Targeting CircNLRP12 attenuates hypoxia-induced pulmonary arterial smooth muscle cell dysfunction by sponging miR-107-5p and suppressing the ITGA2-mediated FAK/PI3K/AKT pathway

Abstract

Background

Pulmonary arterial hypertension associated with congenital heart disease (PAH-CHD) drives lethal pulmonary vascular remodeling. While circular RNAs (circRNAs) are emerging as disease regulators, their functional roles in PAH-CHD remain unexplored.

Methods

circRNA sequencing of peripheral blood from 5 PAH-CHD patients versus 5 congenital heart disease(CHD) controls identified dysregulated circRNAs. Functional validation utilized hypoxia-exposed human pulmonary arterial smooth muscle cells (hPASMCs) with circNLRP12 silencing (siRNA), complemented by luciferase assays, quantitative polymerase chain reaction (qPCR),Western blot, and phenotypic analyses.

Results

circNLRP12 was significantly upregulated in PAH-CHD patients and hypoxia-exposed hPASMCs. Functional studies demonstrated that circNLRP12 silencing markedly attenuated hypoxia-induced proliferation and migration while reversing apoptosis resistance in hPASMCs. Mechanistically, circNLRP12 acted as a molecular sponge for miR-107-5p, leading to increased integrin alpha 2 (ITGA2) expression and subsequent activation of the focal adhesion kinase/phosphoinositide 3-kinase/protein kinase B/hypoxia inducible factor-1α (FAK/PI3K/AKT/HIF-1α) signaling pathway, which ultimately promoted vascular remodeling through downstream effectors including vascular endothelial growth factor(VEGF) and α-Smooth Muscle Actin(α-SMA).

Conclusion

Our findings show that circNLRP12 promotes hPASMCs proliferation and dysfunction through a miR-107-5p/ITGA2 axis. As a novel biomarker and therapeutic target, it may serve as significant potential for guiding clinical interventions.

Supplementary Information

The online version contains supplementary material available at 10.1186/s40001-025-03586-0.

Introduction

Pulmonary arterial hypertension (PAH) represents an uncommon disorder marked by gradual structural alterations in the pulmonary arterioles. This process elevates pressure in the pulmonary arteries, causes right heart failure, and ultimately leads to high mortality rates [1, 2]. Congenital heart disease (CHD) represents a major etiology of PAH, implicated in up to 30% of adult and 75% of pediatric PAH cases [3]. CHD encompasses structural cardiovascular anomalies present at birth, arising from aberrant embryonic development of the heart and great vessels [4]. A rate of 8.98 cases of congenital heart disease (CHD) per 1000 live births is observed in China [5]. A recent global meta-analysis indicates a rising birth prevalence of CHD, peaking at 9.410 per 1000 between 2010 and 2017. Notably, Asia now exhibits a higher prevalence than Europe or the Americas, suggesting greater genetic or environmental susceptibility in Asian populations [6].

While CHD is a common cause of PAH, the precise pathogenic mechanisms underlying PAH development in CHD patients remain incompletely understood. Epidemiological data from a large U.S. insured pediatric cohort revealed concurrent CHD in approximately 75% of children diagnosed with PAH [3]. Structural cardiac defects increase cardiac workload, pulmonary blood flow, and pulmonary artery pressure (PAP), thereby initiating PAH. Subsequently, PAH further exacerbates pulmonary vascular resistance and cardiac strain, severely compromising quality of life and potentially progressing to heart failure or death [7]. Despite declining mortality trends, PAH-CHD symptoms can worsen throughout life, and the condition remains incurable [8]. Despite considerable advances in treatment have enhanced functional capacity and survival duration, long-term prognosis continues to be unsatisfactory [9]. Of particular concern, sustained pulmonary hypertension (PH) following surgery is closely linked to increased mortality [10].

Early diagnosis and intervention are paramount, as PAH-CHD may be reversible if treated promptly [11]. Detecting PAH-CHD during its subclinical or intermediate stages significantly improves cure rates. However, identifying reliable biomarkers for PAH-CHD screening via conventional blood tests remains a significant clinical challenge [12]. Consequently, the discovery and validation of effective, non-invasive biomarkers for routine clinical use is imperative.

Circular RNAs (circRNAs) represent a distinct category of endogenous non-coding RNA molecules. Owing to their structural stability and specific expression across tissues, circRNAs are increasingly recognized as promising biomarkers for a wide range of pathological conditions [13, 14]. circRNAs play crucial roles in signaling networks, acting as microRNA sponges, regulating gene expression, and modulating cellular functions [15]. In PAH, circRNAs play a key role in driving the process of pulmonary vascular remodeling—a central pathological process in this condition. They influence gene expression and modulate protein synthesis by acting as microRNA sponges and binding with RNA-binding proteins [16]. The detection of abnormally expressed circRNAs in PAH indicates their promising role as diagnostic markers for early detection and potential targets for treatment [17, 18]. For instance, deficiency of CircST6GAL1 reversed hypoxia-induced abnormal proliferation, migration, and apoptosis inhibition in hPASMCs via the miR-509-5p/MCTP2(multiple C2 domains, transmembrane 2) axis. Furthermore, in a monocrotaline (MCT)-induced mouse model of PAH, this intervention mitigated pulmonary vascular remodeling, identifying CircST6GAL1 as a promising candidate for therapeutic intervention in PAH [19]. Studies of idiopathic pulmonary hypertension (IPAH) have observed the upregulation and nuclear localization of HNRNPA2B1, which facilitates disease pathogenesis by modulating the cell cycle [20]. Yuan et al. analyzed the gender differences in circRNAs in idiopathic pulmonary arterial hypertension, but did not conduct further in-depth research on their physiological functions and mechanisms [21]. Additionally, PAH-CHD promotes the progressive proliferation and migration of PASMCs, leading to progressive and irreversible alterations in the architecture of the pulmonary vasculature [22]. Elucidating the precise roles of circRNAs in PAH-CHD pathophysiology may reveal fundamental disease mechanisms and offer new avenues for therapeutic development. Moreover, investigating and deciphering circRNA profiles in PAH-CHD patients holds promise for developing novel diagnostic and prognostic approaches, ultimately improving therapeutic strategies and clinical outcomes [23, 24].

Therefore, this study aims to identify dysregulated circRNAs in patients with PAH-CHD, screen and validate the most promising candidate circRNA, and mechanistically characterize its role in pulmonary arterial smooth muscle cell dysfunction. In this study, we identified significantly elevated circNLRP12 expression in the peripheral blood of PAH patients and in hypoxic hPASMCs through high-throughput sequencing analysis. This finding suggests its potential involvement in PAH pathogenesis. Functional experiments demonstrated that silencing circNLRP12 effectively suppressed hypoxia-induced hPASMC proliferation, migration, and apoptosis resistance, concurrently modulating key signaling pathways and proteins associated with vascular remodeling. These data reveal a novel regulatory mechanism contributing to pulmonary vascular remodeling and implicate circNLRP12 as a potential therapeutic target for PAH progression.

Materials and methods

Patients and clinical samples

Peripheral blood samples were collected from 5 PAH-CHD patients and 5 CHD patients at the Third People's Hospital of Xinjiang Uygur Autonomous Region (Urumqi, China). Following collection, all specimens were promptly snap-frozen and stored at − 80 °C to preserve integrity for later analytical procedures. The research was conducted in compliance with the ethical principles of the Declaration of Helsinki (2024 version) and was approved by the Institutional Ethics Committee at Xinjiang Uygur Autonomous Region People’s Hospital. Written informed consent was acquired from each participant prior to enrollment.

High-throughput CircRNA sequencing

CircRNA sequencing and primary data processing were outsourced to Novogene (Beijing, China). Briefly, total RNA from each sample underwent ribosomal RNA (rRNA) depletion using the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, USA), to enrich for circular RNAs, linear transcripts were digested with RNase R (Epicentre, USA) at a concentration of 3U/μg RNA. The incubation was carried out at 37 °C for a duration of 20 min. Sequencing libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB, USA) in accordance with the manufacturer's protocol. Key steps included: RNA was fragmented under high temperature conditions in the presence of divalent cations. First-strand cDNA was then synthesized with random hexamer primers and M-MuLV Reverse Transcriptase (RNase H⁻), second-strand cDNA synthesis incorporating dUTP, end repair/adenylation, adapter ligation, fragment size selection was carried out with AMPure XP beads (Beckman Coulter, USA) for the isolation of 150–200 bp fragments, USER enzyme (NEB, USA) treatment (37 °C, 15 min; 95 °C, 5 min), PCR amplification, and final library purification. To ensure sequencing quality, library preparations were quality-controlled on an Agilent Bioanalyzer 2100 system. Cluster generation was performed on the cBot system (Illumina, USA) using the HiSeq PE Cluster Kit v4, a 150-bp paired-end sequencing run was carried out on the Illumina HiSeq X Ten platform by Novogene Bioinformatics Technology Co., Ltd (Beijing, China).

CircRNA identification and quantification

A preprocessing pipeline utilizing custom Perl scripts was applied to the raw FASTQ reads for removal of adapter contamination, poly-N stretches, and low-quality reads. We obtained the reference genome and its corresponding annotation files from the Ensembl database (http://www.ensembl.org). The genomic index was constructed with Bowtie v2.0.6, followed by alignment of the cleaned reads to the reference genome using TopHat v2.0.9. Unmapped reads were kept for further analysis, and 20-nucleotide sequences from both ends were isolated and subsequently realigned with Bowtie. CircRNAs were identified using find_circ [25] requiring GU/AG splice site flanking of back-splice junctions and ≥ 2 supporting reads. CIRI [26] was used for parallel identification. The final circRNA set comprised candidates detected by both algorithms. CircRNA expression levels were quantified using the transcripts per million (TPM) method. To identify statistically significant gene expression changes, analysis was conducted with the DESeq2 software (version 1.6.3) [27], with adjusted P values (Benjamini-Hochberg) < 0.05 considered significant.

Cell culture

hPASMCs were obtained from Cellverse (Shanghai, China) and cultured in primary hPASMC growth medium (Cellverse) supplemented with 10% fetal bovine serum (ExCell Bio, Shanghai, China) and 1% (v/v) solution of penicillin–streptomycin (Keycell, Wuhan, China) at 37 °C under 5% CO₂, hypoxia conditions 1% O₂, 5% CO₂, 94% N₂ at 37 °C for different times. To ensure phenotypic stability and the reliability of our functional assays, all experiments were conducted using human pulmonary arterial smooth muscle cells (hPASMCs) within passages 3 to 5.

Constructs and transient transfection

Three siRNAs targeting circNLRP12 (siRNA-1: CUGCAGAUGAUUCAAUACC; siRNA-2: GCAGAUGAUUCAAUACCCC; siRNA-3: AGAUGAUUCAAUACCCCAC) and A non-targeting control siRNA (siNC) was obtained from Genepharma (Shanghai, China). The miR-107-5p mimic (miR-107-5p), mimic control (miR-NC), miR-107-5p inhibitor (anti-miR-107-5p), and inhibitor control (anti-miR-NC) were also procured from Genepharma. hPASMCs were transfected with Lipo8000 transfection reagent (Beyotime, Shanghai, China) following the protocols provided by the manufacturer when cells reached approximately 60% confluency. Following a 24-h incubation post-transfection, cells were treated under hypoxia and subsequently harvested.

RNase R treatment

Total RNA (5 μg) was subjected to digestion with 3 U/μg of RNase R (Solarbio, Beijing, China) at 37 °C for 20 min. Subsequent cDNA synthesis and qPCR analysis were performed to assess the stability of circular RNAs relative to untreated controls.

Cell proliferation assay

Cultured in medium supplemented with 5% fetal bovine serum (FBS), hPASMCs were plated in 96-well plates at a density of 5 × 10³ cells per well. The experiment was performed with three independent biological replicates, each consisting of three technical replicates, to ensure statistical robustness. Cell viability was measured at 0, 24, 48, and 72-h intervals with a CCK-8 assay kit (Beyotime, China). Briefly, To assess cell viability, 10 µL of CCK-8 solution was dispensed into every well, followed by incubation for 2 h at 37 °C, after which the optical density was determined at 450 nm.

Cell apoptosis assay

The Annexin V-FITC/PI Apoptosis Detection Kit (Beyotime, China) was used for the quantitative assessment of apoptosis according to the standard protocol. Transfected cells were collected, washed, and resuspended in binding buffer (1 × 10⁶ cells/mL). Cells were treated with 5 µL of Annexin V-FITC and incubated for 15 min under light-protected conditions, followed by addition of PI. Flow cytometric analysis of apoptotic cells was performed immediately using a BD Biosciences flow cytometer (USA). and fluorescence microscopy (Olympus, Japan). Data were processed using CellQuest software (BD Biosciences).

Cell migration assay

Transfected and/or hypoxia-exposed hPASMCs were seeded into 6-well plates (5 × 10⁵ cells/well) and grown to 80–90% confluence. A linear cell-free gap was generated in the monolayer with a sterile 200-µL pipette tip. Wound closure was monitored at 24 and 48 h under × 10 magnification (Olympus, Japan). Quantification of the migration distance was performed using ImageJ (NIH, USA).

Fluorescence in situ hybridization (FISH)

FISH was conducted to determine the subcellular localization of circNLRP12. Cy3-labeled probes specific to the circNLRP12 back-splice junction were synthesized by RiboBio (China). The hybridization procedure was performed following the manufacturer's protocol provided with the FISH kit (RiboBio). Fluorescence images were captured using an Olympus fluorescence microscope (Japan).

Quantitative real-time PCR (qRT-PCR)

Total RNA was purified from cell lysates via TRIzol reagent (Thermo Fisher Scientific, USA) according to the manufacturer's instructions. Complementary DNA (cDNA) was then synthesized with a reverse transcription kit (Vazyme, Nanjing, China). qRT-PCR was conducted using SYBR Green Master Mix (Vazyme, China) on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). Primer sequences are listed in Table 1. GAPDH or U6 snRNA served as endogenous controls. Relative expression was calculated using the 2^(−ΔΔCt) method [28].

Table 1.

Primer sequences

Gene	Forward primer (5′ → 3′)	Reverse Primer (5′ → 3′)
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG
circNLRP12	TGATGCTGCTTTGCGAGG	TTCCCAAGTGAGGACGGG
ITGA2	TTTGGTAGTGTGCTGTGT	TCTTCCTTCCTCTTTCTT
miR-107-5p	ACACTCCAGCTGGGAGCAGC	TGGTGTCGTGGAGTCG
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
NLRP12	CAAGGATGGATCTCAGTGGCA	CCAGCTGACACTTCCTCAACTGAA

GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase; NLRP12: NLR Family Pyrin Domain Containing 12; ITGA2: Integrin Subunit Alpha 2; U6: U6 Small Nuclear RNA

Western blot analysis

Following cell lysis, protein concentrations were quantified with a BCA assay kit (Biosharp, China). Proteins were resolved via SDS-PAGE and subsequently electrotransferred onto nitrocellulose membranes (Millipore, USA). Following blocking with 5% non-fat milk in PBS for 1 h, membranes were immunoblotted with primary antibodies overnight at 4 °C: glyceraldehyde-3-phosphate dehydrogenase(GAPDH) (Proteintech, 60004-1-Ig, 1:1000), ITGA2 (Proteintech, 30703-1-AP, 1:1000), α-SMA (Proteintech, 14395-1-AP, 1:2000), HIF-1α (Proteintech, 20960-1-AP, 1:2000), VEGF (Proteintech, 66828-1-Ig, 1:1000), AKT (Proteintech, 10176-2-AP, 1:2000), p-AKT (Proteintech, 66444-1-Ig, 1:2000), FAK (CST, #3285, 1:1000), p-FAK (CST, #3283, 1:1000), PI3K (CST, #4292, 1:500), p-PI3K (CST, #17366, 1:1000). Following a series of washes, membranes were subsequently probed using HRP-conjugated secondary antibodies (ZsBio, Beijing, China) and subsequently detected with a chemiluminescent substrate (Servicebio, Wuhan, China) [29].

Bioinformatics and dual-luciferase reporter assay

Putative miRNA targets of circNLRP12 were predicted using miRDB (v6.0) and Miranda (v3.3a). Wild-type and mutant (seed sequence mutations) fragments of circNLRP12 and the ITGA2 3'UTR containing miR-107-5p binding sites were synthesized with XhoI/NotI ends and cloned into the psiCHECK-2 vector (Promega, UK). 293 T cells were co-transfected with 200 ng reporter plasmid and 30 nM miRNA mimic using Lipo8000 (Beyotime, China). At 48 h post-transfection, dual-luciferase activity (Firefly and Renilla) was measured using a commercial assay kit (Beyotime, China), and luminescence signals were read on a PerkinElmer EnVision multimode plate reader (USA). To standardize the measurements, Renilla luciferase values were calculated relative to Firefly luciferase activity.

Statistical analysis

Quantitative data represent mean ± SD of ≥ 3 independent experiments. Analyses were conducted in GraphPad Prism v10.1 (USA), unless stated otherwise. Differences among groups were compared using an unpaired, two-tailed Student’s t-test. The data are presented as the mean ± SD from three independent experiments. A p value less than 0.05 was considered to indicate statistical significance.

Results

CircNLRP12 is upregulated in PAH-CHD patients

Following raw data filtering, sequencing error rate assessment, and GC-content distribution evaluation, high-quality clean reads were retained for downstream analyses, as summarized in Table 2. The reference genome was aligned with the sequencing-derived clean reads employing the Hisat2 aligner, after which the mapped reads were prepared for subsequent analysis, followed by joint analysis with both find_circ and CIRI software to enhance the accuracy of circRNA identification. High-throughput transcriptome sequencing identified 19,304 expressed circular RNAs (circRNAs) in peripheral blood samples from PAH-CHD and CHD patients. Applying stringent criteria (|log₂(fold change)|> 1 and P < 0.05), we identified 76 differentially expressed circRNAs. Among these, 59 were significantly upregulated and 17 were downregulated in PAH-CHD compared to CHD (Table S1), differentially expressed volcano Fig. 1A, heat map Fig. 1B, H-cluster plots line Fig. 1C. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were performed to assess the functional relevance of these circRNAs to PAH pathogenesis (Fig. 2A, B).

Table 2.

Data quality summary

Sample	Raw_reads	Raw_bases	Clean_reads	Clean_bases	Error_rate	Q20	Q30	GC_pct
CHD1	59977070	9G	57670086	8.65G	0.01	98.28	95.45	45.98
CHD2	63215812	9.48G	57630838	8.64G	0.01	98.31	95.7	58.59
CHD3	61134720	9.17G	58993038	8.85G	0.01	97.96	94.42	48.56
CHD4	61880844	9.28G	58726056	8.81G	0.01	97.7	93.78	45.61
CHD5	60819752	9.12G	57292660	8.59G	0.01	98.26	95.43	51.01
CHD_PHA1	63160110	9.47G	42402906	6.36G	0.01	98.07	94.83	60
CHD_PHA2	57001586	8.55G	47024324	7.05G	0.01	98.27	95.55	55.69
CHD_PHA3	72666886	10.9G	66959458	10.04G	0.01	98.3	95.37	59.15
CHD_PHA4	71475664	10.72G	69277258	10.39G	0.01	97.83	94.09	46.38
CHD_PHA5	55737884	8.36G	52832616	7.92G	0.01	98.02	94.85	45.32

Q20:Base calling error rate ≤ 1% (Phred ≥ 20); Q30:Base calling error rate ≤ 0.1% (Phred ≥ 30); GC_pct:GC Content Percentage

Fig. 1.

High-throughput sequencing of differentially expressed circRNAs in PAH-CHD versus CHD patients. A Volcano map analysis of circular RNAs in peripheral blood from PAH-CHD patients. B Heat map analysis of circular RNAs in peripheral blood from PAH-CHD patients (n = 5). C H-cluster plots line. PAH-CHD indicates Pulmonary arterial hypertension associated with congenital heart disease

Fig. 2.

Functional enrichment analysis of DE-circRNAs (GO/KEGG). A Gene Ontology (GO) analysis of 76 differentially expressed circRNAs. B Kyoto Gene and Genomic Encyclopedia (KEGG) analysis of 76 differentially expressed circRNAs

CircNLRP12 knockdown attenuates hypoxia-induced hPASMC dysfunction

Notably, novel_circ_0012677 exhibited one of the highest fold-changes. This circRNA, derived from exons 2 and 5 of the NLRP12 transcript (NM_144687.4), was designated circNLRP12. To confirm its circular structure, divergent primers targeting the specific back-splice junction were designed for efficient amplification. Moreover, we confirmed that circNLRP12 was more stable than NLRP12 after treatment with RNase R in PASMC cells(Fig. 3A). Observation of circNLRP12's expression pattern in PASMCs provides compelling evidence for its functional existence. FISH assays specifically detected a significant signal enrichment within the cytoplasmic compartment(Fig. 3B). This finding is critical, as the subcellular positioning of circRNAs provides direct insight into their biological activities, suggesting a cytoplasm-based mechanism for circNLRP12. Given the central role of PASMC proliferation in PAH-associated vascular remodeling, we investigated circNLRP12 function in PASMCs. Quantitative real-time PCR (qRT-PCR) confirmed that hypoxia exposure induced a time-dependent upregulation of circNLRP12 expression in human PASMCs (hPASMCs) (Fig. 3C).

Fig. 3.

Hypoxia-induced circNLRP12 upregulation in hPASMCs. Expression of circNLRP12 and NLRP12 was measured by real-time quantitative PCR (RT-qPCR) analysis after RNase R treatment in PASMC cells. B Cy3 probes targeting circNLRP12 showed their location in PASMC cells. Scale bar, 10 μm. C qPCR analysis of circNLRP12 expression in hPASMCs after exposure to hypoxia for 48 h (n = 3). D The interference efficiency of sicircNLRP12 or siNC was validated using qRT-PCR. E The siRNA specifically silences circNLRP12 without affecting the linear NLRP12 transcript, as validated by qRT-PCR

To elucidate the functional role of circNLRP12, small interfering RNAs (siRNAs) specifically targeting the circNLRP12 back-splice junction (sicircNLRP12) were designed and transfected into hPASMCs. SicircNLRP12 significantly reduced circNLRP12 expression levels compared to the negative control siRNA (siNC) (Fig. 3D). We measured NLRP12 mRNA levels following circNLRP12 knockdown. The results, now included in the Fig. 3E, show that our siRNA specifically silences circNLRP12 without significantly affecting the linear NLRP12 transcript, ruling out confounding effects from the host gene.

Under hypoxic conditions, sicircNLRP12 effectively suppressed the hypoxia-induced increase in circNLRP12 expression (Fig. 4A). Functional assays demonstrated that hypoxia significantly promoted hPASMC proliferation (Fig. 4B) and migration (Fig. 4C, D). Silencing circNLRP12 reversed these pro-proliferative and pro-migratory effects. Furthermore, hypoxia inhibited hPASMC apoptosis, an effect counteracted by circNLRP12 knockdown (Fig. 4E, F). Collectively, these findings indicate that circNLRP12 silencing reverses hypoxia-induced hPASMC dysfunction, characterized by enhanced proliferation and migration coupled with suppressed apoptosis.

Fig. 4.

CircNLRP12 Knockdown Attenuates Hypoxia-Induced hPASMC Dysfunction. A–F Human pulmonary artery smooth muscle cells were transfected with sicircNLRP12 or siNC and then incubated in hypoxia condition. A qRT-PCR for sicircNLRP12 expression. B Cell counting kit-8 for proliferation analysis. C, D Wound healing assay for cell migration. E, F Flow cytometry for cell apoptosis. Apoptosis (E): Early apoptosis; Apoptosis (L): Late apoptosis; Apoptosis (T): Total apoptosis. All values are presented as the mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001

CircNLRP12 regulates ITGA2 expression via sponging miR-107-5p

Bioinformatic analysis using miRDB and Miranda algorithms predicted miR-107-5p as a potential target of circNLRP12, identifying complementary binding sites (Fig. 5A). To validate this interaction, dual-luciferase reporter assays were performed in HEK293T cells. Introduction of a miR-107-5p mimic via co-transfection markedly reduced luciferase activity in a reporter construct carrying the wild-type circNLRP12 sequence, which includes the predicted binding sites for miR-107-5p. Mutating these binding sites (MUT) abolished the suppressive effect of the miR-107-5p mimic, confirming specific binding (Fig. 5B).

Fig. 5.

CircNLRP12 Regulates ITGA2 Expression via Sponging miR-107-5p. A The binding site between miR-107-5p and circNLRP12. B The interaction between miR-107-5p and circNLRP12 was validated using dual-luciferase reporter assay. C The binding site between miR-107-5p and ITGA2. D The interaction between miR-107-5p and ITGA2 was validated using dual-luciferase reporter assay. E qRT-PCR analysis for the expression of circNLRP12 in hypoxia- or normoxia-induced human pulmonary artery smooth muscle cells. F qRT-PCR analysis for the expression of miR-107-5p in hypoxia- or normoxia-induced human pulmonary artery smooth muscle cells. G qRT-PCR analysis for the expression of ITGA2 in hypoxia- or normoxia-induced human pulmonary artery smooth muscle cells. H Assessment of cell proliferation by CCK-8 assay following co-transfection with si-circNLRP12 and either miR-107-5p mimic or ITGA2 overexpression plasmid. All values are presented as the mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001

Similarly, bioinformatic prediction identified Integrin Subunit Alpha 2 (ITGA2) as a potential target of miR-107-5p, with complementary binding sites within its 3' untranslated region (3'UTR) (Fig. 5C). Luciferase reporter assays confirmed this interaction: the miR-107-5p mimic suppressed luciferase activity from a reporter vector containing the WT ITGA2 3'UTR sequence, but not from a vector containing mutated binding sites (Fig. 5D).

Functional validation in hypoxic human pulmonary arterial smooth muscle cells (hPASMCs) demonstrated that knockdown of circNLRP12 (si-circNLRP12) significantly elevated miR-107-5p levels while reducing ITGA2 mRNA expression (Fig. 5F, G). Furthermore, transfection with a miR-107-5p inhibitor following circNLRP12 silencing effectively rescued the mRNA expression levels of both circNLRP12 and integrin subunit alpha 2 (ITGA2) (Fig. 5E, G). Cell proliferation assays revealed that circNLRP12 knockdown markedly suppressed cell proliferation. Importantly, this suppression was reversed upon co-transfection with either a miR-107-5p inhibitor or an ITGA2 overexpression plasmid(Fig. 5H). Collectively, these results demonstrate that circNLRP12 acts as a molecular sponge for miR-107-5p, thereby regulating ITGA2 expression.

CircNLRP12 modulates hypoxia-induced vascular remodeling via the FAK/PI3K/AKT/HIF-1α axis

To investigate the signaling pathways underlying circNLRP12's role in PH vascular remodeling, we analyzed key signaling molecules and vascular remodeling markers in hypoxic hPASMCs following circNLRP12 knockdown. Western blot analysis revealed that circNLRP12 silencing significantly downregulated ITGA2 protein expression. Furthermore, It also significantly suppressed the phosphorylation of FAK, PI3K, and AKT, indicating inhibition of these pathways (Fig. 6A, B). Silencing circNLRP12 also significantly decreased the protein levels of HIF-1α and key vascular remodeling markers, VEGF and α-SMA (Fig. 6A, B). These data establish that circNLRP12 promotes hypoxia-induced vascular remodeling in hPASMCs through a signaling cascade involving ITGA2, FAK, PI3K, AKT, and HIF-1α.

Fig. 6.

CircNLRP12 Modulates Hypoxia-Induced Vascular Remodeling via the FAK/PI3K/AKT/HIF-1α Axis. A, B Western blotting analysis for the protein levels of ITGA2, FAK, PI3K, AKT, HIF-1α,VEGF and α-SMA. All values are presented as the mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001

Discussion

Pulmonary arterial hypertension remains a challenging condition with limited therapeutic options, largely due to the complex pathological mechanisms underlying pulmonary vascular remodeling. The advancement and implementation of high-throughput sequencing have progressively unveiled critical roles of circular RNAs (circRNAs) in regulating gene expression both transcriptionally and post-transcriptionally during the development of PAH [30, 31]. Our study, leveraging clinical sample sequencing, identified a novel circRNA, circNLRP12, which is significantly upregulated in PH. Utilizing in vitro cellular models, we demonstrated that circNLRP12 critically regulates PASMC proliferation, apoptosis, migration, and vascular remodeling. Mechanistically, circNLRP12 exerts its effects by sponging miR-107-5p, thereby modulating ITGA2 expression and subsequently influencing PASMC remodeling and hypoxia response.

CircRNAs participate in diverse biological processes, and their dysregulation is strongly linked to diseases, including PAH-CHD [17, 24]. Elucidating the precise functions of circRNAs in endothelial dysfunction, vascular remodeling, and dysregulated signaling pathways offers important novel perspectives on the pathogenic mechanisms underlying PAH-CHD [16]. These non-coding RNAs exert their regulatory roles through diverse mechanisms, such as serving as microRNA (miRNA) decoys or sponges, modifying protein function, influencing metabolism, and regulating epigenetic modifications [13, 15, 32].

The competitive endogenous RNA (ceRNA) mechanism represents a prominent pathway through which circRNAs impact PH. For instance, circ-Calm4 is highly expressed in PAH models and functions as a sponge for miR-337-3p, regulating myosin 10(Myo10) and promoting PASMC proliferation via the circ-Calm4/miR-337-3p/Myo10 axis [33]. Furthermore, circ-Calm4 modulates pyroptosis through the circ-Calm4/miR-124-3p/programmed cell death 6 (Pdcd6) axis [31], highlighting its multifaceted role in PAH pathogenesis.

Beyond ceRNA functions, circRNAs regulate PH development via interactions with proteins and metabolic reprogramming. CircNAP1L4 directly binds its host protein nucleosome assembly protein 1-like 4(NAP1L4), influencing the super-enhancer-driven epigenetic regulation of the glycolytic gene Hexokinase II (HK II), thereby inhibiting hPASMC proliferation [34]. Targeting circNAP1L4 ameliorates PH in the SU5416-chronic hypoxia (SuHx) model [34]. Similarly, under hypoxic conditions, circ-Grm1 expression is upregulated and subsequently associates with fusion(FUS). This interaction competitively inhibits FUS binding, which markedly diminished GRM1 expression. and modulation of the Grm1/Rap1/ERK pathway, ultimately affecting PASMC proliferation and migration [35].

CircRNAs also play critical roles in metabolic reprogramming, a hallmark of PAH. Silencing CircSMOC1 expression enhances PASMC proliferation, migration, and aerobic glycolysis; conversely, in vivo overexpression suppresses vascular remodeling, right ventricular pressure, and cardiac hypertrophy [36]. Mechanistically, nuclear CircSMOC1 binds polypyrimidine tract binding protein 1 (PTBP1), competitively inhibiting the alternative splicing of pyruvate kinase M (PKM) pre-mRNA and favoring PKM2 expression to enhance glycolysis. Within the cytoplasmic compartment, CircSMOC1 functions by sequestering miR-329-3p, thereby acting as a molecular sponge for this microRNA, alleviating its suppression of pyruvate dehydrogenase beta (PDHB) expression, thereby contributing to metabolic dysregulation and mitochondrial dysfunction in PASMCs [36].

Epigenetic regulation, such as m⁵C modification, further expands the functional repertoire of circRNAs in PH. Hypoxia downregulates circCCNL2 expression, whose overexpression mitigates PH progression and inhibits PASMC proliferation [37]. NOP2/Sun RNA methyltransferase 2(NSUN2) mediates m⁵C modification of circCCNL2. Reduced NSUN2 expression decreases m⁵C modification, diminishing circCCNL2 binding to Fragile X mental retardation, autosomal homolog 2 (FXR2). This leads to increased association of free FXR2 with cyclin-dependent kinase-like 3 (CDKL3), promoting PASMC proliferation. m⁵C-modified circCCNL2 thus acts via FXR2 binding to suppress PH development [37].

Significant progress has also been made in identifying circRNAs as potential biomarkers for early diagnosis and prognosis assessment in PAH-CHD. Huang et al. reported significant downregulation of hsa_circ_0003416 in PAH-CHD children, demonstrating diagnostic potential with an AUC of 0.721 [17]. Similarly, elevated serum levels of hsa_circ_0068481 correlate with disease severity, right heart failure (RHF), and poor outcomes in idiopathic PAH (IPAH) patients, showing high diagnostic (AUC = 0.895) and prognostic value [38]. Guo et al. further validated hsa_circ_0068481 as a marker for right ventricular hypertrophy (RVH) in PAH patients (AUC = 0.974), implicating its interaction with miRNAs and eyes absent homolog 3 (EYA3) in the underlying mechanism [39].

Vascular remodeling, characterized by extracellular matrix deposition and medial thickening of pulmonary arteries, is a core feature of PAH pathophysiology [40]. The shifting of PASMCs from a contractile phenotype to a synthetic phenotype, proliferative, dedifferentiated, and migratory state is a key driver of this remodeling [41, 42]. PH is also associated with excessive pulmonary arteriole fibrosis and macrophage infiltration. Increased collagen deposition and fibrosis in the medial layer correlate with PH severity, with interstitial macrophage (iMΦ) infiltration playing a significant role [43]. Single-cell transcriptomics identified a specific iMΦ subtype (MHCII^hiLYVE1^loCCR2^hi) that expands in response to stimuli (e.g., Sugen5416/hypoxia) and drives medial fibrosis via the Wnt family member 11(WNT11)/planar cell polarity (PCP) pathway, promoting a fibroblast-like phenotype in PASMCs. Genetic ablation of Wnt11 in iMΦ reversed this fibrotic phenotype, reduced medial fibrosis, improved vascular compliance, and alleviated PH in rats [43]. Pulmonary adventitial fibroblasts also play crucial roles, exhibiting early, robust, and sustained proliferative, anti-apoptotic, and inflammatory responses to vascular stress in PH [44]. These findings underscore the intimate link between PAH and fibrosis across cellular, tissue, and organ levels.

The relevance of the FAK/PI3K/AKT/HIF-1α axis is further highlighted in other fibrotic contexts. Yang et al. demonstrated that integrin alpha 8 (ITGA8) is a key regulator of lysyl oxidase like 1 (LOXL1)-mediated liver fibrosis [45]. Silencing Itga8 in fibroblasts reduced LOXL1 expression and suppressed activation. LOXL1 activated the FAK/PI3K/AKT/HIF-1α pathway, and inhibitors of FAK or PI3K reversed these effects by downregulating LOXL1. HIF-1α directly interacted with and upregulated LOXL1, forming a positive feedback loop. Hepatic stellate cell (HSC)-specific Loxl1 deletion prevented fibrosis and inflammation by disrupting this FAK/PI3K/AKT/HIF-1α signaling cascade [45].

In this study, we observed significant upregulation of circNLRP12 in the peripheral blood of PAH patients and in hypoxic hPASMCs, suggesting its involvement in PAH pathogenesis. Functional experiments demonstrated that silencing circNLRP12 effectively counteracted hypoxia-induced hPASMC proliferation, migration, and apoptosis resistance. KEGG pathway analysis revealed marked enrichment in the NOD-like receptor (hsa04621), TGF-beta (hsa04350), and PI3K-Akt (hsa04151) signaling pathways (Fig. 2). suggesting their potential functional importance in circRNA-associated PHA. Thus, we conducted Western blotting to examine the protein levels of the PI3K/AKT signaling axis, revealing that circNLRP12 knockdown in hypoxic hPASMCs significantly downregulated key components of the FAK/PI3K/AKT/HIF-1α signaling pathway and altered the expression of vascular remodeling markers VEGF and α-SMA(Fig. 6). These results indicate that circNLRP12 promotes the synthetic phenotype switch in VSMCs and vascular remodeling, likely through modulation of the FAK/PI3K/AKT/HIF-1α axis.

Due to their remarkable stability and distinct expression profiles across tissues and cell types, circRNAs represent promising therapeutic targets [46, 47]. Strategies targeting circRNAs are actively being explored, and circRNA-based vaccines (e.g., CircRNA-RBD, VFLIP-X, cytokine-encoding circular mRNAs, CircRNAOVA-luc-LNP) have shown efficacy in preclinical models for various diseases [48]. Consequently, targeting circNLRP12 emerges as a potential novel therapeutic strategy for PAH intervention.

Despite the findings presented, this study has several limitations that should be acknowledged. First, the clinical sample size for circRNA sequencing was relatively small (n = 5 per group), which may affect the statistical power and generalizability of our initial screening results. Future validation in a larger, independent cohort is essential to confirm the clinical relevance of circNLRP12 as a biomarker. Second, our functional and mechanistic investigations were conducted entirely in vitro using cultured PASMCs. The absence of in vivo data from animal models of PAH means that we cannot yet confirm the therapeutic potential or the complex multicellular effects of targeting the circNLRP12 axis in a whole-organism context. Finally, while we have performed rescue experiments to strengthen the proposed ceRNA mechanism, the intricate regulatory network within PASMCs suggests that other potential targets and pathways might also be involved. Thus, the circNLRP12/miR-107-5p/ITGA2 axis, as proposed here, should be considered a significant but preliminary mechanistic pathway, warranting further in-depth validation.

In summary, our data reveal that circNLRP12 deficiency attenuates hypoxia-induced hPASMC dysfunction through the miR-107-5p/ITGA2 axis and downstream FAK/PI3K/AKT/HIF-1α signaling. These findings provide a molecular foundation for targeted clinical interventions in PAH.

Abbreviations

PAH

Pulmonary arterial hypertension

CHD

Congenital heart disease

PAH-CHD

Pulmonary arterial hypertension associated with congenital heart disease

hPASMCs

Human pulmonary arterial smooth muscle cells

PAP

Pulmonary artery pressure

circRNAs

Circular RNAs

FBS

Fetal bovine serum

qRT-PCR

Quantitative real-time polymerase chain reaction

SDS-PAGE

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis

3' UTR

3' Untranslated region

ceRNA

Competitive endogenous RNA

AUC

Area under the curve

Author contributions

LZ and ZM designed experiments; LZ and ZM carried out sample collection and process; LZ and ZM analyzed data. LZ and ZM wrote the manuscript.

Funding

This work was supported by the Natural Science Foundation of Xinjiang Uygur Autonomous Region (Grant No. 2022D01A308).

Data availability

The datasets generated during and analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The research was conducted in compliance with the ethical principles of the Declaration of Helsinki (2024 version) and was approved by the Institutional Ethics Committee at Xinjiang Uygur Autonomous Region People’s Hospital (XJSQ2022072808). Written informed consent was acquired from each participant prior to enrollment.

Competing interests

The authors declare no competing interests.