Blockage of P2X7 receptor activation attenuated bone loss in ligature-induced model of periodontitis in rats

Abstract

Periodontitis is a highly prevalent immunoinflammatory disease that compromises the supporting tissues of the teeth, especially the periodontal ligament and alveolar bone. During disease progression, inflammatory responses lead to the release of ATP, which interacts with purinergic receptors such as P2X7R, potentially influencing bone remodeling. Although P2X7R has been studied in bone cells, its specific role in periodontitis remains poorly characterized. This study aimed to evaluate the effects of P2X7R modulation on osteoblastic activity and experimental bone loss. In vitro, P2X7R expression was confirmed in OFCOL II osteoblastic cells. Receptor activation using BzATP significantly reduced cell viability, altered cell morphology, and decreased alkaline phosphatase (ALP) activity (p < 0.05). In vivo, periodontitis was induced in Wistar rats via ligature. Animals were allocated into four groups: (1) Naïve; (2) Periodontitis (saline-treated); (3) BzATP-treated (P2X7R agonist); and (4) BBG-treated (P2X7R antagonist). BzATP aggravated periodontal damage, with increased inflammation, loss of osteoblasts, and disorganization of periodontal ligament fibers. In contrast, BBG improved tissue architecture, reduced inflammatory infiltrate, and increased osteoblast numbers and ALP activity, possibly via the Wnt signaling pathway. These results suggest that P2X7R activation contributes to inflammation-driven bone loss, impairing osteoblast viability and function. Therefore, P2X7R inhibition may serve as a promising pharmacological strategy to preserve bone and periodontal integrity in the context of periodontitis.

Introduction

Periodontal disease (PD) comprises a wide range of local inflammatory conditions that affect the supporting tissues of the teeth, with a complex and multifactorial etiology [1, 2]. PD, which includes gingivitis and periodontitis. This condition has a high incidence and it is considered the sixth most common disease in the world, also being related to the host systemic condition [3].

In the presence of a dysbiotic biofilm, the host response is one of the most important etiological factors in this condition [4]. The innate and adaptive immune responses work together, initially producing cytokines and chemokines, that leads to activation of macrophages and lymphocytes to combat microbial invasion. However, as the inflammatory process persists, tissue destruction and bone resorption events are observed [1].

Damaged cells release ATP into the extracellular environment. Extracellular ATP binds to purinergic receptors, mainly P2 × 7R, and lead to influx of calcium and efflux of potassium, assembly and activation of the NLRP3 inflammasome, activation of caspase-1, and cleavage and release of mature IL-1β and IL-18. ATP-P2X7 signaling also promotes chemotaxis and activation macrophages dendritic cells and neutrophils, together with differentiation and function of T cells into Th17 cells [5].

Considering the impact of inflammation on bone diseases, it has been reported that the P2X7 receptor contributes to osteoclast activation, particularly through modulation of the RANKL/OPG pathway [6]. Evidence also supports the involvement of P2X7 in inflammatory bone loss, such as that observed in rheumatoid arthritis and periodontitis [7, 8]. However, the role of P2X7 in periodontitis remains unclear, especially in animal model studies that integrate immune, histological, and molecular assessments of P2X7 expression within the periodontium, highlighting the necessity of this investigation.

In this context, this study aimed to investigate the role of the P2X7 receptor in the immune response and bone destruction in a ligature-induced periodontitis model, focusing on receptor expression, inflammatory cytokine levels, and its impact on the morphological structure of the alveolar bone. Understanding the role of P2X7R in periodontitis may offer new therapeutic perspectives within the field of osteoimmunology, with potential clinical applications in the management of periodontal bone loss.

Materials and methods

Study design and ethical aspects

This study is a prospective, randomized, controlled, and blinded investigation using rat models subjected to periodontitis. All experimental protocols were reviewed and approved by the Animal Use Ethics Committee (CEUA) at the Federal University of Ceará (UFC). Surgical procedures and animal treatments were conducted in compliance with the Ethical Principles for Animal Research. The experiments adhered to the ARRIVE guidelines and checklist. This proposal received approval from the CEUA of the UFC School of Medicine (protocol # 6,388,251,022).

In Vitro assays

Osteoblast culture

A murine osteoblast cell line (OFCOL II), obtained from the cell bank of the Federal University of Rio de Janeiro (UFRJ), was used. The cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. Cells were maintained in an incubator at 37 °C with 5% CO₂. Cell growth was monitored daily using an inverted light microscope (Nikon Eclipse TS100). Medium changes were performed according to cellular metabolism.

Cell viability test by direct method (MTT)

Mitochondrial function was quantitatively assessed through the reduction of the tetrazolium salt MTT (3-(4,5-dimethylthiazol-2-yl)−2,5-diphenyl tetrazolium bromide; Sigma) into formazan crystals. For this assay, 1.3 × 10³ cells per well were plated in 96-well culture plates containing 100 μL of supplemented culture medium, and the groups were divided as follows: 100 μM and 50 μM of BzATP and 10 μM of BBG, maintained in an incubator for 72 h. After this period, 20 μL per well of MTT (Sigma Aldrich) diluted in PBS at a concentration of 5 mg/mL was added. MTT was incubated for 4 h under ideal conditions. Then, the contents of each well were removed and 100 μL of DMSO was added per well, followed by shaking for 30 s to solubilize the formazan crystals. The solution was aspirated and transferred to a new 96-well plate, and absorbance readings were taken using a spectrophotometer (Biotek) at a wavelength of 590 nm [9].

Alkaline Phosphatase (ALP) assay

Samples were collected after 72 h from all study groups using a commercial kit for this purpose, following the manufacturer’s instructions (DiaSys, Germany). The method is based on the heat-induced modification of the alkaline phosphatase isoform. Samples were incubated in a water bath at 56 °C for 10 min and then transferred to an ice bath. The activity of non-bone (heat-stable) alkaline phosphatase was measured directly in a spectrophotometer at 30 °C, with absorbance readings taken at 405 nm, using p-nitrophenyl phosphate as the substrate. The bone-specific fraction was indirectly calculated by subtracting the activity of heat-stable alkaline phosphatase from the total alkaline phosphatase activity [10].

Immunocytochemistry for P2X7R in cell culture

Cells grown on coverslips were fixed with ice-cold methanol for 10 min at room temperature and rinsed three times with EnVision™ FLEX Wash Buffer (Dako). Permeabilization was performed with 0.1% Triton X-100 in PBS for 10 min, followed by additional PBS washes. Peroxidase blocking was performed for 20 min using EnVision™ FLEX Peroxidase-Blocking Reagent. Non-specific binding was blocked with 1% Bovine Serum Albumin (BSA) solution in Phosphate-Buffered Saline (PBS) for 1 h at room temperature.

Cells were then incubated overnight at 4 °C with primary antibodies against P2X7R (dilution 1:400 in 1% Bovine Serum Albumin/Phosphate-Buffered Saline). The following day, cells were rinsed with wash buffer and incubated with the HRP-conjugated polymer detection system (EnVision FLEX/HRP; Dako) for 30 min at room temperature. After washing, chromogenic detection was carried out using DAB solution (EnVision FLEX DAB + Chromogen; Dako) for 1–2 min, followed by rinsing with distilled water.

Counterstaining was performed with Mayer’s hematoxylin for 10 s, and the coverslips were mounted onto glass slides using aqueous mounting medium. Stained samples were then examined under a light microscope.

Study design

Twelve-week-old Wistar rats (Rattus norvegicus), weighing approximately 200 g and with normal physiological status, were selected as study units. The animals were housed in appropriate cages (3 animals per cage) at the Porangabussu Sectoral Animal Facility. They were provided with balanced commercial food and water ad libitum and maintained under standardized environmental conditions with 12-h light/dark cycles and a room temperature of 22 °C throughout the experiment, including a one-week acclimation period. The study was initiated only after the UFC institutional ethics committee approval (#6,388,251,022).

The sample size was determined based on previous studies that evaluated similar biological outcomes in rat models, considering a statistical power of 80% (β = 0.2) and a significance level of 5% (α = 0.05). An effect size of 1.5 was assumed, based on expected differences in the primary outcome (alveolar bone loss) between experimental groups. Using these parameters and a one-way ANOVA model, a minimum of 6 animals per group was calculated to be sufficient to detect statistically significant differences.

Forty-eight rats were initially randomized, into four groups (n = 6 per group) as follows: Naive Group consisted of normal rats without any intervention or treatment; Experimental Periodontitis Group (EP) included rats, previously anesthetized with Ketamin and xylanzin, subjected to a ligature-induced periodontitis model and treated with 0.9% saline solution (2 ml via intraperitoneal injection); BzATP Group comprised rats subjected to periodontitis and treated with 2′(3′)-O-(4-benzoylbenzoyl) adenosine 5′-triphosphate (BzATP) (Sigma-Aldrich, Italy), a P2X7R agonist (1 mg/kg/day via intraperitoneal injection), administered one hour prior to ligature placement and daily for 11 days until euthanasia [11].; and BBG Group consisted of rats subjected to periodontitis and treated with Brilliant Blue G (BBG), a P2X7R antagonist (45.5 mg/kg via intraperitoneal injection), administered one hour before ligature placement and every 48 h for 11 days until euthanasia [12]. Euthanasia was conducted on day 11, by administering an overdose of anesthetics (Ketamine 240 mg/kg and Xylazine 30 mg/kg via i.p.) [13].

Exclusion criteria included the presence of pre-existing conditions, weight loss exceeding 20% during the study, failure to recover from anesthesia, or any procedural complications that could compromise the experimental outcomes. Any animal meeting exclusion criteria was humanely euthanized, and data from such cases were not included in the final analysis. In this experiment we had no exclusions or unexpected adverse effects.

In order to reduce potential confounding variables, animals were randomly assigned to experimental groups using a computer-generated randomization list. All procedures were conducted at the same time of day to minimize circadian variation. The order of treatments and outcome measurements was balanced across groups to prevent systematic bias. Cage placement within the animal facility was also randomized and rotated weekly to avoid location-related effects such as differential light, temperature, or handler exposure. Investigators performing data collection and analysis were blinded to the group allocation.

Periodontitis model

Experimental Periodontitis (EP) was induced by the placement of a 3.0 nylon suture around the left second upper molar under anesthesia (80 mg/kg Ketamine and 10 mg/kg Xylazine, administered intraperitoneally) [13]. Following, a surgical knot was performed facing the buccal surface of the tooth. The right hemimaxilla served as the control. The outcome measures assessed were: alveolar bone loss, and bone microarquitecture and histology, quantification of alkaline phosphatase, inflammatory cytokine, gene expression of GSk3b.

Micro-CT analysis of the maxilla

The maxillae of 18 animals were scanned using a MILabs micro-CT (U-CT da MILabs B. V.) and the MILabs Reconstruction software. The data were then analyzed from the three-dimensional model using the Imalytics Pre-clinical software (version 3.1.1). Quantitative morphometric indices based on three-dimensional morphometry, as determined by the micro-CT data, were assessed. These included: bone volume (BV), total tissue volume (TV), BV/TV, trabecular surface area (BS), Bone mineral density (BMD), trabecular number (Tb.N), trabecular thickness (Tb.Th), and trabecular separation (Tb.Sp), all measured in the furcation region. Data are given in mean ± SEM.

Histological analysis of bone tissue

After euthanasia, jaws of 24 animals were removed, fixed in 10% buffered formalin for 48 h, and then demineralized with 10% buffered EDTA for approximately 30 days. The specimens were embedded in paraffin to create paraffin blocks, from which 4 μm serial sections were prepared for Hematoxylin and Eosin (H&E) staining. For analysis, the region between the first and second molars was examined, focusing on inflammatory aspects such as the presence and intensity of cellular infiltrate, as well as the preservation state of the alveolar process and cementum. Scores ranging from 0 to 3 were assigned [14]: 0—absence or minimal inflammatory infiltrate (restricted to the marginal gingival region), with preservation of the cementum and alveolar process; 1—moderate cellular infiltrate with slight resorption of the alveolar process and intact cementum; 2—marked cellular infiltrate (extending to the gingiva and periodontal ligament), moderate degradation of the alveolar process, and partial destruction of the cementum; 3—severe cellular infiltrate, complete resorption of the alveolar process, and extensive destruction of the cement. Data are given in median(range).

Analysis of periodontal ligament collagen

The previously prepared paraffin blocks were sectioned at a thickness of 2 µm and stained with Picrosirius Red solution (ScyTek®, Logan, UT, USA). Slides were analyzed using polarized light microscopy, and images were captured at 400 × magnification. A qualitative assessment of birefringence patterns was performed using ImageJ® software, identifying red–orange tones, which indicate thicker, well-formed collagen, and green-yellow tones, which indicate thinner, less organized collagen [15]. Data are presented as mean percentage ± SEM.

Additionally, HE-stained slides were evaluated using a fluorescence microscope (Olympus FV1000, Olympus, Tokyo, Japan) to analyze the presence and organization of collagen fibers in the periodontal ligament based on autofluorescence properties. A 488 nm laser and a green FITC-fluorescence emission channel were used to observe the region between the first and second upper left molars at 400 × magnification [16].

Histomorphometric analysis of bone tissue

H&E-stained slides were used to count osteoblasts (N.Ob/B.Pm.) and osteoclasts (N.Oc/B.Pm.) along the bone perimeter, following international standards with ImageJ® [13, 17]. Cells classified as osteoblasts were cuboidal or linear with a single nucleus and located on the bone matrix, whereas osteoclasts were identified as large multinucleated cells (containing at least three nuclei) on the bone matrix. Data are given in mean ± SEM.

Serum measurement of Bone Alkaline Phosphatase (BALP)

Blood samples were collected from 24 animals at euthanasia (day 11) by tail vein puncture to assess the bone isoform of alkaline phosphatase (BAP) using the thermoactivation method. Samples were heated to 56 °C for 10 min, and serum BAP levels were determined by measuring the difference in total alkaline phosphatase levels [10, 18] (Labtest, Lagoa Santa-MG, Brazil). Data are presented as mean ± SEM.

Inflammatory Cytokine quantification (TNF and IL-1)

In a separate set of experiments, gingival tissue around the maxillary molars, from 24 animals, was excised on the 11th day after PE induction. The tissue was homogenized in RIPA Lysis Buffer (Santa Cruz Biotechnology, USA) and centrifuged at 10,000 rpm for 15 min at 4 °C. The supernatants were then stored at −80 °C to assess TNF levels. TNF and IL-1 concentrations were measured by ELISA (R&D Systems® Parameter) according to the manufacturer's protocol. Absorbance was read at 450 nm, and results were expressed as mean of picograms per milliliter (pg/ml) ± SEM.

mRNA expression of GSK3b

In the third set of experiments, after euthanasia, the left hemimaxillae, of 24 animals, were collected, the gingival tissue removed and the bone tissue was macerated in liquid nitrogen using Trizol (Thermo Fischer-Waltham, Massachusetts, USA). The extracted mRNA was quantified using Nanodrop (Thermo Fischer-Waltham, Massachusetts, USA) and then transcribed using Superscript II (Invitrogen). Subsequently, the RT-PCR assay was carried out using SYBRgreen as a reference (ABI 7500 Fast; Applied Biosystems). The PCR condition was 50 °C for 2 min and 90 °C for 10 min, then 40 cycles at 95 °C for 15 s and 60 °C for 1 min, where the RT-PCR system at 7900HT from Applied Biosystems. To calculate the results obtained, the threshold cycle method (10) was used, where they were presented as gene expression related to beta-actin. Primer sequences were as following: ß-actin s: TGAGCTGACCAGTTCCCTCT; ß-actin as: AAGCTCGCTCCTGTGAGTTC; GSK-3b s: AGAAGAGCCATCATGTCGGG; GSK-3b as: CCAAAAGCTGAAGGCTGCTG. Data are given in mean ± SEM.

Statistical analysis

Prior to statistical analysis, data were evaluated to ensure they met the assumptions required for parametric testing. Normality of distribution was assessed using the Shapiro–Wilk test, and homogeneity of variances was evaluated with Levene’s test. When these assumptions were met, parametric tests such ANOVA followed by Tukey's test was used and data are presented as mean ± standard error of the mean (SEM). If the data violated assumptions of normality or homoscedasticity, a non-parametric test Kruskal–Wallis test followed by Dunn’s test was applied, and data are presented as mean (range). A significance level of 5% was set for all tests. Calculations were performed using Prism software (GraphPad Software Inc., San Diego, CA, USA). All protocols and analyses were conducted by a calibrated examiner blinded to group assignments.

Results

P2X7R blockade does not reduce osteoblast proliferation or morphology In Vitro

Figure 1C shows that the OFCOL II osteoblast cell line expresses P2X7R. Analyzing the effect of P2X7R modulators in vitro, it was observed that P2X7 receptor blockade mediated by BBG at 10 µM did not alter cell viability (Fig. 1A) and preserved osteoblast morphology (Figs. 1A and 1B). Activation of the receptor using low doses of BzATP (50 µM) also did not change osteoblast viability (Fig. 1B) or morphology (Figs. 1B and 1 C) compared to control. However, the use of high doses of BzATP (100 µM) significantly reduced cell viability and altered osteoblast morphology when compared to the control (Figs. 1A and 1B). It was seen a significant difference between cell viability comparing BzATP at 100 µM and BBG at 10 µM groups (Fig. 1A).

Fig. 1.

P2X7R Blockade Does Not Affect Osteoblasts. A Cell viability analysis (MTT) of osteoblasts after 72 h; B Well images after the experimental period, stained with crystal violet and observed under an inverted light microscope; C P2X7R expression in OFCOL II cells; D Alkaline phosphatase quantification; E Quantification of mineralized nodules; F Density of GSK3β immunostaining; G Photomicrograph of immunocytochemistry for GSK3β in osteoblasts. Magnification: 200 ×. Bars represent mean ± SEM. ANOVA and Tukey’s test. *Significant difference compared to the control group. #Significant difference compared to BzATP (100 µM) (p < 0.05)

The use of BBG did not impact alkaline phosphatase (ALP) levels in osteoblast cultures. BzATP at low doses (50 µM) did not change ALP levels compared to the control. However, BzATP at 100 µM significantly reduced ALP levels compared to the control (Fig. 1D). P2X7R modulators reduced the formation of calcification nodules in osteoblast cultures (Fig. 1E).

Analyzing GSK3β immunostaining, it was observed that BzATP at 100 µM maintained high expression of this component, which negatively regulates the WNT pathway, whereas BBG was able to reduce GSK3β expression. This suggests activation of the WNT pathway and osteoblast activation, confirming the ALP findings.

P2X7R blockade protects bone tissue architecture in experimental periodontitis

Figure 2 confirms the effect of P2X7R modulators on the periodontal ligament of animals subjected to periodontitis, where BzATP, a P2X7R agonist, increased its expression by 78%, while BBG, a P2X7R antagonist, reduced the intensity of its expression by 50% in the periodontal ligament during periodontitis.

Fig. 2.

BBG reduces P2X7R Expression in the Periodontal Ligament during periodontitis. A P2X7R expression in the periodontal ligament; B Adjusted density of P2X7R expression in the periodontal ligament. Magnifications: 100 × and 400 ×. Bars represent mean ± SEM (n = 6). ANOVA and Tukey’s test. *Significant difference compared to the control. #Significant difference compared to BzATP (p < 0.05)

Analyzing the alveolar bone subjected to periodontitis, P2X7R activation increased alveolar bone loss (ABL) by 16%, while receptor blockade reduced ABL by 18% compared to the periodontitis group (PE) (Figs. 3A and 3B). The use of BBG increased bone volume by 39% (Fig. 3C) and bone mineral density by 23% (Fig. 3D) (p < 0.05), supported by a reduction of 33% in trabecular spacing (Fig. 3G) and an increase of 25% in trabecular number (Fig. 3H). There were no differences in bone surface (Fig. 3E) or trabecular thickness (Fig. 3F) after BBG treatment compared to EP. The difference in bone surface was significant comparing BzATP and BBG groups (Fig. 3C).

Fig. 3.

P2X7R Blockade Protects Bone Architecture. A Alveolar bone loss (mm²); B 3D reconstruction of hemimaxillae; C Bone volume/total volume (BV/TV); D Bone mineral density (BMD); E Bone surface (BS); (F) Trabecular thickness (Tb.Th); (G) Trabecular spacing (Tb.Sp.); (H) Trabecular number (Tb.N.). Bars represent mean ± SEM, n = 6/group. ANOVA and Tukey’s test. *Significant difference compared to control. #Significant difference compared to BzATP (p < 0.05)

P2X7R blockade stimulates osteoblasts in experimental periodontitis

Micro-CT data corroborate the histomorphometric findings, showing that P2X7R blockade in animals subjected to experimental periodontitis (EP) increased osteoblast count by 26% (Fig. 4A and 4D) while significantly reducing osteoclast number by 79% (Fig. 4C and 4D). The increase in osteoblast number was accompanied by enhanced function, as indicated by a 92% increase in serum bone alkaline phosphatase levels (Fig. 4B).

Fig. 4.

P2X7R Blockade Stimulates Osteoblasts. A Number of osteoblasts/bone perimeter (N.Ob/B.Pm.); B Serum levels of bone alkaline phosphatase (BALP) (U/L); C Number of osteoclasts/bone perimeter (N.Oc/B.Pm.) (D) Histological aspect of the periodontium, shown by the presence of osteoblasts (arrow and black square) and osteoclasts (arrow and yellow square). Bars represent mean ± SEM, n = 6/group. ANOVA and Tukey’s test. *Significant difference compared to control. #Significant difference compared to BzATP (p < 0.05). Hematoxylin and Eosin (H&E). Magnification 400 ×

P2X7R blockade modulates inflammation in experimental periodontitis

Activation of P2X7R by BzATP was not able to protect bone tissue in animals with periodontitis, nor did it reduce the inflammatory infiltrate caused by periodontitis. On the other hand, P2X7R blockade attenuated the local inflammatory infiltrate (Fig. 5A; Table 1). Cytokine quantification in gingival tissue corroborates these findings, showing that P2X7R blockade induced by BBG tended to increase levels of IL-10, an anti-inflammatory cytokine (Fig. 5B), and significantly reduced TNF-alpha levels by 38%, even in the presence of periodontal inflammation (Fig. 5C). The modulatory effect of BBG on the P2X7 receptor during periodontitis also reduced GSK-3β gene expression in bone tissue (Fig. 5D).

Fig. 5.

P2X7R Blockade Modulates Periodontal Inflammation. A Histological aspect of the periodontium; B Gingival levels of IL-10; C Gingival levels of TNF-alpha; D Gene expression of GSK-3β in bone tissue. Bars represent mean ± SEM, n = 6/group. ANOVA and Tukey’s test. *Significant difference compared to control. #Significant difference compared to BzATP (p < 0.05). Hematoxylin and Eosin (H&E). Magnification 100 ×. D = Dentin; PL = periodontal ligament; G = gingiva; AB = alveolar bone; * = inflammatory infiltrate

Table 1.

Histopathological analysis of the periodontium

Scores	Naive	EP	BzATP	BBG
Median (Extreme values)	0 (0–0) *	3 (3–3)	3 (2–3)	1,5 (1–2) *

Values are presented as median (range) with n = 6 per group. Kruskal–Wallis and Dunn’s tests were used. EP = Experimental Periodontitis. *Significant difference compared to control. #Significant difference compared to BzATP (p < 0.05)

P2X7R blockade protects periodontal ligament fibers

An important marker of tissue damage caused by periodontal inflammatory processes is collagen destruction, especially in the periodontal ligament fibers; therefore, Picrosirius Red staining was performed. Activation of the P2X7 receptor during periodontitis promoted greater thinning of the periodontal ligament fibers, which showed increased intensity of green-yellowish staining. P2X7R blockade during periodontitis protected the periodontal ligament fibers by increasing the expression of red–orange fibers, characteristic of mature collagen fibers (Fig. 6).

Fig. 6.

P2X7R Blockade Protects Periodontal Ligament Fibers. A Histological aspect of the periodontal ligament stained with Picrosirius Red under polarized light, and fluorescence microscopy of the periodontal ligament; B Birefringence intensity of collagen fibers in red–orange tones; C Birefringence intensity of collagen fibers in yellow-green tones. Bars represent mean ± SEM, n = 6/group ANOVA and Tukey’s test. *Significant difference compared to control. #Significant difference compared to BzATP (p < 0.05). Magnification 400 ×. D = Dentin; PL = periodontal ligament; G = gingiva; AB = alveolar bone. White arrows indicate the presence of collagen fibers with birefringence in yellow-green tones.

Fluorescence microscopy analysis corroborated these findings, showing that during periodontitis, P2X7 receptor activation was not able to improve the organization and architecture of the periodontal ligament. On the other hand, P2X7R blockade preserved collagen in the periodontal ligament and maintained its organization, thickness, and cellularity (Fig. 6).

Discussion

This study demonstrated that the experimental periodontitis model in rats resulted in significant bone loss, characterized by an increase in inflammatory infiltrate, a decrease in the thickness and organization of collagen fibers in the periodontal ligament, and a reduction in both the number and function of osteoblasts. Activation of P2X7R by BzATP in animals with periodontitis failed to reverse the pathological changes observed in the SAL group. Conversely, blockade of the P2X7 receptor with BBG mitigated bone loss, reduced osteoclast counts, and alleviated periodontal inflammation, while preserving periodontal architecture and stimulating osteoblast activity in the periodontitis-affected animals. To the best of our knowledge, this is the first study to investigate the role of P2X7R in experimental periodontitis in rats. The results of this study indicate that activation of the P2X7 receptor, mediated by BzATP at a concentration of 100 µM, inhibited osteoblast proliferation and decreased alkaline phosphatase levels. In contrast, blocking the receptor with BBG reversed these effects.

Previous research has shown that the P2X7 receptor is expressed in both human and rodent osteoblastic cell lines levels [19–21]. In mesenchymal stem cells, activation of P2X7R by BzATP (100 µM) has been reported to stimulate differentiation into mature osteoblasts and enhance bone formation [22]. However, the role of P2X7R in mature osteoblasts remains controversial. For instance, Ke et al. [23] observed reduced periosteal bone formation in long bones of P2X7R knockout mice. Conversely, other studies support our findings by demonstrating that P2X7R activation can lead to apoptosis [20], the induction of plasma membrane bleb formation [24] the production of lipid mediators [25], and the activation of the AP-1 transcription factor [26], alongside a reduction in mineralization [27]. In summary, basal and transient activation of P2X7R appears to exert an osteogenic effect; however, prolonged and repeated stimulation of this receptor at high ATP concentrations results in the formation of cytolytic pores, which inhibit osteoblast function and activity and induce apoptosis. This mechanistic understanding aligns with our findings [20, 22, 28].

In animals subjected to periodontitis, overactivation of P2X7R led to the destruction of periodontal architecture, characterized by a reduction in the thickness of collagen fibers, tissue disorganization, and an increase in inflammatory infiltrate. Generally, the inflammatory process releases ATP, which acts as a damage-associated molecular pattern (DAMP). The administration of BzATP results in a significant increase in extracellular ATP (eATP), which ensures the activation of P2X7 receptors. This activation promotes the formation of the NLRP3 inflammasome, subsequently contributing to the cleavage of pro-IL-1β into its active form, IL-1β [8]. The release of IL-1β, in conjunction with tumor necrosis factor-α (TNFα), stimulates the production of matrix metalloproteinases (MMPs), such as MMP-8, which play a crucial role in collagen degradation during periodontitis [29, 30]. Furthermore, macrophages and neutrophils involved in the inflammatory response also contribute to collagen destruction [31]. The degradation of collagen fibers further enhances ATP release by gingival fibroblasts, leading to cell deformation and increased Ca²⁺ influx. This positive feedback loop of ATP release induces the activation of P2X7 receptors in other cells, such as lymphocytes and osteoblasts, resulting in increased RANKL expression and, ultimately, bone loss [32].

This study demonstrated that blocking P2X7R with BBG preserved the periodontal ligament, resulting in slightly thicker, better-oriented collagen fibers that filled the periodontal space, exhibiting a red–orange appearance, while also reducing inflammatory infiltrate. In the context of periodontitis, P2X7R blockade in knockout animals subjected to the P. gingivalis infection model led to a reduction in IL-17 and IFNγ levels [8], mediators commonly associated with various inflammatory diseases mediated by IL-1β [33]. Furthermore, Ramos-Junior et al. [8] reported high gene expression levels of IL-1, NLRP3, and P2X7 in patients with chronic periodontitis, with a subsequent reduction in NLRP3 and P2X7 expression following treatment. Binderman et al. [34] evaluated the effects of BBG on periodontal tissue and found that local administration of BBG was effective in reducing bone loss after periodontal surgery, attributed to its action on the P2X4 receptor. It is important to note that BBG is a first-generation, non-specific antagonist of P2X7R, which also inhibits the activity of P2X1 and P2X4 receptors [35]. In the inflammatory process, P2X4R can serve as an initial signal for inflammasome formation, increasing the efflux of K⁺ and ATP via Panexin channels, thereby raising eATP levels and promoting P2X7R activation [35] (Fig. 7).

Fig. 7.

P2X7R Activity When Overactivated by ATP in Osteoblasts. Overactivation of P2X7R resulting from inflammatory conditions due to high extracellular ATP (eATP) concentration, combined with the presence of its agonist BzATP, triggers signaling for activation of the NLRP3 inflammasome. When activated, it inhibits the translocation of cytoplasmic β-catenin and the synthesis of IL-1β, which contributes to inflammation and, together with TNF-α, promotes activation of MMP-8. This favors degradation of fibroblasts and collagen, contributing to increased ATP levels and resulting in negative feedback. Furthermore, during the inflammatory process, when P2X7R is antagonized by BBG, fibroblast degradation is prevented and GSK-3β is blocked, inhibiting β-catenin phosphorylation. The β-catenin then migrates to the nucleus to transcribe genes responsible for bone formation, such as Runx2, OCN, and increased expression of OPG. P2X4R, under these conditions, may have dual activity in the inflammasome depending on modulation, considering its activation even at low ATP concentrations. However, under these conditions, the activity of the Wnt/β-catenin pathway and its interaction with P2X7R remain unclear. (eATP = extracellular ATP); (IL-1β = interleukin 1β); (MMP-8 = matrix metalloproteinase-8); (OCN = osteocalcin); (OPG = osteoprotegerin)

Analysis of the effects of P2X7R modulators on osteoblasts revealed that receptor activation led to a decrease in both their number and function. Conversely, blockade of P2X7R with BBG was effective in mitigating the reduction in osteoblast count and preserving their functional capacity. The adverse effects of BzATP on osteoblasts within the diseased periodontium may be attributed to its impact on the Wnt/β-catenin signaling pathway, which is crucial for osteoblastogenesis. Sindhavajiva et al. [36] demonstrated that activation of P2X7R in primary cultures of human osteoblasts derived from the mandible resulted in decreased expression of WNT3A, RUNX2, and OSX genes, along with inhibition of β-catenin translocation to the nucleus in cells exposed to an osteogenic medium. Notably, silencing P2X7R mRNA reversed these effects, confirming that P2X7R activation inhibits the Wnt signaling pathway. However, this remains a controversial topic, as one study indicated that P2X7R activation via BzATP can stimulate the Wnt pathway [37]. Therefore, further studies investigating intracellular signaling following P2X7R activation are necessary to clarify its role in osteoblast function and bone metabolism (Fig. 4).

The results of this study align with existing literature, demonstrating that blocking P2X7R inhibits osteoclast formation in vitro, likely by preventing the fusion of its precursor cells [38]. However, Ke et al. [23] reported that P2X7 knockout animals still exhibited functional osteoclasts, suggesting that P2X7R may not be essential for cell fusion. Furthermore, BzATP (100 µM) promoted greater nuclear translocation of NF-kB in osteoclasts after 3 h, whereas ATP (10 µM) did not enhance the nuclear localization of NF-kB, indicating that this concentration is insufficient to activate P2X4R [39]. It is hypothesized that osteoclasts may be indirectly activated during osteoporosis through the activation of P2X7R in osteoblasts, which positively regulates RANKL expression [40, 41].

Despite the significant role that P2X7R appears to play in inflammatory bone loss, this study has certain limitations that should be acknowledged. Further investigations are required to elucidate the role of P2X7R in this specific osteoblastic lineage (OFCOL II), along with in vivo assays, particularly regarding the effect of P2X7R on the Wnt signaling pathway. Additionally, the use of selective antagonists for the receptor should be considered for future experiments, given the non-specific nature of the agent employed in this study, thereby off-target effects cannot be completely excluded.

Conclusion

In conclusion, the results of the present study demonstrate that the overactivation of P2X7R during the inflammatory process of periodontitis contributes to significant periodontal destruction. This occurs due to an exacerbation of the inflammatory response, leading to the degradation of collagen fibers in the periodontal ligament and a reduction in both the number and activity of osteoblasts. Conversely, blocking P2X7R resulted in a notable increase in osteoblast count and activity, elevated serum alkaline phosphatase levels, and improved collagen quality, while preserving periodontal architecture. Therefore, we propose that P2X7 purinergic receptors represent a potential target for future periodontal therapeutic strategies. However, further studies are needed to elucidate the role of this pathway in inflammatory bone loss.

Nadine Linhares 

Holds a degree in Dentistry from the Catholic University Center of Quixadá. Earned a Master’s degree and is currently pursuing a Ph.D. in Dentistry at the Federal University of Ceará (PPGO-UFC), with a focus on Clinical Dentistry and an emphasis on Applied Clinical and Experimental Therapeutics.

Author contributions

Conceptualization: PG, NL; Methodology: NL, MJB, MAT, JF; Investigation: RS, SF, ES; Formal analysis: VS, GB, AMS; Data curation: SF, RS; Resources: RL, DG, MM; Writing – original draft: NL, MJB, JF, RS; Writing – review & editing: PG, DG, MM; Visualization: RL, DG, MM; Supervision: PG; Project administration: PG; Funding acquisition: PG.

Funding

CNPq process #402349/2021–0 and #302704/2022–1.

Data availability

All data generated or analyzed during this study are included in this published article.

Declarations

Clinical trial number

Not applicable.

Competing interest

The authors declare no competing interests.