelial cells. Vemurafenib was also effective in impairing RSV infection and replication in those cells. Intriguingly, vemurafenib has been reported to limit influenza A virus infection of A549 cells [40] and rhinovirus infection of HeLa cells, but not RSV [41]. It is likely that distinct experimental conditions account for those differences in the results. In our setting, we used nontumour human bronchial epithelial cells, which are the primary target of RSV infection, and our data clearly show a potent RSV inhibition by vemurafenib. Therefore, targeting B-Raf kinase with dabrafenib and vemurafenib holds promise for treating a wide range of viral infections.
To further characterise the antiviral mechanisms of dabrafenib against RSV infection, we performed a proteomic analysis of A549 cell proteins that were significantly altered by either RSV infection alone or by RSV infection in combination with dabrafenib treatment. Our analysis revealed that dabrafenib significantly altered the A549 cell proteomic profile. Of interest to our approach of dabrafenib as an antiviral, we found that both RSV and dabrafenib induced the expression of proteins involved in antiviral responses, such as IFIT1, IFIT3 and ISG15. An in-depth pathway-focused analysis of RSV-infected cells treated with dabrafenib demonstrated that the drug decreased RSV-induced upregulation of MUC5B, a protein involved in mucus secretion. Mucus is an integral part of the pathophysiological processes in the airways because it protects the respiratory tract as a physical barrier to inhaled insults and pathogens. However, mucus hypersecretion is a prominent feature of RSV infection and can be detrimental to the host, causing airway obstruction and worsening inflammation [42, 43]. Although dabrafenib was able to attenuate MUC5B expression, it upregulated MUC13 expression, suggesting that there may be a compensatory mechanism at play in RSV-infected cells treated with dabrafenib. We also observed that dabrafenib reduced the expression of MLKL, a pore-forming protein involved in necroptosis [25, 26], reinforcing the protective effect of dabrafenib against RSV-induced airway epithelial cell death. RSV promotes airway epithelial cell necroptosis, which plays a critical role in disease pathogenesis [33]. The fact that dabrafenib impairs RSV replication while protecting airway epithelial cells from death indicates a potent antiviral activity along with an anti-inflammatory effect [44]. Our pathway-focused analysis also found that IFIT1, ISG15 and IFIT3 expression was induced after RSV infection of A549 cells and that dabrafenib attenuated RSV-triggered expression of these ISGs. ISGs levels are usually silent or expressed at low constitutive levels, and induction of ISGs expression is triggered by a wide range of viruses, including RSV [45, 46], corroborating our findings. We extended our proteomics data and measured ISGs expression levels in A549 and HBEC3-KT cells by reverse transcriptase-qPCR. RSV consistently induced a robust expression of IFIT1 and ISG15 in both A549 and HBEC3-KT cells. Interestingly, dabrafenib did not affect IFIT1 or ISG15 expression promoted by RSV in A549 cells, but it did significantly attenuate RSV-triggered IFIT1 and ISG15 upregulation in HBEC3-KT cells, which is consistent with the reduced RSV viral loads observed after dabrafenib treatment. The ISGs attenuation is likely due to the ability of dabrafenib to promote viral clearance in airway epithelial cells following RSV infection. Correspondingly, we found a strong positive correlation between the levels of IFIT1 and ISG15 with RSV viral loads in airway epithelial cells, indicating that the expression of these ISGs is most likely driven by RSV replication. ISGs expression levels have also been reported to be correlated with HIV viral load in patients before antiretroviral treatment and, upon treatment, ISGs expression levels are normalised [47, 48].
Type I and III IFNs are critical to the host antiviral response. They are produced by airway epithelial cells upon viral infection and induce the transcription of ISGs, which leads to an antiviral state in infected and bystander cells [49]. IFN-α is detected both systemically and in the respiratory tract in response to RSV infection in children [50]. However, IFN-λ1, not IFN-α or IFN-β, is the predominant IFN induced by RSV in human nasal epithelial cells [51]. Additionally, higher expression levels of IFN-λ1 are found in nasopharyngeal washes of children hospitalised for RSV bronchiolitis compared with those infected with other respiratory viruses [52]. This is consistent with our findings showing that RSV induced higher levels of IFN-λ1 in both A549 and HBEC3-KT cells, while inducing modest levels of IFN-β in both cell types and little to no IFN-α in these cells. While dabrafenib did not affect RSV-promoted IFN-α production in A549 cells, the drug reduced both IFN-β and IFN-λ1 secretion induced by RSV in these cells. Similarly, dabrafenib decreased IFN-β and IFN-λ1 levels triggered by RSV in HBEC3-KT cells. Recent studies have reported a protective role of IFN-λ during infection with different respiratory viruses in cell and animal models [53–56]. However, a prolonged exposure to IFN-α, IFN-β and IFN-λ inhibits airway epithelial cell proliferation and regeneration, disrupts lung barrier function and impairs recovery from viral infection [57, 58], suggesting that type I and III IFN responses must be tightly controlled during respiratory viral infections. In addition, higher IFN-λ1 levels are associated with disease severity in children hospitalised for RSV bronchiolitis [52]. Therefore, the fact that the therapeutic treatment with dabrafenib reduced RSV-induced IFN-β and IFN-λ1 production points to an additional protective effect of the drug by potentially limiting airway epithelial cell damage caused by RSV infection.
In conclusion, our data demonstrate that targeting B-Raf kinase using dabrafenib potently impairs in vitro RSV infection and replication in human lung epithelial cell lines and primary nasal epithelial cells. Dabrafenib also regulates the expression of proteins involved in inflammatory and antiviral responses, including MUC5B and ISGs. The ISGs attenuation by dabrafenib is likely due to its ability to promote viral clearance in airway epithelial cells following RSV infection. Finally, dabrafenib decreases IFN-β and IFN-λ1 levels triggered by RSV, which may potentially limit the adverse effects of type I and III IFNs upon chronic exposure during infection. We propose that repurposing dabrafenib as an antiviral therapy against RSV infection may prove valuable as an alternative therapeutic approach to reduce respiratory morbidity caused by this infection in infants and young children.
Limitations
In this study, we used the human adenocarcinoma alveolar epithelial cell line (A549) and the immortalised (nontumour) human bronchial epithelial cell line (HBEC3-KT); thus, the responses observed here might not fully reflect those of primary human bronchial epithelial cells, which are the main target of RSV. Additionally, HNECs were collected from five healthy volunteer donors. Lack of significance in our HNECs study is probably due to the relatively small donor sample number and an inherent biological variability in outcomes between donors. Therefore, a larger donor sample number may unveil a significant protective effect of dabrafenib against RSV infection of HNECs. In addition, in vivo models of RSV infection were not analysed at this point of the study. Future studies could address these limitations.
Acknowledgements
We thank Emanuelle F. da Silva (University of Manitoba, Winnipeg, MB, Canada) for technical assistance.
Footnotes
Provenance: Submitted article, peer reviewed.
Ethics statement: Study participants were recruited at the Hospital for Sick Children in Toronto, under local research ethics board-approved protocol REB 1000061106.
Author contributions: B.N. Porto and J.A. Cerato conceived and designed the study. J.A. Cerato, M. Serda and T. Olumade performed the experiments. J.A. Cerato analysed the data and wrote the manuscript. W. Duan, S. Thanikachalam and R. Salih performed experiments with human primary nasal epithelial cells. T.J. Moraes provided human primary nasal epithelial cells and intellectual input for the study and edited the manuscript. D.M. Santer contributed with RT-qPCR for interferon-stimulated genes, provided intellectual input for the study and edited the manuscript. M.I.R. Madlangsakay, R.P. Zahedi and K.M. Coombs performed the proteomics experiments, analysed proteomics data, provided intellectual input for the study and edited the manuscript. B.N. Porto and K.M. Coombs obtained funding for the study, provided overall supervision and edited the manuscript. All authors reviewed and approved the final manuscript.
Conflict of interest: J.A. Cerato was supported by a University of Manitoba Graduate Fellowship; M. Serda has nothing to disclose; T. Olumade was supported by a Research Manitoba PhD Studentship; W. Duan has nothing to disclose; S. Thanikachalam has nothing to disclose; R. Salih has nothing to disclose; M.I.R. Madlangsakay has nothing to disclose; T.J. Moraes has nothing to disclose; D.M. Santer was supported by funding from the University of Manitoba; R.P. Zahedi has nothing to disclose; K.M. Coombs was supported by funding from the Canadian Institutes of Health Research; B.N. Porto was supported by finding from the University of Manitoba and the Children's Hospital Research Institute of Manitoba.
Support statement: This study was supported by funding from the Children's Hospital Research Institute of Manitoba Operating Grant (grant number OG2023-24-04) and University of Manitoba Start-Up Funds (grant number 324636 to B.N. Porto; number 323955 to D.M. Santer), and a Canadian Institutes of Health Research Operating Grant (grant number VR3-172641) to K.M. Coombs. J.A. Cerato was supported by a University of Manitoba Graduate Fellowship and T. Olumade was supported by a Research Manitoba PhD Studentship. Funding information for this article has been deposited with the Crossref Funder Registry.
Supplementary material
Please note: supplementary material is not edited by the Editorial Office, and is uploaded as it has been supplied by the author.
Supplementary material
00307-2025.SUPPLEMENT
Data availability
All data generated or analysed during this study are included in this published article.
References
- 1.Li Y, Wang X, Blau DM, et al. Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in children younger than 5 years in 2019: a systematic analysis. Lancet 2022; 399: 2047–2064. doi: 10.1016/S0140-6736(22)00478-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Meissner HC. Viral bronchiolitis in children. N Engl J Med 2016; 374: 62–72. doi: 10.1056/NEJMra1413456 [DOI] [PubMed] [Google Scholar]
- 3.Servadio M, Finocchietti M, Vassallo C, et al. An epidemiological investigation of high-risk infants for respiratory syncytial virus infections: a retrospective cohort study. Ital J Pediatr 2024; 50: 56. doi: 10.1186/s13052-024-01627-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Binns E, Tuckerman J, Licciardi PV, et al. Respiratory syncytial virus, recurrent wheeze and asthma: a narrative review of pathophysiology, prevention and future directions. J Paediatr Child Health 2022; 58: 1741–1746. doi: 10.1111/jpc.16197 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Mohapatra SS, Boyapalle S. Epidemiologic, experimental, and clinical links between respiratory syncytial virus infection and asthma. Clin Microbiol Rev 2008; 21: 495–504. doi: 10.1128/CMR.00054-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Blanken MO, Rovers MM, Molenaar JM, et al. Respiratory syncytial virus and recurrent wheeze in healthy preterm infants. N Engl J Med 2013; 368: 1791–1799. doi: 10.1056/NEJMoa1211917 [DOI] [PubMed] [Google Scholar]
- 7.Moraes TJ, Sears MR. Lower respiratory infections in early life are linked to later asthma. Thorax 2018; 73: 105–106. doi: 10.1136/thoraxjnl-2017-211104 [DOI] [PubMed] [Google Scholar]
- 8.Martín-Vicente M, Resino S, Martínez I. Early innate immune response triggered by the human respiratory syncytial virus and its regulation by ubiquitination/deubiquitination processes. J Biomed Sci 2022; 29: 11. doi: 10.1186/s12929-022-00793-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Russell CD, Unger SA, Walton M, et al. The human immune response to respiratory syncytial virus infection. Clin Microbiol Rev 2017; 30: 481–502. doi: 10.1128/CMR.00090-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kaufmann SHE, Dorhoi A, Hotchkiss RS, et al. Host-directed therapies for bacterial and viral infections. Nat Rev Drug Discov 2018; 17: 35–56. doi: 10.1038/nrd.2017.162 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gaur P, Munjhal A, Lal SK. Influenza virus and cell signaling pathways. Med Sci Monit 2011; 17: RA148–RA154. doi: 10.12659/MSM.881801 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Limonta D, Dyna-Dagman L, Branton W, et al. Nodosome inhibition as a novel broad-spectrum antiviral strategy against arboviruses, enteroviruses, and SARS-CoV-2. Antimicrob Agents Chemother 2021; 65: e0049121. doi: 10.1128/AAC.00491-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Thomas KW, Monick MM, Staber JM, et al. Respiratory syncytial virus inhibits apoptosis and induces NF-κB activity through a phosphatidylinositol 3-kinase-dependent pathway. J Biol Chem 2002; 277: 492–501. doi: 10.1074/jbc.M108107200 [DOI] [PubMed] [Google Scholar]
- 14.Lavoie H, Therrien M. Regulation of RAF protein kinases in ERK signalling. Nat Rev Mol Cell Biol 2015; 16: 281–298. doi: 10.1038/nrm3979 [DOI] [PubMed] [Google Scholar]
- 15.Monick MM, Staber JM, Thomas KW, et al. Respiratory syncytial virus infection results in activation of multiple protein kinase C isoforms leading to activation of mitogen-activated protein kinase. J Immunol 2001; 166: 2681–2687. doi: 10.4049/JIMMUNOL.166.4.2681 [DOI] [PubMed] [Google Scholar]
- 16.Preugschas HF, Hrincius ER, Mewis C, et al. Late activation of the Raf/MEK/ERK pathway is required for translocation of the respiratory syncytial virus F protein to the plasma membrane and efficient viral replication. Cell Microbiol 2019; 21: e12955. doi: 10.1111/cmi.12955 [DOI] [PubMed] [Google Scholar]
- 17.Rheault TR, Stellwagen JC, Adjabeng GM, et al. Discovery of dabrafenib: a selective inhibitor of Raf kinases with antitumor activity against B-Raf-driven tumors. ACS Med Chem Lett 2013; 4: 358–362. doi: 10.1021/ml4000063 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Norris MJ, Malhi M, Duan W, et al. Targeting intracellular ion homeostasis for the control of respiratory syncytial virus. Am J Respir Cell Mol Biol 2018; 59: 733–744. doi: 10.1165/RCMB.2017-0345OC [DOI] [PubMed] [Google Scholar]
- 19.Hughes CS, Foehr S, Garfield DA, et al. Ultrasensitive proteome analysis using paramagnetic bead technology. Mol Syst Biol 2014; 10: 757. doi: 10.15252/MSB.20145625 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001; 25: 402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
- 21.Rajan A, Piedra F-A, Aideyan L, et al. Multiple respiratory syncytial virus (RSV) strains infecting HEp-2 and A549 cells reveal cell line-dependent differences in resistance to RSV infection. J Virol 2022; 96: e0190421. doi: 10.1128/jvi.01904-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Garbe C, Eigentler TK. Vemurafenib. In: Martens UM, ed. Small Molecules in Oncology. Cham, Springer, 2018; pp. 77–89. [Google Scholar]
- 23.Villenave R, Thavagnanam S, Sarlang S, et al. In vitro modeling of respiratory syncytial virus infection of pediatric bronchial epithelium, the primary target of infection in vivo. Proc Natl Acad Sci 2012; 109: 5040–5045. doi: 10.1073/pnas.1110203109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Terrance M, Gunawardena T, Ouyang H, et al. Primary human nasal epithelial cell culture. In: Mennella V, ed. Cilia: Methods and Protocols. New York, Springer Nature, 2024; pp. 213–223. [DOI] [PubMed] [Google Scholar]
- 25.Zhao J, Jitkaew S, Cai Z, et al. Mixed lineage kinase domain-like is a key receptor interacting protein 3 downstream component of TNF-induced necrosis. Proc Natl Acad Sci USA 2012; 109: 5322–5327. doi: 10.1073/PNAS.1200012109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sun L, Wang H, Wang Z, et al. Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase. Cell 2012; 148: 213–227. doi: 10.1016/J.CELL.2011.11.031 [DOI] [PubMed] [Google Scholar]
- 27.Schoggins JW, Wilson SJ, Panis M, et al. A diverse array of gene products are effectors of the type I interferon antiviral response. Nature 2011; 472: 481–485. doi: 10.1038/NATURE09907 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Coultas JA, Smyth R, Openshaw PJ. Respiratory syncytial virus (RSV): a scourge from infancy to old age. Thorax 2019; 74: 986–993. doi: 10.1136/thoraxjnl-2018-212212 [DOI] [PubMed] [Google Scholar]
- 29.Gatt D, Martin I, AlFouzan R, et al. Prevention and treatment strategies for respiratory syncytial virus (RSV). Pathogens 2023; 12: 154. doi: 10.3390/pathogens12020154 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Widmann C, Gibson S, Jarpe MB, et al. Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol Rev 1999; 79: 143–180. doi: 10.1152/physrev.1999.79.1.143 [DOI] [PubMed] [Google Scholar]
- 31.Pleschka S. RNA viruses and the mitogenic Raf/MEK/ERK signal transduction cascade. Biol Chem 2008; 389: 1273–1282. doi: 10.1515/BC.2008.145 [DOI] [PubMed] [Google Scholar]
- 32.Kong X, San Juan H, Behera A, et al. ERK-1/2 activity is required for efficient RSV infection. FEBS Lett 2004; 559: 33–38. doi: 10.1016/S0014-5793(04)00002-X [DOI] [PubMed] [Google Scholar]
- 33.Simpson J, Loh Z, Ullah MA, et al. Respiratory syncytial virus infection promotes necroptosis and HMGB1 release by airway epithelial cells. Am J Respir Crit Care Med 2020; 201: 1358–1371. doi: 10.1164/RCCM.201906-1149OC [DOI] [PubMed] [Google Scholar]
- 34.Santos LD, Antunes KH, Muraro SP, et al. TNF-mediated alveolar macrophage necroptosis drives disease pathogenesis during respiratory syncytial virus infection. Eur Respir J 2021; 57: 2003764. doi: 10.1183/13993003.03764-2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Wilken L, Rimmelzwaan GF, Elbahesh H. The Raf kinase inhibitors dabrafenib and regorafenib impair Zika virus replication via distinct mechanisms. J Virol 2024; 98: e0061824. doi: 10.1128/jvi.00618-24 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Meineke R, Stelz S, Busch M, et al. FDA-approved inhibitors of RTK/Raf signaling potently impair multiple steps of in vitro and ex vivo influenza A virus infections. Viruses 2022; 14: 2058. doi: 10.3390/v14092058 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Wan W, Zhu S, Li S, et al. High-throughput screening of an FDA-approved drug library identifies inhibitors against arenaviruses and SARS-CoV-2. ACS Infect Dis 2021; 7: 1409–1422. doi: 10.1021/acsinfecdis.0c00486 [DOI] [PubMed] [Google Scholar]
- 38.Hoffmann H, Ebensperger M, Schönsiegel A, et al. Influenza A virus replication has a stronger dependency on Raf/MEK/ERK signaling pathway activity than SARS-CoV-2. Front Cell Infect Microbiol 2023; 13: 1264983. doi: 10.3389/fcimb.2023.1264983 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Pleschka S, Wolff T, Ehrhardt C, et al. Influenza virus propagation is impaired by inhibition of the Raf/MEK/ERK signalling cascade. Nat Cell Biol 2001; 3: 301–305. doi: 10.1038/35060098 [DOI] [PubMed] [Google Scholar]
- 40.Holzberg M, Boergeling Y, Schräder T, et al. Vemurafenib limits influenza A virus propagation by targeting multiple signaling pathways. Front Microbiol 2017; 8: 2426. doi: 10.3389/fmicb.2017.02426 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Laajala M, Zwaagstra M, Martikainen M, et al. Vemurafenib inhibits acute and chronic enterovirus infection by affecting cellular kinase phosphatidylinositol 4-kinase type IIIβ. Microbiol Spectr 2023; 11: e0055223. doi: 10.1128/spectrum.00552-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Stokes KL, Currier MG, Sakamoto K, et al. The respiratory syncytial virus fusion protein and neutrophils mediate the airway mucin response to pathogenic respiratory syncytial virus infection. J Virol 2013; 87: 10070–10082. doi: 10.1128/JVI.01347-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Johnson JE, Gonzales RA, Olson SJ, et al. The histopathology of fatal untreated human respiratory syncytial virus infection. Mod Pathol 2007; 20: 108–119. doi: 10.1038/modpathol.3800725 [DOI] [PubMed] [Google Scholar]
- 44.Lee I-C, Kim J, Bae J-S. Anti-inflammatory effects of dabrafenib in vitro and in vivo. Can J Physiol Pharmacol 2017; 95: 697–707. doi: 10.1139/cjpp-2016-0519 [DOI] [PubMed] [Google Scholar]
- 45.Fensterl V, Sen GC. Interferon-induced Ifit proteins: their role in viral pathogenesis. J Virol 2015; 89: 2462–2468. doi: 10.1128/JVI.02744-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Perng Y-C, Lenschow DJ. ISG15 in antiviral immunity and beyond. Nat Rev Microbiol 2018; 16: 423–439. doi: 10.1038/s41579-018-0020-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.van Pul L, van Dort KA, Girigorie AF, et al. Human immunodeficiency virus-induced interferon-stimulated gene expression is associated with monocyte activation and predicts viral load. Open Forum Infect Dis 2024; 11: ofae434. doi: 10.1093/ofid/ofae434 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Scagnolari C, Monteleone K, Selvaggi C, et al. ISG15 expression correlates with HIV-1 viral load and with factors regulating T cell response. Immunobiology 2016; 221: 282–290. doi: 10.1016/j.imbio.2015.10.007 [DOI] [PubMed] [Google Scholar]
- 49.Mesev EV, LeDesma RA, Ploss A. Decoding type I and III interferon signalling during viral infection. Nat Microbiol 2019; 4: 914–924. doi: 10.1038/s41564-019-0421-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Nakayama T, Sonoda S, Urano T, et al. Detection of alpha-interferon in nasopharyngeal secretions and sera in children infected with respiratory syncytial virus. Pediatr Infect Dis J 1993; 12: 925–928. doi: 10.1097/00006454-199311000-00007 [DOI] [PubMed] [Google Scholar]
- 51.Okabayashi T, Kojima T, Masaki T, et al. Type-III interferon, not type-I, is the predominant interferon induced by respiratory viruses in nasal epithelial cells. Virus Res 2011; 160: 360–366. doi: 10.1016/j.virusres.2011.07.011 [DOI] [PubMed] [Google Scholar]
- 52.Selvaggi C, Pierangeli A, Fabiani M, et al. Interferon lambda 1–3 expression in infants hospitalized for RSV or HRV associated bronchiolitis. J Infect 2014; 68: 467–477. doi: 10.1016/j.jinf.2013.12.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Mallampalli RK, Adair J, Elhance A, et al. Interferon lambda signaling in macrophages is necessary for the antiviral response to influenza. Front Immunol 2021; 12: 735576. doi: 10.3389/fimmu.2021.735576 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Macht A, Huang Y, Reinert LS, et al. Mucosal IFNλ1 mRNA-based immunomodulation effectively reduces SARS-CoV-2 induced mortality in mice. EMBO Rep 2024; 25: 3777–3788. doi: 10.1038/s44319-024-00216-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Villenave R, Broadbent L, Douglas I, et al. Induction and antagonism of antiviral responses in respiratory syncytial virus-infected pediatric airway epithelium. J Virol 2015; 89: 12309–12318. doi: 10.1128/JVI.02119-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Dijkman R, Verma AK, Selvaraj M, et al. Effective interferon lambda treatment regimen to control lethal MERS-CoV infection in mice. J Virol 2022; 96: e0036422. doi: 10.1128/jvi.00364-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Major J, Crotta S, Llorian M, et al. Type I and III interferons disrupt lung epithelial repair during recovery from viral infection. Science 2020; 369: 712–717. doi: 10.1126/science.abc2061 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Broggi A, Ghosh S, Sposito B, et al. Type III interferons disrupt the lung epithelial barrier upon viral recognition. Science 2020; 369: 706–712. doi: 10.1126/science.abc3545 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Please note: supplementary material is not edited by the Editorial Office, and is uploaded as it has been supplied by the author.
Supplementary material
00307-2025.SUPPLEMENT
Data Availability Statement
All data generated or analysed during this study are included in this published article.






