Skip to main content
NCBI home page
Veterinary Sciences logoLink to Veterinary Sciences
. 2025 Dec 2;12(12):1152. doi: 10.3390/vetsci12121152

Development and Preliminary Application of a Beak Development Index in Pathogenicity Studies of Novel Goose Parvovirus

Yu Shao 1, Dong Huang 1, Zhanjie Han 2, Yanfang Cong 3, Jinliang Wang 4, Xiaobin Wang 2, Ruimei Yang 2, Shijun Bao 1,*, Hongliang Zhang 2,*
Editor: Vittorio Sarchese
PMCID: PMC12737641  PMID: 41472132

Simple Summary

Duck short beak and dwarfism syndrome (SBDS), caused by novel goose parvovirus (NGPV), leads to growth retardation, short beak, and lameness. In existing infection model studies, the common approach involves directly measuring the body weight as well as the length and width of the beak. However, this methodology fails to discriminate whether the beak development disorder results from a secondary phenomenon of delayed development or the direct impact of the virus. In this study, the pathogenicity of the newly isolated SBDSV—SD strain in Cherry Valley ducks was appraised. Subsequently, a three-dimensional formula model for the beak development index was constructed using the beak length, beak width, and body weight of healthy ducks. When this model was applied to infected ducks, it was found that this formula could effectively mirror the beak development disorder induced by the virus.

Keywords: novel goose parvovirus (NGPV), short beak and dwarfism syndrome (SBDS), pathogenicity, beak development index (BDI), cherry valley ducks

Abstract

Duck short beak and dwarfism syndrome is a viral infectious disease caused by a novel goose parvovirus (NGPV), which results in growth retardation, short beaks, protruding tongues, and lameness in ducks. To determine whether short beak results from growth retardation or viral direct impact, this study sequenced the SBDSV-SD strain and investigated its pathogenicity in 2- and 8-day-old ducks. The formula model of beak development index was established by using the three-dimensional data of beak length, beak width and body weight of healthy ducks. The results show that phylogenetic analysis classified SBDSV-SD within the NGPV clade. The result of the challenge test shows that viral infection can cause weight loss, short beak, and viral shedding, and more severe symptoms in younger ducks. A beak development index (BDI), correlating beak length2 × width with body weight (R2 > 98%), was established. The application of BDI revealed a significant difference at two weeks post-infection in infected ducks, indicating that early short beak is attributable to a secondary injury of growth retardation rather than the direct impact of the virus. The BDI can effectively differentiate between these mechanisms.

1. Introduction

The “Short Beak and Dwarfism Syndrome” (SBDS), also termed “duck macroglossia,” is a contagious disease caused by novel goose parvovirus (NGPV). SBDS is characterized by a mortality rate in ducks typically below 5%, whereas NGPV infection induces growth retardation, short beak, tongue protrusion, lameness, and increased bone fragility. Although the mortality rate of this disease is relatively low, the vast majority of infected ducks develop into “ numb ducks”, showing symptoms such as abnormal growth, stunted development, and weight loss [1]. The culling rate of such “ numb ducks” is as high as 80%, causing significant economic losses [2]. In addition, vertical transmission further complicates disease control [3].

NGPV is classified within the genus Dependovirus of the subfamily Parvovirinae. It is a single-stranded DNA virus with a diameter of 20–24 nm, exhibiting icosahedral symmetry. The viral genome is approximately 5.1 kb in length and contains inverted terminal repeats (ITRs) at both ends, as well as two open reading frames (ORFs). The left ORF encodes the non-structural proteins NS1 and NS2, while the right ORF encodes the structural proteins VP1, VP2, and VP3 [4,5].

SBDS was first reported in mule ducks in southern France (1971–1972), with subsequent outbreaks documented in Taiwan (1989), Poland (1995), and China (2015) [6,7,8]. Recent cases have emerged in Egypt [9] and Vietnam [10]. Previous studies on the pathogenicity of NGPV have shown that ducklings are highly susceptible to NGPV infection, which can cause dysplasia, short beak, tongue protrusion, and slope foot symptoms, and even lead to death [7,11,12]. However, there are obvious limitations in the assessment of beak development. Most studies have only been evaluated by direct comparison of absolute beak length or width, an approach that cannot distinguish whether developmental impairment of the beak is the result of a direct effect of the virus or merely a secondary concomitant phenomenon with systemic growth retardation (weight loss). The lack of a quantitative indicator to correlate beak development with general growth status is a key bottleneck for standardized assessment of pathological changes in this disease.

Inspired by comprehensive measures such as Body Mass Index (BMI = Weight/Height2) and the Ponderal Index (PI = Weight/Height3) [13,14,15,16,17,18,19] in human medicine, these indices correlate height and weight to assess nutritional and developmental status. We speculate that establishing a comprehensive index correlating beak size with body weight for ducks may provide a more scientific assessment of the specific effects of viruses on beak development.

In this study, we analyzed the genomic characteristics of an NGPV (SBDSV-SD) strain isolated in 2023 and investigated the pathogenicity of SBDSV-SD in 2- and 8-day-old Cherry Valley ducks. To this aim, we proposed and defined for the first time the beak development index (BDl), in order to provide new key indicators for establishing a standardized infection model.

2. Materials and Methods

2.1. Virus and Experimental Animals

The new goose parvovirus SBDSV-SD strain was originally isolated from the spleen of the cherry duckling flock with SBDS in Shandong province, China. The isolated virus was grown and titrated in 9-day-old embryonated Specific Pathogen Free (SPF) duck eggs through the allantoic cavities route. The titer of SBDSV-SD strain was calculated at 104.85 ELD50/0.2 mL for intramuscular challenge in this study. One-day-old ducklings negative for maternal antibodies of NGPV were purchased from a hatchery in Qingdao. On the second day after hatching, we randomly assigned them to different groups based on their weight and housed them in separate, isolated rooms in a closed animal facility. They were fed high-quality commercial duck rations, and have unlimited access to water. The ducklings were identified by individually numbered leg rings.

2.2. Sequencing and Analysis of the NGPV Genome

The complete genome of SBDSV-SD strain was amplified by six conserved-region primer pairs (Table 1) and products were cloned into pCE2 (Vazyme, Nanjing, China), and sequenced by Sangon Biotech (Shanghai, China). The genome sequences (PP236942.1) were compared with GenBank reference strains and generated neighbor-joining trees by MEGA 7.0 [20] (bootstraps 1000, p-distance, d: Transitions + Transversions).

Table 1.

Primers used to amplify the complete nucleotide sequence of NGPV isolate SBDSV-SD.

Primers Nucleotide Sequence (5′ to 3′) Position Length of Products (bp)
P1-F CTTATTGGAGGGTTCGTTCG 1–20 191
P1-R GCATGCGCGTGGTCAACCTAACA 169–191
P2-F GCATGCCGCGCGGTCAGCCCAAT 186–209 1294
P2-R TCACCCAGCCGCACAGGATAC 1459–1480
P3-F TAGACAGGTGAAAGCTGCACT 1298–1319 1550
P3-R TGATAGGCTCTTCTACTAGGC 2827–2848
P4-F GTAATCTTGGAAAGGCTGTAT 2773–2794 1515
P4-R ATTTGCCATCAGTCTTCGGT 4268–4288
P5-F CCAGCATCCCAGCTCAGAATAGTTT 3994–4019 667
P5-R ATATTTTGCGCGCCAGGAAGTGCTT 4636–4661
P6-F TCAATACTCTACAGGCCAGTGT 4418–4440 468
P6-R CTGTTAGGTTGACCACGCGCATGC 4862–4886
Open in a new tab

2.3. Ethical Approval

All animal studies were conducted in accordance with the applicable animal welfare standards (Chinese National Standard (GB/T 42011-2022 [21])) and Declaration of Helsinki, and approved by the Institutional Ethics Committee of The National Animal Health Products For Engineering Technology Research Center (GCZX RD YF046-1.0, 25 November 2024).

2.4. Animal Experimental Design

Forty ducklings were randomly allocated into four groups (n = 10). One experimental group was infected with of NGPV at 2 days old, while the other group was infected at 8 days old. The infection dose is 0.5 mL per 100 g of body weight, and the ducklings of control groups were inoculated with equal PBS at the same age. Clinical symptoms such as listlessness, apathy, ruffled feathers, diarrhea, tongue protrusion, and lameness were monitored over a period of 21 days post-infection (dpi) or an extended period of 28 days post-infection (applicable only to Group 1 and Group 2). Pharyngeal and cloacal swabs were collected on days 0, 2, 4, 6, 10, 14, 21, and 28 (applicable only to Group 1 and Group 2) post-infection to assess viral shedding dynamics using Quantitative Real-Time PCR (qPCR). Body weight, beak length, and beak width were measured weekly (Table 2). At 30 days of age, the animals were humanely euthanized in accordance with ethical guidelines. During necropsy, tissue samples from the heart, liver, spleen, lung, kidney, pancreas, small intestine, beak, and tibia were collected and fixed in 4% formaldehyde solution for subsequent histopathological analysis. For molecular detection, 0.5 g of tissues from the heart, liver, spleen, lung, kidney, pancreas, small intestine, and thymus were homogenized in 0.5 mL of phosphate-buffered saline (PBS), followed by nucleic acid extraction. qPCR was performed to determine the toxin load in each tissue sample. Additionally, head, wing, and leg tissues were collected and subjected to radiological imaging examination.

Table 2.

The infection experimental designs used for the animal studies.

Group Number Day of Infection Antigen Dose Tissue and Viscera Collection Pharyngeal and Cloacal Swab Collection Body Weight, Beak Length and Beak Width Collection
1 10 2-day-old NGPV 0.5 mL per 100 g of body weight 4 weeks after infection 0 day before infection; 2, 4, 6, 10, 14, 21 and 28 days after infection 0 day before infection; 1, 2, 3 and 4 weeks after infection
2 10 2-day-old PBS
3 10 8-day-old NGPV 3 weeks after infection 0 day before infection; 2, 4, 6, 10, 14 and 21 days after infection 0 day before infection; 1, 2, and 3 weeks after infection
4 10 8-day-old PBS
Open in a new tab

2.5. NGPV Quantitative Real-Time PCR

Swabs/tissues were homogenized in PBS; DNA was extracted using Vazyme (Nanjing, China) Viral Kit 2.0 per manufacturer’s instructions. NGPV loads in duck samples were quantified using an NGPV qPCR assay. In brief, a 108 bp VP gene target was amplified using NGPV-F: AGTTCCTTTCCACAGCAT; NGPV-R: TTTCTGTTGCTGTCTACCTC; Probe: FAM-TTCGCTCATTCACAGGACTTAGACAGGC-BHQ1.Standard curves used pUC19-NGPV VP2 dilutions (10−1–10−10; corresponding to 8.74 × 109–8.74 × 10−2 copies/uL). Reactions (20 μL) contained 2 μL template, 0.4 μM primers, 0.2 μM probe, and All-Ready Mix(Qingdao Biotephy Co., Ltd., Qingdao, China). Cycling: 95 °C/3 min; 40 × [95 °C/10 s → 60 °C/30 s]. Specificity confirmed against 7 waterfowl pathogens; sensitivity: 8.74 copies/μL. Triplicate runs per sample.

2.6. Statistical Analysis

GraphPad Prism software version 8.02 (GraphPad Software Inc., San Diego, CA, USA) was utilized to perform correlation analyses and comparisons of collected data on body weight, beak length, beak width, swab viral shedding, and viral load across various tissues in both infected and control duck groups. Data were expressed as mean ± standard deviation (SD). Statistical significance was determined by Student’s t test analysis. p value < 0.05 was considered statistically significant between 2 groups. Normality of distribution was assessed by the Kolmogorov–Smirnov test.

2.7. Establishment of Beak Development Index (BDI)

Body weight, beak length, and beak width were measured weekly in a group of 20 healthy Cherry Valley ducks serving as blank controls over a three-week or four-week period, resulting in data collection at five consecutive time points. Refer to the different calculation formulas developed in the research on human body mass index [13], we examined the linear relationships between various morphometric indices of beak development—including beak length, beak width, the product of length and width (length × width), and the volumetric proxy (length2 × width)—and body weight. The relationship exhibiting the strongest correlation with body weight and satisfying the assumption of normality—assessed using the least squares method under a Gaussian model—was identified as the optimal predictor variable. Based on the relationship, a beak development index was formulated to quantitatively characterize beak growth relative to overall body size.

2.8. Application of Beak Development Index in Infected Ducks

The beak development index (BDI) values for both the infection group and the control group were calculated according to the established formula (BDI = beak length2 × width/body weight). GraphPad Prism software (version 8.02) was employed to compare and analyze the BDI between the two groups, in order to evaluate the potential impact of viral infection on beak development in ducks. Statistical significance was determined by Student’s t test analysis. p value < 0.05 was considered statistically significant.

3. Results

3.1. Genomic Characterization of SBDSV-SD

The length of SBDSV-SD genome is 5056 nucleotides, and 380 nucleotides inverted terminal repeats (ITRs) in the non-coding regions at both ends. Two major ORFs were identified: the ORF at 512~2395 nucleotides encodes the non-structural Rep protein (627 aa), while the ORF at 2414~4612 nucleotides encode VP1 (732 aa). VP2 and VP3 initiation codons are located, respectively, at 2849 and 3008 nucleotide (Figure 1A). The phylogenetic result shows that SBDSV-SD clusters with NGPV strains, formed a distinct clade with HN1P (2019), SD0402 (2019), and SDHZ0512 (2023) (Table 3), and diverged from the isolates before 2016 (Figure 1B).

Figure 1.

Figure 1

Open in a new tab

Genome structure and phylogenetic tree of NGPV strains obtained based on the genome nucleotide sequences. (A) Genome structure of NGPV; (B) phylogenetic tree of NGPV strains. Numbers at nodes indicate bootstrap percentages obtained after 1.000 replicates. Genotypes are indicated on the right side of the tree. Note: The red dot represents SBDSV-SD strain.

Table 3.

Description of waterfowl parvovirus isolates involved in this study.

Viral Classification Strain Pathogenicity Host Geographic Origin Collection Date Genbank Accession No.
GPV SYG61 v Vaccine Goose China 1961 KC996729
GPV SHM319 Pathogenic Goose USA 1971 U34761.1
GPV 82-0321 Pathogenic Goose Taiwan 1982 EU583390
GPV YZ99-6 Pathogenic Goose China 1999 KC996730
GPV 06-0329 Pathogenic Goose Taiwan 2006 EU583391
GPV VG32/1 Vaccine Goose Taiwan 2008 EU583392
GPV 82-0321v Vaccine Goose Thailand 2008 U583389
GPV SH Pathogenic Goose China 2009 JF333590
GPV Y Pathogenic Goose China 2011 KC178571
GPV SHFX1201 Pathogenic SWAN China 2012 KC478066
GPV MDE Pathogenic mule duck China 2015 MF438102
GPV Konya/19 Pathogenic Anser anser domesticus Turkey 2019 MW386078
MDPV FM Pathogenic Cairina moschata Hungary 1995 U22967
MDPV YY Pathogenic Muscovy duck China 2000 KX000918
MDPV D Vaccine Muscovy duck China 2003 JF926696.1
MDPV JH06 Pathogenic Muscovy duck China 2006 MH807697
MDPV GX5 Pathogenic Muscovy duck China 2011 KM093740
MDPV SAAS-SHNH Pathogenic Muscovy duck China 2013 KC171936
NGPV FJ15 Pathogenic mule duck China 2015 KU844283
NGPV SDLC01 Pathogenic Cherry Valley duck China 2015 KT343253
NGPV QH15 Pathogenic Peking duck China 2015 KT751090.1
NGPV JS1 Pathogenic Peking duck China 2015 KT935531.2
NGPV AH Pathogenic Cherry Valley duck China 2015 MH444513.1
NGPV GD Pathogenic mule duck China 2016 MH444514
NGPV SD0402 Pathogenic Anas platyrhynchos China 2019 MT084129
NGPV HN1P Pathogenic Anas platyrhynchos China 2019 MK737642
NGPV HNXY21 Pathogenic duck China 2021 ON645931.1
NGPV VNUA-07 Pathogenic Duck Vietnam 2021 OP265005.1
NGPV SDHZ0512 Pathogenic Duck China 2023 PP068765.1
NGPV SBDSV Pathogenic Cherry Valley duck China 2023 PP236942.1
Open in a new tab

3.2. Clinical Parameter Monitoring and Growth Metric Analysis

In 2-day-old ducks, viral infection led to progressive clinical signs, with listlessness, anorexia, and recumbency appearing from day 4 post-infection, flaccid paralysis of the legs evident from day 7, and tongue protrusion observed starting on day 13. By day 28 post-infection, the recorded clinical manifestations included lameness (30%), tongue extension (20%), and developmental delay, which reached 100% incidence (Figure 2A–D). Gross pathological findings at necropsy revealed splenic hemorrhage (30%), pericardial effusion (20%), hepatomegaly (30%), and intestinal dilation (30%, Figure 2E–H). Compared with the control group, infected ducks exhibited a mean weight reduction of 24.24% ± 4.48% during the first four weeks post-infection (p < 0.05, Figure 3A). Beak length was significantly reduced by 17.22% ± 3.84% (p < 0.001, Figure 3B), and beak width decreased by 12.28% ± 1.17% (p < 0.05, Figure 3C).

Figure 2.

Figure 2

Open in a new tab

Clinical signs and gross lesions in NGPV infected ducks. (A) Leg fracture or lameness; (B) tongue extension; (C) listless, clustered and recumbency; (D) blank control. (E) splenic congestion; (F) pericardial effusion; (G) hepatomegaly; (H) intestinal flatulence.

Figure 3.

Figure 3

Open in a new tab

Body weight, beak length and beak width between PBS group and 2-day-old infection group. (A) Body weight; (B) length of beak; (C) width of beak. Note: ns represents p value > 0.05, no significant difference. “*” represents p value < 0.05; “**” represents p value < 0.01; “***” represents p value < 0.001.

The 8-day-old ducks exhibited temporary lethargy and recumbency from 1 to 3 dpi; no significant gross lesions were found during the post-mortem examination during the necropsy. The body weight was significantly reduced by 13.05% only at 1 week after infection (p < 0.05, Figure 4A). Additionally, beak length was significantly shorter by 7.05% and 4.74% at 1 and 2 weeks post-infection (p < 0.05, Figure 4B), and beak width was reduced by 7.97% to 4.63% at the same time (p < 0.05, Figure 4C). No significant differences were observed in these parameters at 3 weeks after the infection.

Figure 4.

Figure 4

Open in a new tab

Body weight, beak length and beak width between PBS group and 8-day-old infection group. (A) Body weight; (B) length of beak; (C) width of beak. Note: ns represents p value > 0.05, no significant difference. “*” represents p value < 0.05; “**” represents p value < 0.01; “***” represents p value < 0.001.

3.3. Histopathological Examination

Histopathology examination revealed splenic fibrosis, hepatocellular necrosis, myocardial degeneration, intestinal mucosal necrosis, and chondrocyte proliferation in the beak and tibia, along with reduced osteoblast activity in the infected group (Figure 5).

Figure 5.

Figure 5

Open in a new tab

Microscopic lesions of ducks 28 days after NGPV infection (200×). (A–F) Infected ducks. (A) Heart: Granular degeneration of myocardial cells. (B) Liver: Hepatocyte swelling with numerous vacuoles in the cytoplasm and hepatocyte necrosis. (C) Spleen: No distinct splenic corpuscles, congestion, abundant fibrous-like substances, and infiltration of heterophilic granulocytes. (D) Duodenum: Partial necrosis of mucosal epithelial cells. (E) Beak: Abundant connective tissue in the bone tissue space, with visible trabeculae and bone marrow cavity in the middle of the bone tissue. There are many chondrocytes on the trabeculae and few osteoblasts on the edge of the bone marrow cavity. (F) Tibia: Chondrocytes are distributed in the bone tissue of the tibia, and no obvious osteoblasts are seen covering the inner surface of the bone marrow cavity. (G–L) Healthy ducks. (G) Heart. (H) Liver. (I) Spleen. (J) Duodenum. (K) Beak. (L) Tibia.

3.4. Radiological Investigation

X-ray examination revealed severe hypoplasia of the bones in the beak, wings, and legs of the infected ducks, characterized by shortened bones, reduced mineral density, and diminished marrow cavity volume (Figure 6).

Figure 6.

Figure 6

Open in a new tab

X-ray examination of ducks 28 days after NGPV infection. (A) Heads; (B) wings; (C) legs. Left, uninfected control group; right, infected group.

3.5. Viral Shedding and Tissue Tropism

Viral DNA in oral and cloacal swabs were detected by NGPV qPCR after infection. In 2-day-old ducks, viral loads peaked at 106.08 ± 0.4 copies/μL on 2 dpi, stabilizing until 6 dpi and declining to 103.80 ± 0.35 copies/μL at 28 dpi (Figure 7A). Viral shedding in 8-day-old ducks exhibited similar curve patterns but demonstrated 100-fold lower titers, with a peak of 103.91 ± 0.4 copies/μL (Figure 7C). Both 2-day-old and 8-day-old ducklings demonstrated significantly elevated viral loads in all examined organs compared to controls. Among the organs analyzed, the spleen exhibited the highest viral load, whereas the thymus displayed the lowest detectable levels (Figure 7B,D).

Figure 7.

Figure 7

Open in a new tab

Viral qPCR results. (A) Virus shedding was monitored by qPCR in 2-day-old infection group; (B) the viral load of each organ in 2-day-old infection group; (C) virus shedding was monitored by qPCR in 8-day-old infection group; (D) the viral load of each organ in 8-day-old challenge group.

3.6. Establishment of Beak Development Index

A total of 90 samples were collected at five time points. All samples exhibited a strong linear relationship (R2 > 0.8828, Figure 8A–D), with beak length2 × width showing the highest goodness of fit (R2 = 0.9806, Figure 8D). Based on these findings, we developed an index to evaluate beak development, termed the beak development index (BDI), calculated as BDI = (beak length2 × width)/body weight. Statistical analysis revealed that BDI values in healthy ducks followed a normal distribution, as confirmed by the Kolmogorov–Smirnov test (p value = 0.161, Figure 8E).

Figure 8.

Figure 8

Open in a new tab

The linear analysis results of the degree of beak development and body weight. (A) Beak length; (B) beak width; (C) beak length× width; (D) beak length2 × width; (E) the normal distribution of the healthy duck BDI was confirmed by the Kolmogorov–Smirnov test. Note: The red line represents the fitting curve of the normal distribution, and the blue rectangles denote the frequency of data occurrence.

3.7. The Results of Beak Development Index Application in Infected Ducks

Statistical analysis revealed that the beak development index in the 2-day-old and 8-day-old infection groups was significantly different from that of the control group two weeks after infection. Compared with the control group, 2-day-old infected ducks exhibited a mean BDI reduction of 21.32% ± 5.41% (p < 0.05, Figure 9A), while the 8-day-old infection group showed a reduction of 11.14% ± 2.05% (p < 0.05, Figure 9B).

Figure 9.

Figure 9

Open in a new tab

Beak development index between PBS group 2-day-old infection group and 8-day-old infection group. (A) Comparison between PBS group and 2-day-old infection group; (B) comparison between PBS group and 8-day-old infection group. Note: ns represents p value > 0.05, no significant difference. “*” represents p value < 0.05; “***” represents p value < 0.001.

4. Discussion

Since 2015, a novel duck-derived goose parvovirus (NGPV) has emerged on the mainland of China [8]. Despite its relatively low mortality rate, NGPV causes a high disability rate in ducks, resulting in significant economic losses for the waterfowl industry. Moreover, the disease can be transmitted vertically, posing a substantial challenge to disease prevention and control [3,12].

Recently, the NGPV virus has been detected in several countries including Poland [7,22], Egypt [9], and Vietnam [10], as well as China [8], where the incidence rate is particularly high. Genomic analyses of Chinese NGPV strains [8,23,24,25,26] reveal 96–100% sequence homology. In this study, the SBDSV-SD strain was clustered into the new goose parvovirus branch and shared 97.8–99.6% identity with 11 representative NGPV strains. Isolates HN1P and SD0402 in 2019 and SDHZ0512 in 2023 clustered into a new branch compared with the representative strains isolated in 2015.

The current pathogenicity studies on NGPV have confirmed that NGPV can infect mule ducks, Cherry Valley ducks, Peking ducks, etc. [7,11,12]. The common symptoms of NGPV are developmental delay, short beak, leg fracture and tongue extension, etc. For this study, we preferred to evaluate the pathological effects on Cherry Valley ducks, both because they are the most commonly used in meat duck breeding in China, and because the symptoms, previously listed and described in the literature, are more easily detectable. And our research results replicated the aforementioned clinical symptoms described. In addition, X-ray examination results of infected ducks revealed that the lengths of the mandible, humerus, ulna, metacarpal, femur, and metatarsal bones were significantly shorter compared to those in the control group. Microscopic pathological examination of the duck beaks and tibiae further demonstrated an increased number of chondrocytes and a reduced number of osteoblasts. These findings suggest that viral infection may disrupt the normal process of chondrocyte-to-osteoblast transformation, thereby impairing bone growth.

Furthermore, aforementioned methods for confirming the shortness of the beak are mostly through direct measurement of the beak length and width, which is unable to distinguish whether the abnormal development of the beak is caused by a viral infection or is a consequence of delayed development. Palya et al. [7] infected ducks of different ages with the Hungarian D176/02 strain and the ratio of beak length to beak width was introduced as a statistical indicator in the beak development analysis. Chen et al. [12] infected 1-day-old Cherry Valley ducks with the SDLC01 strain and conducted pathogenicity research. He merely briefly described the length of the beak, without conducting a significant difference analysis. And In Zhang’s and Xiao’s evaluation test of subunit vaccine immune protection, only the differences in body weight and beak length were measured [27,28]. Although there have been many studies on the pathogenicity or vaccine evaluation of NGPV in ducks, the evaluation of beak development has been limited to comparing the length and width of the beak, which raises the question of whether impaired beak development is directly caused by viral infection or secondary to reduced body weight growth. In this study, we explored a more scientific approach to characterizing the symptoms of beak developmental disorders caused by the virus using data-driven methods. Statistical analyses revealed a significant linear correlation between beak dimensions (length and width) and body weight, leading to the introduction of the “beak development index” as a novel metric for assessing beak abnormalities.

The BDI integrates multiple variables (beak length, beak width, and body weight) into a standardized index, which can more specifically reflect the development status of the beak and reduce the assessment deviation caused by simple body weight differences. The inspiration for this measurement standard comes from the human health index such as BMI and PI. Currently, this health index not only evaluates whether a person is overweight, but numerous studies have also linked it to the probability of contracting various diseases [17,29,30,31,32].

In this study, although there was a significant difference in beak length or width on the 7 dpi, the BDI showed a highly significant difference after 14 dpi. This indicates that the viral infection might initially affect overall growth before showing a specific inhibitory effect on beak development. Notably, the 8-day-old infection group demonstrated no significant differences in body weight or beak length and width at 21 dpi (Figure 4); although clinical recovery appeared to occur, qPCR results indicated ongoing viral replication and virus shedding in the swabs. The persistent presence of the virus may continue to impair beak development, a finding supported by the significant differences in the beak development index (BDI). Furthermore, it has been demonstrated that NGPV inhibits bone development in infected ducks through the BMP/Smad and FGF signaling pathways [33]. These findings suggest that the BDI may serve as a more reliable indicator for assessing beak development and enable more precise delineation of the temporal progression of NGPV infection. The variation pattern of the BDI aligns with this pathological process, indicating its potential as an effective tool for quantifying disease progression in future studies.

In this study, we used 20 healthy Cherry Valley ducks. We measured their body weight, beak length and beak width every week, and collected a total of 90 samples at five time points to establish a data model for beak development index. Although the data was statistically significant, the universality of BDI still needs to be further verified in larger-scale studies involving different species of ducks. Here, we introduce the concept and formula of the beak development index, which may serve as a foundation for researchers interested in this field to expand upon and validate using additional datasets. In the future evaluation of vaccine immunogenicity, we believe BDI will be used as a more sensitive indicator than singly beak length or width to investigate specific developmental disorders caused by NGPV.

5. Conclusions

In conclusion, we conducted a comprehensive pathogenicity study of NGPV in Cherry Valley ducks and, based on these findings, established the beak development index (BDI) for the first time, along with its preliminary application. BDI provides a novel method that can objectively reflect the impact of NGPV on the single element of beak development.

Author Contributions

Conceptualization, Y.S. and S.B.; methodology, Y.S.; software, Y.S. and D.H.; validation, Z.H. and X.W.; formal analysis, Y.S. and D.H.; investigation, Y.S.; resources, H.Z. and S.B.; data curation, D.H.; writing—original draft preparation, Y.S.; writing—review and editing, D.H., Y.C., J.W. and R.Y.; visualization, Y.S. and D.H.; supervision, H.Z.; project administration, H.Z.; funding acquisition, S.B. and H.Z. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Ethics Committee of The National Animal Health Products for Engineering Technology Research Center (GCZX RD YF046-1.0, 25 November 2024).

Informed Consent Statement

Informed consent was waived because the study did not involve any privately owned animals.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

Author Yanfang Cong was employed by the Qingdao Vland Biotech INC. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The sponsors had no role in the design, execution, interpretation, or writing of the study.

Funding Statement

This research was funded by discipline construction fund project of Gansu Agricultural University, the Key Project of Natural Science Foundation of Gansu Province (NO. 25JRRA350), Shandong Provincial Key Research and Development Program (Major Scientific and Technological Innovation Project) (NO. 2024CXGC010910-3), Qingdao City Innovation Ecosystem Construction Special Project (NO. 23-2-6-ghjd-4-hz).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Wang H., Wang X., Jiao X., Yin Y., Pang B. Progress in the study of novel goose parvovirus. Chin. J. Anim. Infect. Dis. 2020;28:115–118. doi: 10.19958/j.cnki.cn31-2031/s.2020.02.019. [DOI] [Google Scholar]
  • 2.Bian G., Ma H., Luo M., Gong F., Wang G., Liao M., Yuan J. Progress of a novel goose parvovirus virus. Chin. J. Anim. Infect. Dis. 2019;27:102–107. [Google Scholar]
  • 3.Chen H., Tang Y., Dou Y., Zheng X., Diao Y. Evidence for Vertical Transmission of Novel Duck-Origin Goose Parvovirus-Related Parvovirus. Transbound. Emerg. Dis. 2016;63:243–247. doi: 10.1111/tbed.12487. [DOI] [PubMed] [Google Scholar]
  • 4.Chen Y., Afumba R., Pang F., Yuan R., Dong H. Advances in Research on Genetic Relationships of Waterfowl Parvoviruses. J. Vet. Res. 2021;65:391–399. doi: 10.2478/jvetres-2021-0063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang J., Liu P., Wu Y., Wang M., Jia R., Zhu D., Liu M., Yang Q., Wu Y., Zhao X., et al. Growth characteristics of the novel goose parvovirus SD15 strain in vitro. BMC Vet. Res. 2019;15:63. doi: 10.1186/s12917-019-1807-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lu Y.S., Lin D.F., Lee Y.L., Liao Y.K., Tsai H.J. Infectious bill atrophy syndrome caused by parvovirus in a co-outbreak with duck viral hepatitis in ducklings in Taiwan. Avian Dis. 1993;37:591–596. doi: 10.2307/1591694. [DOI] [PubMed] [Google Scholar]
  • 7.Palya V., Zolnai A., Benyeda Z., Kovács E., Kardi V., Mató T. Short beak and dwarfism syndrome of mule duck is caused by a distinct lineage of goose parvovirus. Avian Pathol. 2009;38:175–180. doi: 10.1080/03079450902737839. [DOI] [PubMed] [Google Scholar]
  • 8.Chen H., Dou Y., Tang Y., Zhang Z., Zheng X., Niu X., Yang J., Yu X., Diao Y. Isolation and Genomic Characterization of a Duck-Origin GPV-Related Parvovirus from Cherry Valley Ducklings in China. PLoS ONE. 2015;10:e0140284. doi: 10.1371/journal.pone.0140284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Soliman M.A., Erfan A.M., Samy M., Mahana O., Nasef S.A. Detection of Novel Goose Parvovirus Disease Associated with Short Beak and Dwarfism Syndrome in Commercial Ducks. Animals. 2020;10:1833. doi: 10.3390/ani10101833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Dong H.V., Tran G.T.H., Nguyen H.T.T., Nguyen T.M., Trinh D.Q., Le V.P., Choowongkomon K., Rattanasrisomporn J. Epidemiological Analysis and Genetic Characterization of Parvovirus in Ducks in Northern Vietnam Reveal Evidence of Recombination. Animals. 2022;12:2846. doi: 10.3390/ani12202846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ning K., Liang T., Wang M., Dong Y., Qu S., Zhang D. Pathogenicity of a variant goose parvovirus, from short beak and dwarfism syndrome of Pekin ducks, in goose embryos and goslings. Avian Pathol. 2018;47:391–399. doi: 10.1080/03079457.2018.1459040. [DOI] [PubMed] [Google Scholar]
  • 12.Chen H., Dou Y., Tang Y., Zheng X., Niu X., Yang J., Yu X., Diao Y. Experimental reproduction of beak atrophy and dwarfism syndrome by infection in cherry valley ducklings with a novel goose parvovirus-related parvovirus. Vet. Microbiol. 2016;183:16–20. doi: 10.1016/j.vetmic.2015.11.034. [DOI] [PubMed] [Google Scholar]
  • 13.Komaroff M. Historical review of developing body weight indices: Meaning and purpose. Adv. Obes. Weight Manag. Control. 2017;6:184–192. doi: 10.15406/aowmc.2017.06.00177. [DOI] [Google Scholar]
  • 14.Mohajan D., Mohajan H. Ponderal Index: An Important Anthropometric Indicator for Physical Growth. J. Innov. Med. Res. 2023;6:15–19. doi: 10.56397/JIMR/2023.06.03. [DOI] [Google Scholar]
  • 15.Morris S.S., Victora C.G., Barros F.C., Halpern R., Menezes A.M., César J.A., Horta B.L., Tomasi E. Length and ponderal index at birth: Associations with mortality, hospitalizations, development and post-natal growth in Brazilian infants. Int. J. Epidemiol. 1998;27:242–247. doi: 10.1093/ije/27.2.242. [DOI] [PubMed] [Google Scholar]
  • 16.Peterson C.M., Su H., Thomas D.M., Heo M., Golnabi A.H., Pietrobelli A., Heymsfield S.B. Tri-Ponderal Mass Index vs Body Mass Index in Estimating Body Fat During Adolescence. JAMA Pediatr. 2017;171:629–636. doi: 10.1001/jamapediatrics.2017.0460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Seo Y.J., Shim Y.S., Lee H.S., Hwang J.S. Metabolic risk assessment in children and adolescents using the tri-ponderal mass index. Sci. Rep. 2022;12:10094. doi: 10.1038/s41598-022-13342-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wiebe N., Lloyd A., Crumley E.T., Tonelli M. Associations between body mass index and all-cause mortality: A systematic review and meta-analysis. Obes. Rev. 2023;24:e13588. doi: 10.1111/obr.13588. [DOI] [PubMed] [Google Scholar]
  • 19.Wu Y., Li D., Vermund S.H. Advantages and Limitations of the Body Mass Index (BMI) to Assess Adult Obesity. Int. J. Environ. Res. Public Health. 2024;21:757. doi: 10.3390/ijerph21060757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kumar S., Stecher G., Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Laboratory Animals -General Code of Animal Welfare. National Market Supervision and Administration; National Standardization Management Committee; Beijing, China: 2022. [Google Scholar]
  • 22.Matczuk A.K., Chmielewska-Władyka M., Siedlecka M., Bednarek K.J., Wieliczko A. Short Beak and Dwarfism Syndrome in Ducks in Poland Caused by Novel Goose Parvovirus. Animals. 2020;10:2397. doi: 10.3390/ani10122397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li Y., Jia J., Mi Q., Li Y., Gao Y., Zhu G., Wang J. Molecular characteristics and phylogenetic analysis of novel goose parvovirus strains associated with short beak and dwarfism syndrome. Arch. Virol. 2021;166:2495–2504. doi: 10.1007/s00705-021-05145-4. [DOI] [PubMed] [Google Scholar]
  • 24.Zhan G., Liu N., Fan X., Jiang W., Yuan M., Liu Y., Dong S. Genome cloning and genetic evolution analysis of eight duck-sourced novel goose parvovirus strains in China in 2023. Front. Microbiol. 2024;15:1373601. doi: 10.3389/fmicb.2024.1373601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bian G., Ma H., Luo M., Gong F., Li B., Wang G., Mohiuddin M., Liao M., Yuan J. Identification and genomic analysis of two novel duck-origin GPV-related parvovirus in China. BMC Vet. Res. 2019;15:88. doi: 10.1186/s12917-019-1833-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ning K., Liang T., Wang M., Dong Y., Qu S., Zhang D. Genetic detection and characterization of goose parvovirus: Implications for epidemiology and pathogenicity in Cherry Valley Pekin ducks. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2017;51:101–103. doi: 10.1016/j.meegid.2017.03.024. [DOI] [PubMed] [Google Scholar]
  • 27.Zhang Q., Sun Y., Sun Y., Zhang H., Yang R. Expression of VP2 protein of novel goose parvovirus in baculovirus and evaluation of its immune effect. Microb. Pathog. 2024;195:106751. doi: 10.1016/j.micpath.2024.106751. [DOI] [PubMed] [Google Scholar]
  • 28.Xiao S., Wang S., Jiang D., Cheng X., Zhu X., Lin F., Yu B., Dong H., Wang X., Munir M., et al. VP2 virus-like particles elicit protective immunity against duckling short beak and dwarfism syndrome in ducks. Transbound. Emerg. Dis. 2022;69:570–578. doi: 10.1111/tbed.14021. [DOI] [PubMed] [Google Scholar]
  • 29.Guo T., Zheng S., Chen T., Chu C., Ren J., Sun Y., Wang Y., He M., Yan Y., Jia H., et al. The association of long-term trajectories of BMI, its variability, and metabolic syndrome: A 30-year prospective cohort study. EClinicalMedicine. 2024;69:102486. doi: 10.1016/j.eclinm.2024.102486. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kinder F., Giannoudis P.V., Boddice T., Howard A. The Effect of an Abnormal BMI on Orthopaedic Trauma Patients: A Systematic Review and Meta-Analysis. J. Clin. Med. 2020;9:1302. doi: 10.3390/jcm9051302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Candelli M., Pignataro G., Saviano A., Ojetti V., Gabrielli M., Piccioni A., Gullì A., Antonelli M., Gasbarrini A., Franceschi F. Is BMI Associated with COVID-19 Severity? A Retrospective Observational Study. Curr. Med. Chem. 2023;30:4466–4478. doi: 10.2174/0929867330666230206095923. [DOI] [PubMed] [Google Scholar]
  • 32.Empringham B., Jennings W.J., Rajan R., Fleming A.J., Portwine C., Johnston D.L., Zelcer S.M., Rassekh S.R., Tran V., Burrow S., et al. Leptin is Associated with the Tri-Ponderal Mass Index in Children: A Cross-Sectional Study. Adolesc. Health Med. Ther. 2021;12:9–15. doi: 10.2147/AHMT.S289973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhang S. Ph.D. Thesis. Shandong Agricultural University; Tai’an, China: 2023. Molecular Mechanism of Inhibition of DuckSkeletal Development by a Novel GooseParvovirus Infection. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Articles from Veterinary Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES