Zinc Finger Protein 706 Gene a Potential Diagnostic and Therapeutic Target in Hepatocellular Carcinoma: Implications for Cancer Biotechnology

Abstract

Background:

Zinc finger proteins, particularly Zinc Finger Protein 706 (ZNF706), have been implicated in various cancers, yet their functional and clinical significance in hepatocellular carcinoma (HCC) remains unclear. Identifying novel biomarkers and therapeutic targets is essential for improving HCC diagnosis and treatment.

Objectives:

To investigate the functional role of ZNF706 in HCC and evaluate its potential as a diagnostic and therapeutic target with biotechnological applications.

Materials and Methods:

Bioinformatic analyses were performed using clinical and transcriptomic data from TCGA and GTEx databases to assess ZNF706 expression and its correlation with clinicopathological features and patient prognosis. Quantitative PCR and Western blotting validated ZNF706 expression in liver epithelial and HCC cell lines. Functional assays, including CCK-8, flow cytometry, and Transwell migration/invasion assays, were conducted following ZNF706 knockdown.

Results:

ZNF706 was significantly overexpressed in HCC tissues and cell lines compared to normal controls. High ZNF706 expression correlated with advanced TNM stage, pathological stage, and poor survival outcomes. Knockdown of ZNF706 inhibited proliferation, migration, and invasion, and increased apoptosis in HCC cells. ROC analysis demonstrated high diagnostic accuracy (AUC > 0.90) for ZNF706 in distinguishing HCC and predicting prognosis.

Conclusions:

ZNF706 is a promising biomarker for HCC diagnosis and prognosis and represents a potential therapeutic target for biotechnological intervention. These findings support the development of ZNF706-based diagnostic assays and targeted therapies for improved management of HCC.

1. Background

Hepatocellular carcinoma (HCC) is one of the most common cancers, and its incidence rate has been rising in the past 30 years and may continue to 2030 ( 1 , 2 ). The influencing factors of HCC include hepatitis B virus, hepatitis C virus, non-alcoholic steatohepatitis associated with metabolic syndrome or diabetes ( 2 , 3 ). Therapeutic strategies for HCC encompass orthotopic liver transplantation, surgical resection, ablation technology, radiotherapy, chemotherapy, and targeted treatment ( 4 ). Although these treatments provide opportunities for long-term response, the recurrence rate and mortality rate are still high ( 2 ).

Among transcription factors, zinc finger (ZNF) proteins comprise the largest family ( 5 ). ZNF family members have finger-like DNA binding motifs, such as Cys₂His₂ (C₂H₂) like and TAZ2 domain-like, exhibiting interactions with substrates such as lipids, and nucleic acids (DNA and RNA) ( 5 , 6 ). ZNF706 is localized on chromosome 8q22 3. ZNF706 shows potential as an early diagnostic biomarker for rheumatoid arthritis ( 7 ). ZNF706 is overexpression in laryngeal cancer, gastric cancer, and HCC ( 8 - 10 ). However, the specific function of ZNF706 in diseases is less studied. A recent study showed that elevated ZNF706 levels correlated with reduced survival in HCC patients, whereas its genetic ablation suppressed HCC progression in experimental models ( 8 ).

2. Objectives

This study aimed to analyze the expression and clinical significance of ZNF706 in HCC using bioinformatics approaches and large-scale transcriptomic datasets, evaluate the potential of ZNF706 as a diagnostic and prognostic biomarker for HCC, investigate the functional role of ZNF706 in regulating proliferation, migration, invasion, and apoptosis of HCC cells through in vitro experiments, and assess the translational and biotechnological potential of ZNF706 as a novel target for the diagnosis and targeted therapy of HCC.

3. Materials and Methods

3.1. Expression Characteristics and Clinical Correla-tion of ZNF706 In HCC

HCC clinical and transcriptomic profiles were obtained from public repositories: The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) databases. Clinical data processing and expression matrix derivation were performed using R, while Perl scripts filtered mRNA transcripts by excluding non-coding RNA profiles. The transcriptome data were background corrected and normalized. Bioinformatic screening identified differentially expressed mRNAs based on predefined thresholds: p.adj < 0.05 and|log2FC| ≥ 1.00. Heat map of differentially expressed gene expression matrix in HCC was drawn. The expression of ZNF706 was extracted by ggplot2, stats, and car.R package, and the expression differences between unpaired samples and paired samples between the two groups were compared. The deseq2 package was used to perform single gene difference analysis on the original counts matrix of the selected public data, and the ComplexHeatmap package was used to further visualize the expressed genes of single gene difference analysis, and the related expression heat map was constructed according to its clinical characteristics.

3.2. Correlation Between Znf706 Expression and Sur-vival, As Well As Prognosis

Stratified by ZNF706 expression levels, HCC cohorts underwent prognostic analysis, including Receiver Operating Characteristic (ROC) curves, Overall Survival (OS), Disease-Specific Survival (DSS), and Progression-Free Interval (PFI) assessments at 1/3/5-year intervals.

3.3. Cell Culture

Immortalized liver epithelial cells THLE-2, Hep3B, and 97H were cultured in RPMI 1640 medium (Gibco), MEM medium (Gibco), and DMEM medium (Gibco), respectively. All media were supplemented with 10% fetal bovine serum (FBS; Gibco). Among these, THLE-2 serves as control cells, while Hep3B and 97H are HCC cell lines. All cells were expanded at 37 °C in a 5% CO₂ incubator.

3.4. Quantitative Polymerase Chain Reaction (qPCR)

The primer sequences (5’-3’) for qPCR were as follows:

H-GAPDH-F, CATCATCATCCCTGCCTCTACTGG; H-GAPDH-R, GTGGGTCGCTGTTGAAGTC; H-ZNF706-F, GGACATGACCAAAGGCTGC; H-ZNF706-R, TGCTCTCAAAGTGCTGCTGCTTG.

Triquick reagent (Sorbio, R1100) was used to extract total RNA. Total RNA (1 µg) underwent reverse transcription using 5× RT Supermix (APEXbio, K1074) for cDNA synthesis. 2 × SYBR Green qPCR Master Mix (APEXbio, K1070) was used for qPCR detection. The expression of ZNF706 was calculated using 2-^∆∆CT, with GAPDH as the internal reference.

3.5. Western Blot Analysis

ZNF706 (Thermo, PA5-68545, 1:1000) and GAPDH (Proteintech, 60004-1-Ig, 1:50000) were primary antibodies, Goat anti-mouse (Biosharp, BL001A, 1:50000) and Goat anti-rabbit (Biosharp, BL003A, 1:50000) were secondary antibodies. After the cells were lysed in RIPA buffer (Beyotime Biotechnology, Shanghai, China), the protein in the lysate was quantified using the bicinchoninic acid (BCA) Kit (Beyotime Biotechnology). After separating 15 µg proteins on 12% SDS-PAGE and transferring to polyvinylidene fluoride (PVDF) membranes, blocking with 5% bovine serum albumin (BSA) for 2 h preceded primary antibody incubation (20 h, 4 °C). Membranes were then washed with tris-buffered saline with tween (TBST), probed with secondary antibody for 2 h, and rewashed. Finally, the protein bands were observed after the membrane was incubated with enhanced chemiluminescence (ECL). Protein bands were quantified using ImageJ.

3.6. Transfection

Hep3B and 97H were transfected with negative control (NC), si-ZNF706-1, si-ZNF706-2, si-ZNF706-3 accor-ding to the instructions of Lipofectamine 3000 (Thermo Fisher Scientific). The cells were transfected for 48 h before subsequent detection.

3.7. Cell Counting Kit-8 (CCK-8)

CCK-8 detected the changes of cell proliferation. Cells (2000 cells per well) were added to 96-well plates, and 9 duplicate wells were set in each group. Then, 10% CCK-8 (3 wells each time) was added into well at 12, 24, and 48 h, respectively. The absorbance value was detected at 450 nm.

3.8. Apoptosis Detection

Resuspended cells in binding buffer (1 × 10⁵ in 100 µL) were taken into the flow tube. After co-staining with 5 µL Annexin V-FITC and PI (15 min, 25 °C dark), samples in binding buffer (400 µL) underwent flow cytometry.

3.9. Transwell Assay For Migration And Invasion

The experimental steps of Transwell for detecting migration and invasion are mostly the same, except that Matrigel (BD, 354234) needs to be pre-laid in the upper chamber of Transwell before the invasion experiment. Transwell chambers received upper compartment seeding (1×10⁵ cells in 100 μL medium) with 10% FBS medium (600 μL) in lower chambers. After 36 h incubation (37 °C, 5% CO₂), chambers were fixed in 4% paraformaldehyde (15 min), stained with 1% crystal violet (10 min) post-PBS washes, then non-migrated cells were removed by cotton swab prior to microscopic enumeration.

3.10. Statistical Analysis

Statistical analyses employed one-way ANOVA and Student’s t-test with significance threshold of P<0.05. The quantitative data showed as mean ± standard deviation. Graphics were drawn using GraphPad 7.0.

4. Results

4.1. Expression characteristics and clinical correlation of ZNF706 in HCC

Transcriptome expression data of HCC included 110 normal liver tissue samples, 50 adjacent non-tumor tissues and 371 HCC tissues. According to the criteria of p.adj < 0.05 and |log2FC| ≥ 1.00, 4531 differentially expressed mRNAs were screened out, and the heat map of differentially expressed genes of HCC was drawn (Fig. 1A). Further, ZNF706 expression and the general clinical data of patients with HCC were included for analysis. It was found that tumor TNM stage, pathological stage, and tumor status were closely related to ZNF706 expression (Fig. 1B).

Figure 1.

Expression characteristics and clinical correlation of ZNF706 in HCC. A) Heatmap of differentially expressed genes in HCC, including ZNF706. B) Heat map of correlation between clinical traits of HCC and ZNF706.

4.2. The Expression of ZNF706 in HCC

The expression differences between unpaired samples and paired samples between the two groups were compared. Results showed that ZNF706 was signi-ficantly overexpressed in HCC (Fig. 2A-2B).

Figure 2.

The expression of ZNF706 in HCC. A) unmatched samples. B) matched samples.

4.3. ZNF706 and Its Prognostic Significance in Early-Stage HCC

ROC analysis showed that the AUC was > 0.900, which means that ZNF706 has diagnostic significance for survival and prognosis (Fig. 3A). For the results of OS/DSS/PFI, patients with high ZNF706 expression had worse survival prognosis (Fig. 3B-3D). Multi-year survival ROC analysis demonstrated ZNF706’s high predictive value for early-stage HCC prognosis, especially showing high value in predicting 1-year survival outcomes with an AUC >0.85 (Fig. 3E-3G).

Figure 3.

Correlation between ZNF706 and survival, as well as prognosis. A) ROC, B) OS, C) DSS, D) PFI. E-G) ROC curves of patients with HCC at 1, 3, and 5 years.

4.4. Expression of ZNF706 in HCC Cells

ZNF706 overexpression in HCC cells was validated by qPCR and Western blot. (Fig. 4A-4B). Hep3B and 97H cells were transfected with siRNAs targeting ZNF706. qPCR and Western blot showed that si-ZNF706-2 and si-ZNF706-3 significantly reduced the expression of ZNF706, and si-ZNF706-2 had the strongest inhibition on ZNF706 expression, so it was selected for subsequent function detection (Fig. 4C-4D).

Figure 4.

ZNF706 expression in HCC cells. A) The expression of ZNF706 in THLE-2 (control cells), Hep3B, and 97H was detected by qPCR; and B) Western blot; C) Hep3B and 97H were transfected with NC, si-ZNF706-1, si-ZNF706-2, and si-ZNF706-3, respectively. Samples were collected at 48 h. The expression of ZNF706 was detected by qPCR; and D) Western blot. Statistical analyses employed one-way ANOVA, with significance threshold of P<0.05.

4.5. HCC Cell Malignant Behaviors (Proliferation/Migration/Invasion) are Attenuated By ZNF706 Depletion

Compared with the control group, knockdown of ZNF706 inhibited cell proliferation (Fig. 5A) and increased cell apoptosis (Fig. 5B). Meanwhile, knockdown of ZNF706 significantly reduced cell migration and invasion (Fig. 5C-5D).

Figure 5.

Knockdown of ZNF706 inhibits the proliferation, migration and invasion of HCC cells. Hep3B and 97H cells were transfected with NC/si-ZNF706-2, respectively. After 48 h, the cells were collected for CCK-8 to detect A) cell proliferation; B) flow cytometry to detect cell apoptosis; C) and Transwell to detect migration; and D) invasion. Statistical analyses employed Student’s t-test, with significance threshold of P<0.05.

5. Discussion

Based on the above results, this study found that ZNF706 expression related to the TNM stage, pathological stage, and tumor status, and had diagnostic value for the survival and prognosis. Hepatoma cell malignant behaviors (proliferation/migration/invasion) are attenuated by ZNF706 depletion. This study identifies ZNF706 as a translational target for HCC management.

HCC is the sixth most common malignant tumor and ranks fourth in global cancer-related mortality ( 11 ). The following cancer characteristics can be found in HCC: upregulated telomerase-cyclin axis induces neoplastic transformation via proliferation dyscontrol, genomic instability, and multi-pathway dysregulation encompassing oxidative/metabolic/ER stress ( 12 , 13 ). HCC prognosis correlates with staging: 5-year survival declines from 36% (early-stage) to 13% (metastatic) ( 14 ). The basis for staging is tumor size and quantity, lymph node spread, metastasis, vascular invasion, liver function, and potential liver disease factors ( 15 ). Early detection of HCC is crucial, but the reality is that it is only diagnosed when symptoms are obvious, usually in the late stages. Therefore, effective monitoring and diagnosis can prolong patients’ lives and reduce economic expenditures ( 19 , 20 ). This study found that ZNF706 is closely related to the following characteristics of HCC: TNM stage, pathological stage, and tumor status. In addition, ZNF706 has great value in the diagnosis, survival, and prognosis of HCC. Therefore, we speculated that ZNF706 potentially drives HCC initiation and progression.

Transcriptional abnormalities are usually associated with transcription factors ( 21 ). ZNF protein is the largest family of transcription regulators in mammals. It has a variety of zinc finger domains (such as C₂H₂, PHD domains) to participate in a variety of life activities, such as proliferation, apoptosis, and DNA damage ( 22 ). For example, ZNF-148 is up-regulated in breast cancer cells and promotes malignant phenotypes (such as proliferation and epithelial-mesenchymal transformation) ( 23 ). ZNF-714 promotes malignant behaviors (proliferation/migration/invasion) ( 24 ). ZNF-281 demonstrates diagnostic utility in oral squamous cell carcinoma detection ( 25 ). It can be seen that ZNF protein is involved in the progress and diagnosis of cancer. ZNF706 has a C₂H₂ domain. The C₂H₂ domain (28-30aa) is a left-handed ββα structure ( 26 ). ZNF706 is abnormally expressed in various diseases, such as early rheumatic arthritis, laryngeal squamous cell carcinoma, and gastric cancer ( 9 , 10 , 27 ). However, there is still little research on the function of ZNF706 in diseases. The latest research shows that ZNF706 is highly expressed in HCC, positively correlated with cell proliferation, and may be associated with poor survival ( 8 ). We found that ZNF706 is highly expressed in HCC tissues and cell lines, and knocking out ZNF706 inhibits cell proliferation. In addition, we also found that inhibiting ZNF706 expression reduces cell migration and invasion, but promotes cell apoptosis.

However, several limitations need to be addressed in future studies. For example, the upstream regulatory mechanisms of ZNF706 were not explored in this study and should be further investigated to fully understand its role in HCC. Additionally, while the findings of this study are valuable, the lack of in vivo validation through animal experiments limits the ability to generalize the conclusions. Furthermore, the relatively small clinical sample size (371 cases) may affect the stability and reliability of the prognostic analysis, and larger, more diverse sample sizes are needed to validate these results. Finally, additional clinical samples should be collected to further monitor ZNF706 expression and its correlation with clinical data, which will help clarify its potential as a diagnostic and prognostic biomarker for HCC. More comprehensive exploration of the mechanisms underlying ZNF706’s action is also necessary to guide future therapeutic strategies.

6. Conclusions

This study demonstrates that ZNF706 is significantly overexpressed in HCC and is closely associated with advanced clinicopathological features and poor prognosis. Functional experiments reveal that silencing ZNF706 effectively inhibits proliferation, migration, and invasion of HCC cells, while also promoting apoptosis. Importantly, these results highlight ZNF706 as a promising biomarker for early-stage HCC diagnosis and prognosis, with strong predictive value for patient outcomes. Additionally, ZNF706 shows potential as a therapeutic target for developing novel biotechnological interventions. The findings provide a foundation for future translational research aimed at developing ZNF706-based diagnostic assays and targeted therapies to improve clinical management of HCC.