Pyrophosphate dysregulation and impaired FGF23/FGFR signaling contributes to impaired matrix mineralization in bone marrow stromal cultures from sickle cell disease mice

Abstract

Sickle cell disease (SCD) is characterized by osteopenia and impaired bone mineralization, but the underlying mechanisms remain unclear. Fibroblast growth factor 23 (FGF23), elevated in SCD, regulates phosphate metabolism through FGFRs/klotho and contributes to bone loss. Although FGF23’s systemic effects are known, its local actions in SCD bone remain poorly defined. Using bone marrow stromal cells (BMSCs) derived from SCD mice, we previously reported that enhanced local FGF23/FGFR1 signaling and increased osteopontin impair osteoblast mineralization, which is rescued by an FGF23-neutralizing antibody (FGF23Ab). Here, we further investigated downstream signaling and pyrophosphate/phosphate (PPi/Pi)-regulatory mechanisms contributing to mineralization defects. FGF23Ab reduced phospho-FGFR1, restored phospho-FGFR2 and phospho-AKT, and decreased pSTAT3 activation. SCD-BMSCs exhibited increased matrix inhibitors, matrix Gla protein (MGP) and matrix extracellular phosphoglycoprotein (MEPE), and reduced mineralization promoters PHEX and DMP1, which were partially normalized by FGF23Ab. FGF23Ab also corrected elevated PPi-generating enzymes ENPP1 and ANK and restored tissue-nonspecific alkaline phosphatase (TNAP). In contrast, the phosphate importer PiT2 was significantly reduced in SCD BMSCs and was further suppressed with FGF23Ab. These findings indicate that excessive local FGF23 signaling disrupts mineralization by upregulating matrix inhibitors and altering PPi/Pi-regulatory pathways. FGF23 neutralization partially restores mineralization capacity.

Introduction

Sickle cell disease (SCD) is an inherited hemoglobinopathy caused by a β-globin gene mutation that results in hemoglobin S polymerization, erythrocyte sickling, and chronic hemolysis. These processes drive vaso-occlusion, inflammation, and ischemia–reperfusion injury, contributing to multi-organ complications [1]. Among these, skeletal abnormalities—including osteopenia and impaired bone mineralization—are common in individuals with SCD [2], although the mechanisms underlying bone deficits remain poorly defined.

Fibroblast growth factor 23 (FGF23), a phosphate-regulating hormone produced primarily by osteocytes, is elevated in both the circulation and bone tissue of SCD mice [3–5]. We previously demonstrated that neutralization of FGF23 in vivo ameliorates renal phosphate wasting and mitigates bone loss in SCD mice [5]. Beyond its endocrine actions on kidney phosphate transport and vitamin D metabolism, FGF23 acts locally within bone through FGFR/α-klotho–dependent and –independent pathways. Our earlier work showed that bone marrow stromal cells (BMSCs) derived from SCD mice exhibit impaired mineralization associated with elevated osteopontin—a matrix inhibitor whose expression was reduced following FGF23 neutralization [5]—suggesting that local FGF23 signaling contributes to osteoblast dysfunction in SCD.

FGF23 interacts closely with matrix-regulating proteins such as MGP, MEPE, PHEX, and DMP1, which collectively coordinate mineralization through osteocyte-mediated mechanisms [6]. Perturbations in this regulatory network can increase ASARM peptides, suppress mineral deposition, and further stimulate FGF23 production, establishing a pathogenic feedback loop. Whether this matrix regulatory axis contributes to bone impairment in SCD, however, is unknown.

Emerging studies also show that excessive FGF23 signaling suppresses tissue-nonspecific alkaline phosphatase (TNAP) and increases inorganic pyrophosphate (PPi), a potent mineralization inhibitor generated by ENPP1 and ANK [7, 8]. The balance between PPi and inorganic phosphate (Pi) is essential for hydroxyapatite formation, yet it remains unclear whether PPi/Pi dysregulation participates in the mineralization defects observed in SCD.

In this study, we used BMSCs from SCD mice to further investigate how local FGF23/FGFR signaling affects osteoblast mineralization. We focused on two potential mechanisms: (1) dysregulation of extracellular matrix–associated mineralization proteins, and (2) alterations in PPi/Pi-regulating pathways. We further evaluated whether FGF23 neutralization can reverse these abnormalities and improve matrix mineralization.

Materials and Methods

Mice-

Female healthy controls (Ctrl) and Townes sickle cell disease (SCD) mice (Ryan et al., 1997) on a mixed C57BL/6 × 129 background were purchased from The Jackson Laboratory (Stock 013071, Bar Harbor, ME, USA) and maintained in the Center for Comparative Medicine at UConn Health. Mice were maintained on Envigo Teklad Diet-2918 (1% calcium, 0.7% phosphate, 1.5 IU vitamin D3/g diet). At 6 months of age, mice were euthanized with CO₂ for BMSC collection.

This study exclusively utilized female mice. Our focus on females was based on prior in vivo findings in female SCD mice [5], which the current work extends by identifying additional mechanisms through which local FGF23 contributes to bone pathology in vitro. Because male mice were not included, it remains unknown whether these findings are generalizable to males.

All animal procedures were approved by the UConn Health Institutional Animal Care and Use Committee with reference number AP-201028.01, approved on 12/19/2023. The ethical guidelines were followed. All studies were conducted in compliance with institutional and ARRIVE guidelines, as well as the NIH (National Research Council) Guide for the Care and Use of Laboratory Animals.

In vitro Bone Marrow Stromal Cell (BMSC) Cultures-

As previously described in detail [5], bone marrow cells were flushed from femurs and tibias, seeded at 2 × 10⁶ cells per well in 6-well plates, and cultured for 3 days in proliferation medium (αMEM + 10% FBS + 100 U/mL penicillin-streptomycin). Cells were then switched to osteogenic medium (αMEM + 10% FBS + 100 U/mL penicillin-streptomycin + 4 mM β-glycerophosphate + 50 μg/mL ascorbic acid). To assess whether FGF23 neutralization could rescue bone nodule formation, cells were treated with either control IgG or a rat anti-rat FGF23 antibody (FGF23Ab, 100 nM; clone 58.5, Amgen, Inc., Thousand Oaks, CA) throughout the 21-day culture. This concentration was chosen based on our previous study showing it can alleviate BMSC mineralization defect from SCD mice [5]. A rat anti-NGFPb-3F8-raIgG2a served as control. Bot control IgG and FGF23Ab were dissolved in 9% sucrose in sodium acetate, pH 5.0. Cell culture supernatant was collected at day 21. Cultured cells were harvested at days 7 and 21 for ALP and Alizarin red staining. RNA and proteins were extracted from 21-day parallel cultures for qPCR and Western blot analyses.

Dish Staining and Quantification-

At day 7, cultures were stained for alkaline phosphatase (ALP) using a commercially available staining kit (Sigma, St. Louis, MO) and counterstained with crystal violet for total cell visualization. At day 21, mineralized nodules were detected by Alizarin Red staining (ScienCell Research Laboratories, Carlsbad, CA). Stained dishes were scanned, and Alizarin Red was extracted using the ARed-Q kit (ScienCell) and quantified per manufacturer’s instructions.

mRNA Isolation and Gene Expression-

Total RNA was extracted using TRIzol (Invitrogen) and 3 μg was reverse-transcribed with the RNA-to-cDNA EcoDry Premix (Oligo dT, Takara Bio) for qRT-PCR. Reactions were performed using iTaq Universal SYBR Green Supermix on a CFX Duet Real-Time PCR System (Bio-Rad). βActin was used as a reference gene, and expression levels were normalized to βActin and expressed as fold change relative to the first sample of each group. Primer sequences are provided in Table 1.

Table 1.

Primers used for qPCR

Genes	Forward Primer	Reverse Primer
β-Actin	ATGGCTGGGGTGTTGAAGGT	ATCTGGCACCACACCTTCTACAA
Fgf23	ACTTGTCGCAGAAGCATC	GTGGGCGAACAGTGTAGAA
Fgfr1c	GACTGCTGGAGTTAATACCA	CTGGTCTCTCTTCCAGGGCT
Fgfr2	CTGTGGGCTGAAGGCATT	CCCTGGTCCTCTTCCATATCT
Fgfr3c	GTTCTCTCTTTGTAGACTGC	AGTACCTGGCAGCACCA
Mgp	GTGGCGAGCTAAAGCCCAA	CGTAGCGCTCACACAGCTTG
Mepe	ACTATCCACAAGTGGCCTCG	CCGCTGTGACATCCCTTTAT
Phex	ATTAGGTGCCGAGAGGAAGA	TCCCCACAACATATGGGAGT
Dmp1	CACGGACAGCAGTGAATCTGG	GCCGGTCCCCGTACTCTTA
Enpp1	TGGACCCTCAGTGGCAACTT	AAGTTGTCAGAGCCATGAAATCC
Ank	CTGCTGCTACAGAGGCAGTG	GACAAAACAGAGCGTCAGCGA
Tnap/Alpl	GTGACTACCACTCGGGTGAAC	CTCTGGTGGCATCTCGTTATC
Pit2/Slc20a2	TGGACGGGTATCTGTGGATG	ATCGTTGGCACCGACTGAAAA

Protein Extraction and Western Blot-

Proteins were extracted with Radioimmunoprecipitation Assay (RIPA) buffer (Cell Signaling Technology) and quantified with a Bicinchoninic Acid (BCA) assay (Pierce). Proteins were separated on 4–15% SDS-PAGE gels then transferred to Immu-Blot^® PVDF Membrane for Protein Blotting (MBIO-RAD). After blocking for 1 hour in 5% nonfat dry milk (TBS-T), membranes were incubated with primary antibodies overnight at 4 °C and with secondary antibodies for 1 hour at room temperature. Signals were visualized using SuperSignal^™ West Dura substrate (Thermo Scientific) and quantified by ImageJ densitometry. Membranes were stripped and re-probed for βactin. Antibodies are listed in Table 2.

Table 2.

Antibodies

Name	Source	Catalog#	RRID
β-Actin	Santa Cruz	sc-47778	AB_626632
FGF23	R&D SYSTEM	MAB26291	AB_2104623
pFGFR1	Abcam	ab59194	AB_941585
pFGFR2	Invitrogen	PA5-106140	AB_2817538
pFGFR3	Invitrogen	PA5-64798	AB_2662689
αKlotho	R&D SYSTEM	AF1819	AB_2296612
pSTAT3	Cell Signaling Technology	9145	AB_2491009
pAKT	Cell Signaling Technology	4060	AB_2315049
AKT	Cell Signaling Technology	8596	AB_10890703
MGP	Proteintech	10734-1-AP	AB_2297660
MEPE	Bioss	bs-8689R	AB_3716608
PHEX	Invitrogen	PA5-143870	AB_3075084
DMP1	GeneTex	GTX04077	AB_3716607
ENPP1	Bioss	bs-4913R	AB_3716606
ANK	Abgen	ap9741b	AB_10614768
TNAP	Bioss	bs-1535R	AB_10856921
PIT2/ SLC20A2	Invitrogen	PA5-121031	AB_2914603

Measurement of PPi in cell culture supernatant-

PPi levels in cell culture supernatant were measured using the PPiLight Inorganic Pyrophosphate Assay (Lonza) following the manufacturer’s instructions. The luminescence readings (RLUs) corresponding to PPi were normalized to the total protein content of the respective wells.

Statistical Analysis-

Statistical analyses were performed with GraphPad Prism 10. Comparisons were made using two-way ANOVA with Tukey’s post hoc test. p < 0.05 was considered significant. Data are shown as mean ± standard error of the mean (SEM), with individual values shown in bar graphs.

Results

Impact of FGF23Ab Treatment on Mineralized Nodule Formation in BMSC Cultures Derived from SCD Mice -

At 7 days of culture, there was no difference in ALP-positive area between Ctrl-IgG and SCD-IgG BMSCs. Crystal violet area was lower in SCD-IgG cultures versus Ctrl-IgG (p=0.0075), with no alternation by FGF23Ab treatment (Fig.1A–D). We investigated whether BMSCs from SCD mice exhibit reduced bone nodule formation and if treatment with FGF23Ab can restore this capacity. At day 21 of culture, Alizarin Red staining revealed markedly reduced mineralized nodules in SCD-IgG BMSC cultures versus Ctrl-IgG, which were markedly improved by FGF23Ab treatment (Fig.1E). After solubilization Alizarin Red was quantified. Alizarin Red concentration was lower in SCD-IgG culture Ctrl-IgG (p<0.0001), which was improved by FGF23Ab treatment (p=0.0421) (Fig.1F).

Figure 1. Effect of FGF23Ab on ALP-positive colonies and mineralized nodules formation in BMSC cultures from Ctrl and SCD mice.

BMSCs from 6-months-old female Ctrl and SCD were plated in proliferation media for 3 days then changed to osteogenic media and cultured for up to 21 days. FGF23Ab and control IgG were added at plating and with each media change. Representative images of (A) ALP-positive colonies and (C) crystal violet at 7 days of culture, and (E) Alizarin Red staining at 21 days of culture. (B) ALP-positive colony area and (D) crystal violet-positive colony area was quantified utilizing ImageJ software. (F) The concentration of Alizarin Red was quantified after the dye was solubilized. n = 6 wells/group per time point. Data are presented as individual values with mean ± standard error of the mean (SEM). *: p<0.05 by two-way ANOVA with Tukey’s post hoc test.

Impact of FGF23Ab on FGF23, pFGFRs, αKlotho, pSTAT3, and pAKT Expression in SCD BMSC Cultures-

Since FGF23 signals through FGF receptors (FGFRs), we measured expression of FGF23, pFGFR1, pFGFR2, pFGFR3, co-receptor αKlotho in BMSCs cultured for 21 days. Fgf23 mRNA levels did not differ among groups (Table 3); however, Western blotting (Fig.2A) and quantification analysis (Fig,2B) showed that FGF23 protein level was higher in SCD-IgG BMSC cultures versus Ctrl-IgG (p=0.0248). FGF23Ab treatment did not significantly decrease FGF23 level in SCD BMSC culture. Fgfr1c mRNA showed no difference between Ctrl-IgG and SCD-IgG but Fgfr1c mRNA level was significantly reduced with FGF23Ab in SCD BMSCs (Table 3). Phosphorylated FGFR1 protein was elevated in SCD-IgG (p=0.0364) and significantly reduced with FGF23Ab (p=0.0492) (Fig.2). Fgfr2 mRNA was higher in SCD-IgG cultures versus Ctrl-IgG cultures, but unaffected by FGF23Ab (Table 3). In contrast, phosphorylated FGFR2 protein was reduced in SCD-IgG cultures compared to Ctrl-IgG cultures (p=0.0041) and increased by FGF23Ab (p=0.0283) (Fig.2). Fgfr3c mRNA level was elevated in SCD-IgG cultures versus Ctrl-IgG (p=0.0001) and reduced by FGF23Ab (p=0.0262) (Table 3). However, there was no significant difference in phosphorylated FGFR3 protein expression among groups (Fig.2). αKlotho, a co-receptor for FGF23, mRNA levels were similar among groups (Table 3). αKlotho protein level was significantly higher in SCD-IgG culture versus Ctrl-IgG (Fig.2). STAT3 and AKT are the major intracellular signaling pathway molecules for FGFR. pSTAT3 protein level was higher in SCD-IgG compared to Ctrl-IgG (p=0.0002) and was decreased with FGF23Ab treatment (p=0.0294) (Fig.2). pAKT level was lower in SCD-IgG culture versus Ctrl-IgG (p=0.01) and was increased after FGF23Ab treatment (p=0.0126) (Fig.2).

Table 3.

Heatmap representing qPCR analysis of genes of interest

Genes	Ctrl IgG	Ctrl FGF23Ab	SCD IgG	SCD FGF23Ab
Fgf23	0.86	0.91	0.95	0.93
Fgfr1c	0.94	0.81	1.07	0.79	c
Fgfr2	1.18	0.80	2.59	2.23	a
Fgfr3c	1.23	0.49	2.48	1.77	a b c
aKlotho	0.95	0.65	0.79	0.87
Mgp	0.91	1.14	0.78	0.67
Mepe	0.96	0.60	2.83	1.58	a b c
Phex	1.07	0.34	2.72	2.58	a b
Dmp1	0.99	0.50	0.81	0.69	b
Enpp1	1.01	1.16	2.18	1.06	a c
Ank	1.03	1.22	0.93	0.96
Pit2	1.00	0.99	1.25	0.82
Tnap	1.06	0.57	1.78	1.62	a b

Data are presented as mean (n = 6 wells per group). Significance annotations:

^aCtrl-IgG vs. SCD-IgG, p < 0.05

^bCtrl-IgG vs. Ctrl-FGF23Ab, p < 0.05

^cSCD-IgG vs. SCD-FGF23Ab, p < 0.05.

p-values were determined using two-way ANOVA followed by Tukey’s post hoc test.

Figure 2. Analysis of FGF23, pFGFR1, pFGFR2, pFRR3, αKlotho, pSTAT3, and pAKT protein level in BMSCs cultured for 21 days from Ctrl mice and SCD mice with control IgG or FGF23Ab treatment.

BMSCs from 6-months-old Ctrl and SCD female mice were plated in proliferation media for 3 days then changed to osteogenic media and cultured for up to 21 days. FGF23Ab and control IgG were added at plating and with each media change. (A) Western blot image and (B) quantification of protein level for FGF23, pFGFR1, pFGFR2, pFRR3, αKlotho, pSTAT3, and pAKT. n = 6 samples/group. Data are presented as individual values with mean ± standard error of the mean (SEM). *: p<0.05 by two-way ANOVA with Tukey’s post hoc test.

Effect of FGF23Ab on Matrix-regulating Proteins in BMSC Cultures derived from Ctrl mice and SCD Mice-

MGP and MEPE are matrix mineralization inhibitors that are known to be regulated by FGF23. We examined MGP and MEPE mRNA and protein level BMSC at 21-days of cultures. Mgp mRNA levels were unchanged (Table 3), but MGP protein was increased in SCD-IgG and reduced by FGF23Ab (Fig.3A&B). MEPE mRNA and protein were elevated in SCD-IgG cultures versus Ctrl-IgG (p<0.0001) and were reduced by FGF23Ab (p<0.0001) (Table 3 and Fig.3A&B). Phex mRNA was higher in SCD-IgG, with no change after treatment (Table 3); however, PHEX protein was reduced in SCD-IgG cultures and restored with FGF23Ab (p = 0.041) (Fig.3A&B). There was no difference in Dmp1 mRNA level between SCD-IgG and Ctrl-IgG, FGF23Ab reduced Dmp1 mRNA in Ctrl BMSCs (p <0.0001), with no effect in SCD BMSCs (Table 3). DMP1 protein level was significantly lower in SCD-IgG cultures versus Ctrl-IgG (p=0.033), which was improved with FGF23Ab treatment (p=0.001) (Fig.3A&B).

Figure 3. Impact of FGF23Ab on matrix-related protein level, PPi/Pi regulating protein expression, and PPi level in 21-day BMSC cultures derived from Ctrl mice and SCD mice.

BMSCs from 6-months-old Ctrl and SCD female mice were plated in proliferation media for 3 days then changed to osteogenic media and cultured for up to 21 days. FGF23Ab and control IgG were added at plating and with each media change. (A) Western blot image and (B) quantification analysis of protein for MGP, MEPE, PHEX, and DMP1. (C) Western blot image and (D) quantification of protein level for ENPP1, ANK, PIT2, and TNAP. (E) PPi level in cell culture supernatant. n = 6 samples/group. Data are presented as individual values with mean ± standard error of the mean (SEM). *: p<0.05 by two-way ANOVA with Tukey’s post hoc test.

Impact of FGF23Ab on PPi/Pi Regulators and PPi level in BMSC Cultures Derived from Ctrl Mice and SCD Mice -

Recent study showed that FGF23 suppresses TNAP transcription that results in reduced local inorganic Pi production and accumulation of PPi in osteoblast [7, 8], thus we investigated the involvement of TNAP and other PPi/Pi regulators in the impaired bone nodule formation of SCD cultures. ENPP1 catalyzes the hydrolysis of ATP to create PPi, which is an inhibitor of mineralization. As shown in Table 3 and Fig.3C&D, Enpp1 mRNA and protein levels were significantly elevated in SCD-IgG that were significantly reduced with FGF23Ab. ANK, a transmembrane protein, primarily regulates the transport of intracellular inorganic PPi to the extracellular space. As shown in Table 3 and Fig.3C&D, Ank mRNA was unchanged, but ANK protein was significantly increased in SCD-IgG BMSC cultures and significantly reduced by FGF23Ab. PiT2 is the major type of sodium-dependent phosphate transporter in mineralized tissues and is responsible for importing phosphate into cells. There was no difference in Pit2 mRNA level among groups, whereas PIT2 protein was decreased in SCD-IgG cultures compared to cultures from Ctrl-IgG (p = 0.0413) and further decreased with FGF23Ab (p = 0.0149) (Table 3 and Fig.3C&D). TNAP regulates PPi and Pi by breaking down inorganic PPi into inorganic Pi, which promotes mineralization. As shown in Table 3 and Fig.3C&D, Tnap mRNA was higher in SCD-IgG culture versus Ctrl-IgG culture, with FGF23Ab decreasing expression only in Ctrl cultures. However, TNAP protein level was lower in SCD-IgG cultures versus Ctrl-IgG (p=0.0023) and improved by FGF23Ab (p=0.024). As a readout for TNAP protein function, we measured the PPi level in the cell culture supernatant. PPi level was significantly higher in SCD-IgG cultures versus Ctrl-IgG, that was decreased with FGF23Ab treatment (Fig.3E).

Discussion

This study demonstrates that excessive local FGF23/FGFR signaling plays a central role in impairing osteoblast mineralization in SCD and that FGF23 neutralization partially restores this defect. By integrating matrix-regulating pathways with PPi/Pi homeostasis, our findings expand prior in vivo observations [5] and identify previously unrecognized mechanisms through which FGF23 contributes to bone pathology in SCD.

Consistent with previous reports, SCD-BMSC cultures exhibited elevated FGF23 protein despite unchanged mRNA expression, suggesting enhanced translation, stabilization, or reduced degradation of FGF23 under SCD-related microenvironmental stress.

FGF23 neutralization corrected multiple abnormalities in matrix-regulating proteins. SCD-BMSCs displayed increased MGP and MEPE—both mineralization inhibitors—and reduced PHEX and DMP1, key promoters of bone matrix maturation. FGF23Ab normalized these alterations, supporting restoration of the FGF23–PHEX–DMP1 axis and highlighting its contribution to the impaired mineralization phenotype. Given the known role of PHEX deficiency in MEPE-derived ASARM peptide accumulation and subsequent FGF23 stimulation, these results suggest that a dysfunctional matrix protein network amplifies FGF23-driven inhibition of mineralization in SCD.

A major new finding is that SCD-BMSCs exhibit a pronounced PPi-favoring environment characterized by elevated ENPP1 and ANK and reduced TNAP protein levels. Increased PPi accumulation in culture supernatants confirmed functional dysregulation. These changes closely mirror the mineralization impairment previously described in models of excessive osteocytic FGF23 production [7, 8]. FGF23Ab effectively reduced ENPP1 and ANK while restoring TNAP, indicating that FGF23 signaling directly interferes with PPi/Pi balance in SCD osteoblasts. Interestingly, TNAP mRNA was upregulated despite diminished protein, suggesting post-transcriptional inhibition or enhanced degradation—potentially involving pathways activated by FGF23.

Notably, the classical view that ANK/ANKH directly transports inorganic PPi has been revised by recent mechanistic studies. Evidence now indicates that ANK primarily exports intracellular nucleoside triphosphates—especially ATP—into the extracellular space, where ATP is enzymatically hydrolyzed by ENPP1 to generate PPi [9, 10]. Thus, increased ANK protein in SCD-BMSCs likely enhances extracellular nucleotide release, indirectly promoting PPi accumulation. This mechanism aligns with our observation that both ANK and ENPP1 are elevated in SCD cultures and are reduced by FGF23 neutralization. These findings support the evolving model that FGF23-driven ANK upregulation contributes to mineralization defects not through direct PPi transport, but by facilitating ENPP1-dependent PPi production, amplifying the inhibitory mineralization milieu in SCD.

The observation that Ank mRNA levels were unchanged whereas ANK protein expression was markedly increased in SCD-IgG–treated BMSCs suggests regulation at a post-transcriptional level. Several mechanisms may explain this divergence. First, progressive ankylosis protein (ANK) protein stability is known to be influenced by intracellular signaling pathways downstream of FGFR activation, including stress-responsive kinases, which can enhance protein stabilization or trafficking to the membrane without altering transcription [11, 12]. SCD–associated inflammatory factors present in SCD-IgG may suppress proteasomal degradation of ANK, resulting in protein accumulation despite unchanged transcript levels. Conversely, FGF23 neutralization likely attenuates these signaling pathways, restoring normal protein turnover and thereby reducing ANK abundance. Thus, the discordance between mRNA and protein levels supports a model in which FGF23 signaling modulates ANK primarily through post-transcriptional and post-translational mechanisms rather than transcriptional activation.

In addition to abnormalities in PPi/Pi-regulating enzymes, we identified a defect in phosphate import through reduced PiT2 protein expression. PiT2, a major sodium-dependent phosphate transporter in mineralizing cells, was decreased in SCD BMSCs and unexpectedly further suppressed by FGF23Ab. Because PiT2 is essential for intracellular Pi availability—required for hydroxyapatite formation and for balancing the inhibitory effects of PPi—its reduction represents a distinct, FGF23-independent mechanism limiting osteoblast mineralization. Reduced Pi uptake may blunt the mineralization rescue achieved by FGF23 neutralization, helping explain why FGF23Ab only partially restores mineral deposition.

Altered phosphorylation patterns of FGFR1 and FGFR2 further underscore the complexity of FGF23 signaling in SCD. Increased pFGFR1 and reduced pFGFR2 in SCD-BMSCs may reflect receptor-specific activation states that differentially influence downstream pSTAT3 and pAKT signaling. The ability of FGF23Ab to suppress pFGFR1 while restoring pFGFR2 and pAKT suggests that therapeutic blockade may recalibrate receptor utilization toward a more pro-mineralization signaling profile.

In addition to our observations, the differential activation of FGFR1 and FGFR2 identified in SCD-BMSCs is consistent with their established receptor-specific roles in osteoblast biology [13]. FGFR1 signaling is generally associated with suppression of osteoblast differentiation and matrix mineralization, in part through activation of STAT3 and ERK pathways and downstream repression of Runx2 and Osterix. Experimental activation of FGFR1 in osteoblasts reduces bone formation and enhances expression of mineralization inhibitors such as MGP and MEPE [14]—features that parallel the phenotype we observed in SCD cultures. In contrast, FGFR2 normally promotes osteoblast proliferation, early differentiation, and maturation by supporting AKT and MAPK signaling, and its deficiency leads to reduced Osx expression, impaired alkaline phosphatase activity, and defective mineral deposition [15]. This receptor biology aligns closely with our findings: SCD-BMSCs showed increased pFGFR1 and decreased pFGFR2, indicating a shift toward a signaling environment that favors anti-mineralization pathways. The ability of FGF23Ab to suppress pFGFR1 while restoring pFGFR2 and pAKT suggests that excessive FGF23 skews receptor utilization from a physiologic FGFR2-dominant, pro-osteogenic profile toward a pathological FGFR1-dominant state. This shift likely contributes to enhanced STAT3 activation, increased matrix inhibitors, and PPi accumulation. Thus, our data support a model in which excessive local FGF23 alters FGFR1/FGFR2 balance, amplifying downstream disruptions in osteoblast maturation and matrix mineralization in SCD.

Finally, combined defects—including matrix inhibitor upregulation, PPi/Pi imbalance, and reduced PiT2-mediated phosphate uptake—likely converge to produce the profound mineralization impairment characteristic of SCD (Fig.4). This multifactorial disturbance suggests that FGF23 blockade alone may not fully correct osteoblast dysfunction, and that targeting phosphate import pathways (e.g., PiT2 stability or activity) could represent a complementary therapeutic strategy.

Figure 4. Schematic model depicting how FGF23 locally impair bone formation in SCD mice.

FGF23 over production in SCD BMSC cultures results in over production of extracellular matrix mineralization inhibiting protein MGP and MEPE, but inhibiting on matrix promoting protein PHEX and DMP1, these lead to bone mineralization defect. Increased FGF23 production and FGFR1 upregulation suppress TNAP activity through autocrine/paracrine mechanisms and enhance the expression of the PPi-producing proteins ENPP1 and ANK. This combination drives PPi accumulation and ultimately inhibits bone mineralization. FGF23Ab alleviated impaired bone formation in SCD BMSC culture by modulating matrix-regulating protein and PPi/Pi regulating proteins.

Highlights.

• Excessive FGF23 signaling disrupts mineralization in SCD BMSC cultures.

• FGF23 antibody treatment partially restores impaired matrix mineralization.

• Matrix inhibitors MGP and MEPE rise in SCD and are reduced by FGF23Ab.

• ENPP1 and ANK elevation in SCD promotes PPi excess and impaired mineralization.

• SCD BMSCs show increased PPi and reduced TNAP, corrected by FGF23 blockade.

Data availability-

All data supporting the findings of this study are included in the manuscript and its supplementary materials. Additional datasets generated and/or analyzed during the study are not publicly archived but can be obtained from the corresponding author upon reasonable request.