Losartan alleviated synovitis in patients with metabolic osteoarthritis by down-regulating AT1R to inhibit TGF-β signaling

Abstract

Previous studies have shown that losartan can alleviate the progression of osteoarthritis (OA). This study aimed to further explore the therapeutic effect and mechanism of losartan on metabolic OA. In obese OA patients, we found that patients with BMI > 28 had higher synovitis score and higher expression of inflammatory factors compared with BMI < 23, and angiotensin receptor type 1(AT1R) expression were also significantly increased. In high-fat diet (HFD) rat model, the HFD group had higher synovitis scores and OARSI scores, significantly increased expression of inflammatory factors in synovium (SM), significantly decreased matrix synthesis genes and increased degradation genes in cartilage. However, they were significantly alleviated in the HFD + losartan group. In the HFD group, AT1R expression was significantly increased in SM, but was significantly decreased after losartan administration. In vitro co-culture experiments showed that sodium palmitate (PA) could concentration-dependently promote the production of inflammatory factors in fibroblast-like synoviocytes (FLS) and the reduction of extracellular matrix in chondrocytes, while losartan could reverse these effects. In addition, PA could promote of AT1R/TGF-β/Smad2/3 pathway in FLS, which was reversed by either AT1R siRNA or losartan. In summary, we demonstrated that losartan alleviates synovial inflammation in patients with metabolic OA by down-regulating AT1R to inhibit TGF-β/Smad2/3 signaling pathway in SM.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13018-025-06443-2.

Introduction

Osteoarthritis (OA) is a chronic osteoarthropathy with high disability rate. The pathological changes are characterized by the degradation and reduction of articular cartilage matrix, osteophyte formation and synovial aseptic inflammation. The pathological changes involve the whole joint, including cartilage, synovium and subchondral bone [1]. The traditional view is that OA is related to factors such as aging and trauma, but more and more epidemiological and biological evidence shows that OA is not only a degenerative disease related to aging or mechanical stress, but caused by multiple factors such as "metabolic disorders" and "inflammatory aging" [2]. Therefore, OA is considered to be a metabolic disease, called "metabolic OA", which was listed as the fifth component of metabolic syndrome (with obesity, hypertension, dyslipidemia, and hyperglycemia) [3]. In recent years, with the development of social economy, the dietary structure of residents has also changed, in which the number of people with obesity due to high-fat and high-calorie diet is also increasing. The body with excessive weight gain has abnormal metabolism, which in turn cause disorders of musculoskeletal homeostasis. It is known that metabolic alterations play an important role in the occurrence and development of OA [4, 5]. Previous studies of our team have shown that the model of OA induced by high-fat diet (HFD) is stable and reliable [6]. This model is an effective model to study the relationship between metabolic factors and OA.

Articular cartilage, the core tissue of OA pathological changes, is an inert tissue without blood vessels, lymph and nerves, and exists within a hypoxic environment. It is less affected by the systemic and external environment. The synovium (SM) is located in the inner layer of the joint capsule, which is composed of loose connective tissue. The SM layer is a deformable and firm tissue structure that supports joint movement. SM is a hypervascular, normoxic tissue that is sensitive to systemic metabolic changes. The reticular synovial layer is attached to the cartilage surface, creating a barrier for the articular cartilage to protect it from systemic factors, acting as a semi-permeable membrane to allow the passage of small plasma solutes, and secreting synovial fluid to lubricate the articular cartilage, which is essential for the supply of nutrients to the avascular chondrocytes. OA is a low-grade chronic inflammatory disease of the whole joint dominated by synovitis [7]. The swelling, effusion and severity of OA joints are closely related to synovitis [8]. Previous studies had shown that the earliest pathological change of OA is the change of synovial fluid secretion [9]. In fact, when joint pain occurs, tissue lesions have already occurred in SM. In conclusion, the SM is the core connective tissue of the systemic metabolic factors acting on the articular cartilage. In the early stage of OA, the pathological changes of SM will promote the occurrence of OA.

Renin-angiotensin system (RAS) mainly includes renin, angiotensin Ⅱ (AngⅡ), angiotensin converting enzyme (ACE), AngⅡ receptor type 1 (AT1R), AT2R, etc. In recent years, studies have shown that RAS plays an important role in the occurrence and development of metabolic diseases such as obesity [10]. Clinical and animal studies have found that RAS is over-activated in obese patients/animals, as shown by significantly higher levels of angiotensinogen (AGT) and AngⅡ in the serum [11]. Studies also had found that renin, ACE, AT1R and AT2R are expressed in the synovial tissue of humans and animals and participate in the occurrence of OA [12, 13]. It has been established that Ang II induces inflammation through AT1R, and AT1R has been widely confirmed to be associated with fibrosis in many tissues such as kidney, liver and heart, and its mechanism of action involves the inhibition of transforming growth factor-β (TGF-β) production and Smad protein activation [14]. Indeed, the role of TGF-β in fibrogenesis remains indisputable in various models and diseases, including OA. In the rat knee joint, targeted overexpression of TGF-β/Smad2/3 pathway is sufficient to promote an aggressive fibrotic phenotype, including SM [15].

Losartan, an angiotensin receptor antagonist (ARB), is a selective AT1R antagonists, can reduce the expression of pro-inflammatory cytokines [16, 17]. Price et al. confirmed that losartan reduced acute joint inflammation in a dose-dependent manner and that prophylactic losartan inhibited the development of adjuvant arthritis [18]. Further in vitro studies found that losartan inhibited the production of synovial inflammatory factors in RA patients in a dose-dependent manner [19]. In addition, studies have reported that losartan can be used as an antifibrotic agent to treat early post-traumatic joint stiffness [20], and can also reduce articular cartilage degeneration in temporomandibular joint OA [21]. These studies highlight the therapeutic potential of losartan in delaying the progression of OA. It is worth mentioning that there are no animal studies investigating the therapeutic effect of losartan in metabolic OA, especially targeting the SM. Therefore, the present study aimed to investigate the therapeutic potential of losartan in metabolic OA and its underlying mechanisms.

Therefore, in this study, we first analyzed the inflammatory changes of knee synovial tissue in OA patients with obesity and its relationship with RAS system. Then, Wistar rats were fed with HFD to establish metabolic OA model, and at the same time, the AT1R inhibitor losartan was given to observe the protective effect on metabolic OA. Furthermore, we explore its possible mechanism in vitro. This study is intended to provide effective experimental evidence for the clinical treatment of metabolic OA.

Materials and methods

Chemicals and reagents

Losartan Potassium, Sodium palmitate (PA) and Triton X100 (No. T8532) were obtained from Sigma-Aldrich (Shanghai) Trading Co.Ltd. (Shanghai, China); Isoflurane was purchased from Baxter Healthcare (Deerfield, IL, USA); The TRIzol kits was purchased from Invitrogen (Carlsbad, CA, USA); Collagenase type Ⅰ and type Ⅱ was purchased from BioFroxx(Bruckberg, Germany); F-12 (DMEM/F12) was purchased from HyClone Co. (Logan, UT, USA); Fetal bovine serums (FBS) and trypsin were supplied by Gibco (Detroit, MI, USA). Enhanced cell counting kit-8 (CCK8), loading buffer and 4',6-diamidino-2-phenylindole (DAPI) (No.C1002) was purchased from Beyotime Biotechnology (Shanghai, China). Penicillin/streptomycin was purchased from Sangon (Shanghai, China). Reverse transcription kits were provided by Takara Biotechnology (Dalian, Liaoning, China). The SYBR Green qPCR master mix kits, RIPA Lysis Buffer, Phenylmethanesulfonyl fluoride (PMSF) and lipofectamine 3000 were purchased from Applied Biosystems through Termo Fisher Scientifc (ABI, Foster City, CA, USA). DAB staining kit was purchased from Gene Tech Company, Ltd. (Shanghai, China). Western Bright ECL HRP substrate was purchased from Advansta (Menlo Park, CA, USA). The antibody information are as follows: The antibodies for ACE (ab11734) and AT1R (ab9391) were purchased from abcam (Shanghai, China); The antibodies for tumor necrosis factor-alpha (TNF-α) (GB11188-100), interleukin 1 beta (IL-1β) (GB11113-100), interleukin 6 (IL-6) (GB11117-100), matrix metallopeptidase 13 (MMP13) (GB11247-100), ADAM metallopeptidase with thrombospondin type 1 motif 5 (ADAMTS5) (GB11807-100), Collagen Type II Alpha 1 Chain (COL2A1) (GB11021-100) and 10% ethylenediaminetetraacetic acid (EDTA) were purchased from Servicebio (Wuhan, China); The antibodies for transforming growth factor beta 1 (TGF-β) (A23262), Smad2/3 (A18674), p-Smad2/3 (AP1343), aggrecan (A11691), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (AC002), HRP goat anti-mouse IgG (AS003), HRP goat anti-rabbit IgG (AS014) were purchased from ABclonal Biotech Co., Ltd (Wuhan, China). The siRNA oligonucleotides against AT1R were purchased from Shanghai GenePharma Co. Ltd. (Shanghai, China). The other chemicals and agents were analytical grade.

Clinical synovial specimens

Synovial specimens were collected from patients who underwent total knee replacement during hospitalization from 2021-01-01 to 2022-12-31 (n = 10 /group, aged between 50 and 70 years old, grade 4 by Kellgren & Lawrence classification for knee OA). According to body mass index (BMI) at admission, patients were divided into control group (BMI < 23) and overweight group (BMI > 28). Where, BMI = weight (kg)/height^2 (m²). The collected synovial tissue was transferred to wet gauze containing 0.9% normal saline immediately, trimmed, and then transferred to 10% formalin for fixation or frozen at − 80 °C for subsequent morphology and real-time quantitative PCR (RT-qPCR) analysis. The exclusion criteria for specimens were the presence of a major disease such as cancer or diabetes, a history of knee surgery and articular injection, in order to ensure that the original synovial tissue was collected. The protocol used in this study complies with the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the Medical Ethics Committee of Zhongnan Hospital, Wuhan University (No.2019018). All procedures involved were performed with the patient's written informed consent.

Animals and treatment

Specific pathogen-free Wistar rats [2020-0018, accreditation number 42000600043615, license number SCXK 2020-0018 (Hubei Province, China)] were purchased from the Experimental Centre of Hubei Medical Academy (Wuhan, China). Animal experiments were performed at the Wuhan University Animal Experiment Centre (Wuhan, China), accredited by the Association for the Accreditation of Laboratory Animal Care and Assessment International (AAALAC International). The protocol was approved by the Wuhan University School of Medicine Animal Experimentation Ethics Committee (license number: ZN2021222). All experimental animal procedures were performed in accordance with the regulations of the China Animal Welfare Committee.

Wistar rats were kept in a climate-controlled room with the following parameters: room temperature of 18–22 °C, 40%–60% humidity, photoperiod of 12 h of light and dark, and 10–15 air changes per hour. After one week acclimatization, nine-week-old wistar rats were randomly assigned into three groups: normal diet (Control), high fat diet (HFD) and HFD + Losartan (n = 10). For HFD modeling, Wistar rats received a normal diet chow (D12450J, 10% dietary fat) and HFD chow (D12451, 45% dietary fat) from the 9th week to 18th week. The HFD + Losartan group rats were received 15 mg/kg Losartan (1 mg/ml) by intragastric administration every day starting from the 14th week [18, 22]. The rats in the control group were administered with an equal volume of normal saline. At 18 weeks after birth, the rats were euthanized after being given 2% isoflurane anesthesia, and the tissues were collected for further data analysis. All feeds were purchased from Keao Xieli Feed Co., Ltd. (Beijing, China). Figure 1 was an overview of animal handling procedure. Evidence for the success of the HFD model is provided in Supplementary Data 2.

Fig. 1.

The overview of animal handling procedure. HFD, high-fat diet

Primary cells extraction

The rats were euthanized by dislocation after anesthesia and immersed in 95% alcohol for 15 min. The skin was cut in the middle of the knee joint to expose the knee joint. The isolated synovial and cartilage tissues were immersed in PBS solution containing 1% penicillin/streptomycin for 5 min, and then rinsed with PBS solution for 3 times. The tissue was divided into 1 mm × 1 mm pieces by ophthalmic scissors, and then digested with about 6 ml collagenase type Ⅰ (for synovium) and type Ⅱ (for cartilage) containing 20% FBS (collagenase concentration was 4 mg/ml). After digestion at 37 °C in a 5% CO2 incubator for 6–8 h, the cell suspension was mixed, and centrifuged at 1000 rpm for 10 min. The supernatant was discarded and resuspended in DMEM F12 media containing 20% FBS. Primary cells were seeded at a density of 1.0 × 10⁵ cells/cm². The fibroblast-like synoviocytes (FLS) and primary chondrocytes were cultured with F12 containing 20% FBS and 1% penicillin/streptomycin at 37 °C with 5% CO₂. When the density of primary cells reached 70%–80%, the cells were digested with 0.25% trypsin and subcultured into a new sterile culture flask at a ratio of 1:2 ~ 1:3. Subsequent experiments were performed with third- to fourth-generation primary cells.

Co-culture assay and treatment

In order to simulate the physiological environment of synovium and cartilage, and investigate the effect of soluble factors released by FLS on chondrocytes, a non-contact co-culture model was established. Transwell cell culture inserts (No.14312, pore size: 0.4 μm, LABSELECT, Anhui, China) were used in this study. To investigate the role of synovium in the development and progression of OA associated with HFD, chondrocytes (5 × 10⁴ cells/well) were seeded in the lower layer to minimize direct effects of PA on chondrocytes, and cell adherent slides were placed in the lower layer if chondrocytes were used for cellular immunofluorescence (IF). FLS were cultured in the upper layer (1 × 10⁴ cells/well) and they were cultured in F12 with 10% FBS and 1% penicillin/streptomycin at 37 °C with 5% CO₂. FLS were treated with different concentrations of PA (0, 50, 100 and 200 μM) aqueous solution for 48 h to establish a high-fat cell model. The co-culture experimental group included co-culture of chondrocytes and FLS with 0, 50, 100 and 200 μM PA, co-culture of chondrocytes and FLS with 0, 200 μM PA, 200 μM PA + losartan, 200 μM PA + AT1RsiRNA. Co-cultures were conducted in technical triplicate for each assay, and three random fields of each well were selected for evaluation. For transfection, AT1RsiRNA were transfected into FLS using Lipofectamine 3000 according to the manufacturer's protocol. We used AT1RsiRNA at a concentration of 100 nM and transfected AT1RsiRNA for 8 h after cell adherence. The knockdown efficiency of AT1RsiRNA was higher than 50% which evaluated by RT-qPCR and Western blotting (WB).

Cell viability assay

Cell viability was assessed using a CCK-8 assay kit. In brief, FLS (5 × 10³ cells/well) were seeded in medium (100 μL/ well) in a 96-well plate. After attachment, they were treated with different concentrations of PA (0, 50, 100, 200, 400 and 800 μM) aqueous solution for 24/48/72 h. After treatment, FLS were incubated with 10% CCK8 for 2 h in the dark. Absorbance at 450 nm was recorded on a microplate spectrophotometer. According to the literature report [23], and combined with our CCK-8 assay results, we selected 50, 100 and 200 μM PA treatment for 48 h for the in vitro experiments of the subsequent study. Therefore, the concentration selection of PA in vitro experiments in this study was reasonable.

Histological and immunohistochemistry (IHC) evaluations

Human synovial specimens and rat intact knee tissues were fixed in 10% formalin solution for 48–72 h, then decalcified with 10% EDTA for 3 weeks, embedded in paraffin and divided longitudinally into 4 μm-thick sections. Paraffin sections were then stained with hematoxylin/eosin (H&E) and safranin-O/fast green staining to observe general morphology and proteoglycan content followed by semi-quantitative evaluation using the Synovitis score and the Osteoarthritis Research Society International (OARSI) scoring system [24, 25]. For IHC, paraffin sections were first dewaxed to water, then antigen repair was performed in a microwave oven with EDTA antigen repair buffer (medium heating for 8 min to boil, cease fire for 8 min and turn to low heating for 7 min). Paraffin sections were incubated with 3% H₂O₂ solution in the dark at room temperature for 25 min, washed 3 times with PBS, and blocked with 3%BSA (Roche, USA) for 30 min at room temperature. Anti-AT1R, anti-ACE, anti-TNF-α, anti-IL-1β, anti-IL-6, anti-COL2a1, anti-aggrecan, anti-ADAMTS5 and anti-MMP13 antibodies (1:200 dilution) were added and incubated in a wet box at 4 °C overnight. HRP goat anti-rabbit or HRP anti-mouse IgG (diluted 1:5000) secondary antibodies was incubated at room temperature for 1 h, peroxidase activity was measured using a DAB staining kit. Positive immunostaining were absent in negative controls in which the primary antibody was omitted. The above semi-quantitative analyses were performed with Fiji software (ImageJ version 1.53c) [26]. Five randomly histology sections were selected and scored in a blinded way by two independent investigators. All images were captured using a light microscope (Nikon, Tokyo, Japan).

Total RNA extraction, reverse transcription and RT-qPCR

Total RNA was extracted utilizing the TRIzol kits according to the manufacturer’s protocol. The concentration and purity of the isolated total RNA were determined using a spectrophotometer (NanoDrop 2000C, Thermo) and the total RNA concentration was adjusted to 1 μg/μL. To convert the total RNA to cDNA, we performed the conversion according to reverse transcription kit, the total system was prepared to 16 μL and reverse transcribed to cDNA. Then, RT-qPCR was performed using the SYBR Green qPCR Master Mix kit and an ABI Step One RT-qPCR thermal cycler (ABI Step One, USA), cycling 40 cycles. The cycle threshold (Ct) was detected and the relative expression of the gene was determined using the 2-^ΔΔCT method, normalized to the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). All primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The sequences of the primers used in this experiment are shown in Table 1.

Table 1.

Oligonucleotide primers and PCR conditions for real-time quantitative PCR

Species	Genes	Forward primer	Reverse primer
Human	GAPDH	ACATCGCTCAGACACCATG	TGTAGTTGAGGTCAATGAAGGG
	ACE	TATAACCAGGAGTGGTGGAG	GGAACTGGAACTGGATGATG
	AT1R	CTGGCCCTTTGGCAATTA	ATGATGCAGGTGACTTTGG
	AT2R	CTCTTTGGACCTGTGATGTG	GATGCTTGCCAGGGATTT
	ACE2	TGGACCGACAACGAAATG	TGGGTGAAGTGACAAAGAAG
	MasR	GGGAACCTGCATAACATCTC	AGGTTGCATCTCGTCTTTG
	TNF-α	GCCACCACGCTCTTCTGT	GGCAGCCTTGTCCCTTGA
	IL-1β	TGGGAAGCCAGTGGAAATG	CCATGCAATGGGTAGGATGAG
	IL-6	CACTGCCTTCCCTACTTC	GCATCATCGCTGTTCATAC
	MMP13	TGACCTGGGATTTCCAAAAGAG	GTCTTCCCCGTGTCCTCATT
RAT	GAPDH	GTCGGTGTGAACGGATTT	GCCGTGGGTAGAGTCATA
	ACE	CGTCAACTTCCTGGGTATG	GGAGGCTGTGATGGTTATG
	AT1R	GCTGGGCCTTACCAAGAATA	TTTCAGGAGCTGGAGGAAATAC
	AT2R	TCCCTGGCAAGCATCTTATG	GACTTGGTCACGGGTAATTCT
	TNF-α	CCCACGTCGTAGCAAAC	AGAGAACCTGGGAGTAGATAAG
	IL-1β	CCTGTCCTGTGTGATGAAAG	AACTGTGCAGACTCAAACTC
	IL-6	CCAGAGTCATTCAGAGCAATAC	GTCCTTAGCCACTCCTTCT
	MMP13	CCCTGATGTTTCCCATCTATAC	GTCACACTTCTCTGGTGTTT
	COL2A1	CAGGTCCTCCTGGATATTGT	CCCGTAGTCATCCTCGTATT
	ACAN	GACTGGAGAAAGTCCAGAAAC	GCACAGTGATGTCCTCTATTC
	ADAMTS5	GCAACAAAGTGGGACTACA	GAGAGAATGCATCCCTTAGC
	TGF-β	GGCAGCTGTACATTGACTT	GGGTTGTGTTGGTTGTAGAG

GAPDH, glyceraldehyde 3-phosphate dehydrogenase; ACE, angiotensin-converting enzyme; AT1R, angiotensin receptor type 1; AT2R, angiotensin receptor type 2; ACE2, angiotensin-converting enzyme 2; MasR, MAS1 proto-oncogene, G protein-coupled receptor; TNF-α, tumor necrosis factor-alpha; IL-1β, interleukin 1 beta; IL-6, interleukin 6; MMP13, matrix metallopeptidase 13; COL2A1, collagen type II alpha 1 chain; ACAN, aggrecan; ADAMTS5, ADAM metallopeptidase with thrombospondin type 1 motif 5; TGF-β, transforming growth factor beta 1

Cell IF staining

After 48 h of treatment with PA, cultured cells in 6/12-well plates (or cell adherent slides) were washed three times with PBS, fixed in 4% formaldehyde for 15 min, and permeabilized with 0.2% Triton X-100/PBS for 20 min. After washing 3 times with PBS, the cells were blocked with 3%BSA for 1 h and incubated overnight at 4 °C with primary antibodies including anti-AT1R, anti-TGF-β, anti-TNF-α, anti-IL-1β, anti-IL-6, anti-COL2a1 and anti-MMP13 (1:200 dilution). After washing 3 times with PBS, the cells were incubated with FITC goat anti-rabbit or anti-mouse IgG (H + L) (diluted 1:500) secondary antibody for 60 min at room temperature in the dark. The sections were added with DAPI, left at room temperature for 10 min in the dark, and after washing three times with PBS. Images were captured using a confocal microscope (Leica-LCS-SP8-STED, Leica, Germany). The following steps are the same as described in Histological and immunohistochemical evaluations.

Protein extraction and western blot analysis

FLS and primary chondrocytes were collected with RIPA lysate containing 1%PMSF, and proteins were extracted. After protein quantification, add 1/5 volume loading buffer to denaturate at 100 °C for 5–10 min. Each lane was loaded with 10 μg of protein, separated by 10% SDS-PAGE, and transferred on PVDF membrane (Millipole, MA, USA). Membranes were blocked in rapid blocking solution for 15 min and incubated with primary antibodies overnight at 4 °C. Primary antibodies include anti-GAPDH (1:10000 dilution), anti-AT1R (1:1000 dilution), anti-TGF-β (1:2000 dilution), anti-Smad2/3 (1:1000 dilution), anti-p-Smad2/3 (1:1000 dilution). The following day, the membranes were washed and incubated with HRP goat anti-rabbit IgG or HRP goat anti-mouse IgG antibodies (diluted 1:5000) at room temperature for 1–2 h. The membranes were developed using ECL HRP substrate. Antibody binding signals were detected using a ChemiDoc Image Analyzer (Bio-Rad, Hercules, CA, USA).The protein band intensities (n = 3) were quantified using Fiji software (ImageJ version 1.53c) [27].

Statistical analysis

The data from the experiments were evaluated using Prism 8.0 (GraPEad Software, La Jolla, CA, USA). All information was reported as the mean ± S.E.M.. Certain data were subjected to statistical normalization, which corrects test results with baseline or control group values in order to reduce unfavorable sources of variation. Differential gene expression analyses were subjected to a Student's two-tailed t-test. The results from the multigroup investigations were successfully statistically significant using one-way ANOVA (or an equivalent), and there was no discernible variance in homogeneity. ^*P < 0.05 was considered statistical significance.

Results

Patients with knee OA and obesity have more severe synovial inflammation and local RAS activation—AT1R high expression

In the SM of knee OA patients, H&E staining showed that compared with patients with BMI < 23 (Control), patients with BMI > 28 (Obesity) had thickened synovial tissue, increased stromal cell density, increased angiogenesis, marked inflammatory cell infiltration, and the synovitis score was increased (Fig. 2a, c, P < 0.05). RT-qPCR detection showed that compared with BMI < 23, the mRNA expression of inflammatory factors IL-1β, IL-6, TNF-α and cartilage matrix degradation gene MMP13 was significantly increased in BMI > 28 group (Fig. 2b, P < 0.01). Further IHC analysis of the protein expression of the above genes showed that the results were consistent with the mRNA expression changes (Fig. 2d, e, P < 0.01).

Fig. 2.

Synovial inflammation and local RAS activation in OA patients. a Representative images of H&E staining of SM in OA patients, × 40, × 200; b The mRNA expression of inflammatory factors IL-1β, IL-6, TNF-α and MMP13 in SM of OA patients; c The synovitis score of H&E staining in OA patients, × 40, × 200; d, e Representative IHC images (d) and positive cell rate (e) of IL-1β, IL-6, TNF-α and MMP13 in SM of OA patients, × 200; f The mRNA expression of RAS system in SM of OA patients; g, h Representative IHC images (g) and positive cell rate (h) of ACE and AT1R in SM of OA patients, × 40, × 200; i IF co-localization of FLS marker (Vimentin) and AT1R in SM of OA patients; Means ± S.E.M., n = 10, ^*P < 0.05, ^**P < 0.01 vs BMI < 23. RAS, renin-angiotensin system; OA, osteoarthritis; H&E: hematoxylin/eosin; SM, synovium; IL-1β, interleukin 1 beta; IL-6, interleukin 6; TNF-α, tumor necrosis factor-alpha; MMP13, matrix metallopeptidase 13; IHC, immunohistochemistry; ACE, angiotensin-converting enzyme; AT1R, angiotensin receptor type 1; AT2R, angiotensin receptor type 2; ACE2, angiotensin-converting enzyme 2; MasR, Mas1 proto-oncogene, G protein-coupled receptor; IF, immunofluorescence; FLS, fibroblast-like synoviocyte; BMI, body mass index

To detect the expression of related genes in the classical/non-classical RAS system in SM of OA patients, AT1R mRNA expression was significantly increased in BMI > 28 group (Fig. 2f, P < 0.01). The second increased gene was ACE, but there was no statistical difference between the two groups (Fig. 2f). Further IHC and semi-quantitative analysis of AT1R and ACE protein expression showed that, AT1R protein expression in BMI > 28 group was significantly higher than that in BMI < 23 group, while the protein expression of ACE had no significant change (Fig. 2g, h, P < 0.01). At the same time, IF colocalization of FLS marker (Vimentin) and AT1R showed that AT1R protein expression in FLS was significantly increased in BMI > 28 group (Fig. 2i). In conclusion, OA patients with BMI > 28 have more severe synovial inflammation, which may be related to the increased expression of AT1R in FLS.

Losartan can inhibit HFD-induced local RAS activation and reduce synovial inflammation in rat

Based on our previous establishment of OA animal model with HFD, we concurrently administered losartan, a specific AT1R inhibitor. In SM, H&E staining (black box) showed that compared with control group, inflammatory cell infiltration were more obvious in HFD group; synovial cell hyperplasia leading to synovial tissue thickening, synovial structure disorder (blue arrow), and fibrotic areas in the intima and subintima (black arrow) and inflammatory cell infiltration were more obvious in HFD group (Fig. 3a); Masson staining also showed synovial thickening, more fibrotic areas in the intima and subintima (black arrows), and more vascular proliferation (red arrows) in the HFD group (Fig. 3a). In cartilage, H&E staining (blue box) showed that the cartilage matrix structure was disordered, the cartilage thickness became thinner, and the hypertrophic chondrocytes was increased (yellow box) in HFD group (Fig. 3a). After treatment with losartan, compared with HFD group, local inflammatory cell infiltration of SM was reduced, synovial tissue hyperplasia was alleviated, areas of synovial fibrosis and vascular proliferation were also significantly reduced, the number of hypertrophic chondrocytes were decreased, and the pathological manifestations of OA were significantly improved (Fig. 3a). The synovitis score of HFD group was significantly higher than that of control group, and losartan could significantly improve the synovitis score (Fig. 3b, c, P < 0.05, P < 0.01); The OARSI score showed that HFD was significantly higher than that of the control group, while losartan treatment significantly reduced the OARSI score (Fig. 3d, P < 0.05, P < 0.01).

Fig. 3.

Synovial inflammation and local RAS activation in rats treated with HFD and losartan. a–d Representative images of H&E staining and Masson staining in rat knee joints (a), the synovitis score (b, c) and the OARSI score (d), × 40, × 100; e–g The mRNA and protein expression of inflammatory cytokines (IL-1β, IL-6 and TNF-α) and RAS components (ACE and AT1R) in rat SM by RT-qPCR and IHC, × 100. Means ± S.E.M., n = 8 per group for H&E staining, n = 5 per group for Masson staining and IHC, n = 10 per group for RT-qPCR, ^*P < 0.05, ^**P < 0.01, ns, no significance. RAS, renin-angiotensin system; HFD, high-fat diet; H&E: hematoxylin/eosin; IL-1β, interleukin 1 beta; IL-6, interleukin 6; TNF-α, tumor necrosis factor-alpha; ACE, angiotensin-converting enzyme; AT1R, angiotensin receptor type 1; SM, synovium; IHC, immune-histochemistry

RT-qPCR and IHC were used to analyze the mRNA and protein expression of inflammatory factors IL-1β, IL-6 and TNF-α in rat SM. It was found that compared with control group, the mRNA and protein levels of IL-1β, IL-6 and TNF-α were significantly increased in HFD group, while losartan treatment significantly alleviated HFD-induced synovial inflammation (Fig. 3e–g, P < 0.05, P < 0.01). In addition, it was worth noting that HFD can induce an increase in AT1R expression in rat SM, which was significantly inhibited by losartan (Fig. 3e–g, P < 0.05, P < 0.01). These results suggests that HFD can promote the expression of local AT1R in SM and induce local synovial inflammation in joints. Losartan, an AT1R inhibitor, inhibited HFD-induced upregulation of synovial AT1R expression and reduced synovial inflammation.

Losartan alleviated cartilage matrix degradation in synovial inflammatory joints of HFD rats

Further analysis of cartilage morphology revealed that the Safranin O-Fast Green staining results showed that, the HFD group had disordered cartilage matrix structure, thinner cartilage thickness (black arrows), lighter matrix staining, a significant reduction in the number of chondrocytes (black box) and mild cartilage surface degeneration (blue arrows), and the control group had clear tide line (yellow arrows). However, the cartilage thickness in HFD + losartan group was thicker than that in HFD group, the matrix staining was deeper, the cartilage matrix structure was slightly disordered, and the tide line was still clear (Fig. 4a). Analysis of glycosaminoglycan (GAG) content from Safranin O staining showed that compared with control group, the content in HFD group was significantly decreased, while the HFD + losartan group showed a significant increase in GAG content compared to the HFD group (Fig. 4b, P < 0.05, P < 0.01). RT-qPCR and IHC were used to analyze the expression of cartilage Col2a1 and Aggrecan. The results showed that the mRNA expression of aggrecan and Col2a1 in HFD group was significantly lower than that in control group, and the mRNA expression of aggrecan and Col2a1 in HFD + losartan group was significantly higher than that in HFD group, but still lower than that in control group (Fig. 4b, d, P < 0.05, P < 0.01). The Col2a1 protein expression was consistent with its mRNA expression (Fig. 4c, d, P < 0.05, P < 0.01).

Fig. 4.

Pathological changes and extracellular matrix of cartilage of cartilage in rats treated with HFD and losartan. a Representative images of Safranin O-Fast Green staining in rat knee joints, × 200; b The mRNA expression of aggrecan in rat cartilage by RT-qPCR, and the IOD of GAG; c–h The mRNA and protein expression of Col2a1, ADAMTS5 and MMP13 in rat cartilage by RT-qPCR and IHC, × 200. Means ± S.E.M., n = 5 per group for IHC and Safranin O-Fast Green staining, n = 10 per group for RT-qPCR, ^*P < 0.05, ^**P < 0.01. HFD, high-fat diet; IOD, integrated optical density; GAG, glycosaminoglycan; Col2a1, collagen type II alpha 1 chain; ADAMTS5, ADAM metallopeptidase with thrombospondin type 1 motif 5; MMP13, matrix metallopeptidase 13; IHC, immunohistochemistry

RT-qPCR and IHC were used to analyze the mRNA and protein expression of cartilage matrix degradation related genes ADAMTS5 and MMP13. The mRNA and protein expressions of ADAMTS5 and MMP13 in HFD group were significantly increased compared with control, while the mRNA and protein expressions of ADAMTS5 and MMP13 in HFD + losartan group were significantly reduced compared with HFD group (Fig. 4e–h, P < 0.05, P < 0.01). In conclusion, HFD can promote the degradation of cartilage matrix, and losartan can alleviate HFD-induced cartilage matrix degradation.

Losartan inhibits inflammation in FLS and reduces chondrocyte matrix degradation

In order to further confirm that losartan can reduce the local inflammation of SM and improve the degradation of cartilage matrix in the high-fat model, a co-culture system of FLS and primary chondrocytes was established in vitro. FLS were treated with different concentrations of PA (0, 50, 100, 200 μM) for 48 h to establish a hyperlipidemic cell model. Results showed that PA increased the mRNA expression of IL-1β, IL-6 and TNF-α in FLS in a concentration-dependent manner (Fig. 5a, P < 0.05, P < 0.01); Moreover, the mRNA expression of aggrecan and Col2a1 was decreased in a concentration-dependent manner, while induced the mRNA expression of ADAMTS5 and MMP13 in chondrocytes (Fig. 5e, P < 0.05, P < 0.01). In the reverse intervention experiment, losartan could significantly inhibit the mRNA and protein expression of inflammatory factors IL-1β and TNF-α in FLS induced by high concentration (200 μM) PA (Fig. 5b–d, P < 0.05, P < 0.01); and reduced the mRNA and protein expression of MMP13, while reversing the expression of Col2a1 in chondrocytes induced by PA (Fig. 5f–h, P < 0.05, P < 0.01). Based on these results, we concluded that losartan could inhibit inflammation in FLS and alleviate chondrocyte matrix degradation in hyperlipidemic cell model.

Fig. 5.

The effect of losartan on synovial inflammation and cartilage matrix degradation in vitro. a, e FLS treated with different concentrations of PA (0, 50, 100, 200 μM) and co-cultured with primary chondrocytes, the mRNA expression of IL-1β, IL-6 and TNF-α in FLS (a) and the mRNA expression of aggrecan, Col2a1, ADAMTS5 and MMP13 in chondrocytes (e); b–d The mRNA and protein expression of IL-1β and TNF-α in FLS by RT-qPCR and IF treated with PA (200 μM) and PA + losartan, × 400; f–h The mRNA and protein expression of MMP13 and Col2a1 in chondrocytes in co-culture system by RT-qPCR and IF, × 400. Means ± S.E.M., n = 3 per group for IF, n = 6 per group for RT-qPCR, ^*P < 0.05, ^**P < 0.01. FLS, fibroblast-like synoviocyte; PA, sodium palmitate; IL-1β, interleukin 1 beta; IL-6, interleukin 6; TNF-α, tumor necrosis factor-alpha; Col2a1, collagen type II alpha 1 chain; ADAMTS5, ADAM metallopeptidase with thrombospondin type 1 motif 5; MMP13, matrix metallopeptidase 13

Losartan reduces the inflammatory response of FLS by inhibiting TGF-β/Smad2/3 pathway

To confirm the mechanism by which losartan reduces SM local inflammation and cartilage matrix degradation, we examined TGF-β, a key fibrosis mediator in FLS. We found that PA dose-dependently increased the mRNA and protein expression of AT1R and TGF-β in FLS (Fig. 6a–c, P < 0.05, P < 0.01). Furthermore, TGF-β/Smad2/3 pathway was activated, as indicated by increased phosphorylation of Smad2/3 (p-Smad2/3) protein level (Fig. 6b, c, P < 0.05, P < 0.01). In reverse interference experiment, PA could promote the mRNA expression of AT1R and TGFβ in FLS (Fig. 6e, P < 0.01); IF co-localization analysis confirmed that PA could promote the protein co-expression of AT1R and TGF-β in FLS, and losartan could significantly inhibit the expression of AT1R and TGF-β induced by PA (Fig. 6d–f, P < 0.05, P < 0.01). Knockdown of AT1R in FLS using AT1RsiRNA also resulted in a significant decrease in both mRNA and protein expression of AT1R and TGF-β, as observed with losartan (Fig. 6d–f, P < 0.05, P < 0.01). Furthermore, western blot analysis showed that losartan significantly down-regulated the increased TGF-β and p-Smad2/3 protein expression induced by PA, which was consistent with the results of siRNA knockdown of AT1R in FLS (Fig. 6g, h, P < 0.05, P < 0.01). The above results indicate that losartan alleviates inflammation in FLS, possibly through the TGF-β/Smad2/3 pathway.

Fig. 6.

Losartan reduces PA-induced inflammation by inhibiting TGF-β/Smad2/3 pathway in FLS. a–c After treated with different concentrations of PA (0, 50, 100, 200 μM) in FLS, the mRNA expression of AT1R, TGF-β and Smad2/3 in FLS (a), the protein expression of AT1R, TGF-β and p-Smad2/3 (b) and the semi-quantitative analysis of western blot (c); d–h After treated with 0 μM PA, 200 μM PA, 200 μM PA + losartan and 200 μM PA + AT1Rsi in FLS, IF co-localization analysis and IOD value of AT1R and TGF-β in FLS, × 400 (d, f), the mRNA expression of AT1R and TGF-β in FLS (e), the protein expression of AT1R, TGF-β and Smad2/3 in FLS (g) and the semi-quantitative analysis of western blot (h). Means ± S.E.M., n = 3 per group for IF and western blot, n = 6 per group for RT-qPCR, ^*P < 0.05, ^**P < 0.01. PA, sodium palmitate; TGF-β, transforming growth factor beta 1; FLS, fibroblast-like synoviocyte; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; AT1R, angiotensin receptor type 1

Discussion

Local synovial inflammation of the knee joint was aggravated in obese patients and high-fat rats

The role of obesity in the occurrence and development of OA has been confirmed. In addition to increasing joint load, metabolic factor disorder is also the main factor of obesity-induced OA [28]. With the change of people's lifestyle and diet, the prevalence of global obesity is rising significantly in the world. It is expected that by 2030, the global obesity population will exceed 57.8% and approximately 3.3 billion people [29]. With the aggravation of aging society and the further epidemic of obesity, the number of OA will further increase. At present, there are still different opinions on the pathogenesis of obese OA, but many studies tend to suggest that systemic inflammatory response is one of the key factors [28]. Obesity is a chronic low-grade inflammatory state, similar to OA, which is a long-standing low-level inflammation [28]. This is reminiscent of the metabolic inflammation present in obese body. In fact, chronic low-grade inflammatory state in obese body plays an important role in the pathogenesis of OA [30]. Inflammatory factors are considered to be important factors in the occurrence and development of OA. IL-1β, IL-6 and TNF-α are the most well-studied pro-inflammatory cytokines. IL-1β plays a central role in the occurrence and development of OA, which promotes the development of synovial inflammation and synovial wall hyperplasia, thus promoting the progress of OA. TNF-α and IL-1β have similar biological effects, and play a synergistic role with IL-1β in the pathogenesis of OA [31]. Interestingly, in this study, we found that among patients undergoing knee arthroplasty, synovial inflammation was more severe in patients with BMI > 28, and the expression of IL-1β, IL-6 and TNF-α in SM was significantly higher than that in patients with BMI < 23. Our team has confirmed that HFD can induce the occurrence of OA [6]. In this study, we found that the synovitis score of rats with HFD was significantly increased, and their local expression of inflammatory factors IL-1β, IL-6 and TNF-α was also significantly increased. In addition, similar phenomena have been reported in related studies [32, 33]. In conclusion, the local synovial inflammation is more severe in obese patients with OA, which is consistent with the changes of local synovial inflammation in HFD animal models.

Upregulation of AT1R mediates local synovial inflammation in metabolic OA

RAS not only plays its classical role in physiological regulation, but also regulates cell growth and differentiation, participates in the production of reactive oxygen species (ROS), tissue inflammation and fibrosis, regulates hematopoiesis, and is closely related to metabolic diseases [34]. Clinical studies have found that RAS is over-activated in obese patients [35], and AGT and AT1R gene polymorphisms are closely related to obesity [36]. Studies have confirmed that renin, ACE, AT1R and AT2R are expressed in the synovial tissue of humans and animals and are involved in the occurrence of OA [37]. As the main effector molecule of RAS, Ang Ⅱ plays the biological role mainly by binding to its receptor. AT1R plays an important role in pro-inflammatory, pro-proliferation, pro-fibrosis and pro-oxidation, and AT2R exerts anti-inflammation and anti-proliferation [38]. Among them, AT1R mediates most of the functions of Ang Ⅱ, regulates synovial perfusion and growth, promotes synovial fibrosis, and participate in the occurrence and development of OA. In addition, AT1R participates in regulating vasoconstriction, resulting in tissue ischemia–reperfusion, which leads to the release of oxygen free radicals [16]. And it is involved in chronic inflammation to continuously magnify and promote cell proliferation, leading to organ remodeling [38]. Eventually, it causes cell damage and joint damage. Studies have also found that AT1R may be involved in the occurrence of a variety of chronic inflammation, including RA [18, 39]. In this study, the expression of AT1R in SM of patients with BMI > 28 was significantly higher than those of BMI < 23, as in the HFD rat model. In vitro, PA increased the expression of inflammatory cytokines IL-1β, IL-6 and TNF- α in FLS in a concentration-dependent manner, accompanied by an increase in AT1R. This suggests that RAS components are involved in the inflammatory response in the pathological process of OA and that AT1R plays a central role.

Losartan inhibits synovial inflammation and alleviates the progression of metabolic OA

The above results suggest that specific inhibition of AT1R in RAS may be a new method to prevent and treat the pathological progression of OA. Losartan, a commonly used AngⅡ receptor antagonist, which selectively antagonizes AT1R and inhibits the expression of inflammatory factors, thereby reducing the formation of free radicals [17]. At the same time, it can directly inhibit the interaction between leukocytes and joint endothelial cells [40]. In this study, we found that losartan could significantly improve synovitis score and the degeneration of articular cartilage in the model of rat OA induced by HFD, reduce the expression of inflammatory cytokines IL-1β, IL-6 and TNF-α in SM. In vitro experiments also showed that losartan could down-regulate the expression of AT1R in FLS, significantly inhibit the activation of inflammation induced by PA, and improve the expression of extracellular matrix in cartilage.

Studies have reported that the ARB drug losartan can inhibit acute joint inflammation in a dose-dependent manner, and its optimal dose is 15 mg/kg [41]. In addition, in studies on the improvement of metabolic dysfunction by losartan in rat model of metabolic syndrome, the recommended dose of losartan is 10–30 mg/kg [42, 43]. Therefore, in this study, we chose 15 mg/kg as our dose of administration. Prophylactic and therapeutic administration of this dose can significantly reduce knee joint swelling in rats and inhibit TNF-α production in SM [18]. In addition, another study revealed the ability of losartan to inhibit inflammation in arthritic injured forepaws [44]. More importantly, losartan was also found to alleviate the progression of temporomandibular joint OA by inhibiting the degeneration of condylar articular cartilage [45]. Silveira et al. also recently demonstrated that losartan reduced neutrophil recruitment, hyperalgesia, and inflammatory cytokine production in the synovial tissue of antigen-induced arthritis mice [40]. This suggests that losartan has a potential protective effect on OA-related injuries. Therefore, in this study, we verified the prediction that losartan can alleviate the progression of OA. In this study, losartan, as an ARB, competitively binds to AT1R and reduce subsequent signaling. Compared with losartan, ACE inhibitor (ACEI) is located in the upstream segment and can directly interfere with AngⅡ production, which theoretically inhibits RAS more thoroughly. However, due to the complexity of the RAS network, it is difficult to block it fundamentally. Moreover, blocking the action of AngⅡ may also inhibit the function of AT2R. In fact, after losartan inhibits AT1R, the AT2R pathway may be compensatively increased, showing a protective effect. This suggests that AT1R may be a new target for the prevention and treatment of OA patients with obesity. Therefore, this study is also expected to provide theoretical support and guidance for the clinical application of ARB drugs in metabolic diseases such as metabolic OA. However, it should be pointed out that we did not verify the cartilage destruction after AT1R overexpression in FLS. Transfection of AT1R overexpression plasmid in FLS alone (positive control) would provide stronger evidence to suggest that AT1R is a potential therapeutic target for metabolic OA. Therefore, this is the deficiency of this study for the exploration of deeper mechanisms, which is also something we need to improve in the future.

Losartan inhibits synovial inflammation by down-regulating AT1R/TGF-β/Smad2/3 pathway through in metabolic OA

Pattacini et al. confirmed that AngⅡ may be an important mediator in the expansion of FLS. Activated FLS can also produce prostaglandins (PG), MMPs and other inflammatory mediators [46]. Recent studies have shown that FLS play a key role in the development of synovial fibrosis in OA [47]. TGF-β play an important role in the development of articular cartilage, the formation of joints and the maintenance of articular cartilage homeostasis. However, the role of TGF-β in normal joints and OA joints is completely different. Under physiological conditions, TGF-β signaling plays a crucial role in cartilage genesis, proliferation, and differentiation [48, 49]. Studies have shown that inhibition of TGF-β signaling impairs chondrocyte homeostasis, increases MMP13 and ADAMTS-5 production, and ultimately leads to cartilage damage and even spontaneous OA phenotypes [50]. Although TGF-β plays a protective role in maintaining the integrity of cartilage, the use of TGF-β in the treatment of OA has always been a challenge because it may cause synovial fibrosis and osteophyte formation [51]. In OA, TGF-β not only involve in the imbalance of cell phenotype and molecular function of subchondral bone and cartilage, destruction of extracellular matrix synthesis, subchondral bone remodeling, but also participates in synovial inflammation and immune changes, promoting the occurrence and progression of OA [52]. Recent studies have shown that TGF-β signaling not only promotes the proliferation of OA FLS, but also is a strong fibrogenic factor, which is closely related to joint stiffness and pain [53]. TGF-β can be used as a chemotactic factor to recruit FLS for fibrosis, and can also induce synovial cells to produce inflammatory factors [54]. In the present study, we also found that synovial tissue thickness, stromal cell density and fibrosis were increased in obese patients and HFD fed rats, and the AT1R expression was increased. PA treatment of FLS increased the expression of AT1R, TGF-β and p-Smad2/3 in a concentration-dependent manner. IF co-localization analysis showed that AT1R and TGF-β were co-expressed and significantly increased in FLS. However, treatment with losartan and AT1Rsi significantly reversed the PA-induced increase of AT1R and TGF-β. Chen et al. found that losartan could reduce articular cartilage degeneration in OA mice by inhibiting TGF-β1 signaling pathway [55]. It has also been suggested that oral losartan can inhibit tissue fibrosis by blocking this mechanism in musculoskeletal applications [56, 57]. In addition, increasing evidence suggests that Ang II signaling through AT1R may be an upstream activator of TGF-β signaling [58, 59]. TGF-β signaling is a major regulator of fibrosis, mediated through PKC and p38 MAPK pathways [60]. It can be concluded that TGF-β signaling plays a crucial role in synovial inflammatory and fibrotic lesions. This study suggests that losartan has a therapeutic effect on metabolic OA, which is mainly through down-regulating AT1R and inhibiting TGF-β/Smad2/3 signaling pathway in SM to alleviate local inflammation and play a protective role in OA. However, it must be noted that the role of AT1R and Losartan in rheumatoid arthritis (RA) has been elucidated. Therefore, this article in the metabolic OA of Losartan treatment innovation has certain limitations. In RA, AT1R mainly promotes synovial tissue to differentiate into osteoclasts by promoting angiogenesis, which eventually leads to cartilage erosion and bone destruction. In metabolic OA, long-term low-grade synovial inflammation plays a pro-fibrotic response by activating the AT1R/TGF-β/Smad2/3 pathway, leading to the aggravation of synovial fibrosis and promoting synovial inflammation. Therefore, this study provides experimental basis for elucidating the mechanism of metabolic OA, and further supports the therapeutic potential of Losartan in metabolic OA and RA, and provides experimental and theoretical basis for guiding clinical medication.

Conclusion

In conclusions, we confirmed that the abnormal activation of AT1R, which was highly expressed in the SM of obese patients (BMI > 28) and metabolic OA rats induced by HFD, promoted the fibrosis of FLS and the secretion of inflammatory factors, thereby promoting OA progression (Fig. 7). Losartan, as an AT1R inhibitor, can inhibit local synovial inflammation by inhibiting AT1R to down-regulate TGF-β/Smad2/3 pathway and have a therapeutic effect in OA patients with obesity. These results indicate that losartan has a dual effect in treating OA and hypertension, it may be the preferred antihypertensive medicine for OA patients with hypertension. Due to the limited sample size, there are still shortcomings and limitations in this experiment, and further in-depth studies such as localization in signal transduction pathways are needed.

Fig. 7.

The pathogenesis of metabolic OA in synovium. OA, osteoarthritis; RAS, renin- angiotensin system; AT1R, angiotensin receptor 1; TGF-β, transforming growth factor beta 1; TNF-α, tumor necrosis factor-alpha; IL-1β, interleukin 1 beta; IL-6, interleukin 6; MMP13, matrix metallopeptidase 13; COL2A1, collagen type II alpha 1 chain; ACAN, aggrecan; ADAMTS5, ADAM metallopeptidase with thrombospondin type 1 motif 5

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

OA

Osteoarthritis

HFD

High-fat diet

SM

Synovium

FLS

Fibroblast-like synoviocyte

RAS

Renin-angiotensin system

AngⅡ

Angiotensin Ⅱ

ACE

Angiotensin converting enzyme

AT1R

Angiotensin receptor type 1

AT2R

Angiotensin receptor type 2

AGT

Angiotensinogen

RA

Rheumatoid arthritis

ARB

Angiotensin receptor antagonist

GAPDH

Glyceraldehyde 3-phosphate dehydrogenase

MasR

MAS1 proto-oncogene, G protein-coupled receptor

TNF-α

Tumor necrosis factor-alpha

IL-1β

Interleukin 1 beta

IL-6

Interleukin 6

MMP13

Matrix metallopeptidase 13

COL2A1

Collagen type II alpha 1 chain

ACAN

Aggrecan

ADAMTS5

ADAM metallopeptidase with thrombospondin type 1 motif 5

TGF-β

Transforming growth factor beta 1

PA

Sodium palmitate

Author contributions

Qubo Ni and Haonan Zhang performed the RNA isolation and participated in the experimental design, interpretation and manuscript writing. Haonan Zhang and Jiayong Zhu contributed to the acquisition of raw data. Haonan Zhang and Hangyuan He assisted with cell experiment, data analysis and interpretation of findings. Bin Li and Hui Wang provided critical revision of the manuscript for important intellectual content. Qubo Ni and Liaobin Chen performed surgical procedures and collected clinical samples, and participated in the experimental design, the supervision, interpretation and revised the paper. All authors reviewed the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 82373969, 81803275, 81673490, 81673524).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

All procedures involved were performed with the patient's written informed consent. The protocol used in this study complies with the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the Medical Ethics Committee of Zhongnan Hospital, Wuhan University (No.2019018). All experimental animal procedures were performed in accordance with the regulations of the China Animal Welfare Committee. The protocol was approved by the Wuhan University School of Medicine Animal Experimentation Ethics Committee (license number: ZN2021222). This study was reported in accordance with ARRIVE guideline (https://arriveguidelines.org).

Consent for publication

The authors confirmed that human research participants provided informed consent for publication of the images in Fig. 2.

Competing interests

The authors declare no competing interests.