Silencing of optogenetic and chemogenetic transgenes in human iPSCs involves promoter methylation and methylation-independent mechanisms

ABSTRACT

The transplantation of neural progenitor cells derived from induced pluripotent stem cells (iPSCs) has therapeutic potential for the treatment of neurological diseases. However, the functional integration of transplanted iPSC-derived neurons into host neural networks remains controversial. Optogenetic and chemogenetic tools offer the means to assess such integration. However, constructing modifiable iPSC-derived neurons requires efficient gene editing. Here, we used CRISPR/Cas9 (targeting the AAVS1 safe harbor) and PiggyBac transposon systems to insert optogenetic and chemogenetic receptors (ChR2/hM4Di) into human iPSCs. While both systems successfully integrated genes into the genomes of HEK293T cells and iPSCs, receptor expression was detected only in HEK293T cells. Bisulfite sequencing revealed extensive methylation of the TRE3G BI promoter (95.3–98.2%) in iPSCs, in contrast to low methylation (5.9%) in HEK293T cells. For PiggyBac, the methylation of CMV/EF1α promoters in iPSCs exhibited integration site-dependent variability (0–95.2%). Notably, even hypomethylated clones failed to show gene expression, suggesting that additional regulatory mechanisms, such as histone modifications or chromatin remodeling, may contribute to transcriptional silencing. Differentiation into neural stem cells does not reverse methylation nor restore protein expression. Our findings demonstrate that the CRISPR/Cas9 and PiggyBac systems enable the integration of optochemical receptor genes into iPSCs. However, promoter methylation or other epigenetic and non-epigenetic gene-silencing mechanisms could pose barriers to efficient protein expression from the integrated transgene in iPSCs.

Introduction

Induced pluripotent stem cells (iPSCs) provide a versatile source for generating functional neurons, underpinning a key regenerative medicine strategy aimed at repairing central nervous system (CNS) damage through the transplantation and differentiation of iPSCs [1]. The functional integration of transplanted neurons into the host neural network is critical for treating neurological diseases [2]. However, validating the functional integration of transplanted neurons into the host neural network remains a significant challenge. Current approaches predominantly rely on histomorphological analyses of synaptic connections for assessing structural integration; however, direct measures of functional integration, such as neuronal electrical activity modulation, are limited.

Recent advancements in optogenetic and chemogenetic tools have led to transformative solutions. Channelrhodopsin-2 (ChR2) enables neuronal excitation via blue light-induced sodium influx [3]. The G protein-coupled receptor, hM4Di, commonly used in chemical genetics, is an engineered Gi-coupled DREADD derived from the human muscarinic acetylcholine receptor M4. Upon activation by clozapine N-oxide (CNO, which is metabolized in vivo to the active agonist clozapine), hM4Di induces hyperpolarization of the neuronal membrane and mediates suppression of neuronal activity [4]. These tools allow precise manipulation of transplanted neuron activity, providing a mechanistic basis to validate their integration into host circuits [5,6].

iPSCs have important clinical applications due to their capacity to differentiate into a variety of cell types from all three germ layers [7,8]. In recent years, basic research on the application of iPSC-derived neuronal cell transplantation in neurological disorders has become a focal area of scientific interest. However, it remains controversial whether iPSC-derived neurons can be effectively integrated into the host neural network to participate in neurological function repair. Direct gene editing of iPSCs to express ChR2 and hM4Di is crucial for the rapid acquisition of a sufficient number of modified iPSC-derived neurons. The AAVS1 locus on chromosome 19 serves as a ‘safe harbor’ for transgene insertion, offering stable expression without disrupting host gene transcription [9,10]. Currently, virus-independent methods for efficient integration of exogenous genes include the CRISPR/Cas9 system [11] and PiggyBac transposon system [12], among others. As a gene editing technology with the advantages of high efficiency, accuracy, reproducibility, and reversibility, CRISPR/Cas9 has been widely used in the study of gene function and gene therapy in a variety of organisms [13]. The integration of CRISPR/Cas9 technology with the AAVS1 locus has emerged as a powerful tool in multifaceted therapeutic research using iPSCs. CRISPR/Cas9-mediated gene editing has been used to insert the anti-GD2 gene into the AAVS1 locus of iPSCs. Subsequently, these genetically modified iPSCs were induced to differentiate into anti-GD2 chimeric antigen receptor macrophages, representing a promising approach for treating neuroblastoma and melanoma [14]. The PiggyBac transposon system has also been successfully employed to induce the differentiation of iPSCs into neural stem cells [15]. These studies support the feasibility and reliability of gene editing in iPSCs using CRISPR/Cas9 and PiggyBac systems.

Recently, several studies have shown that the AAVS1 locus is not as safe as commonly believed. Various levels of transgene silencing have been found across cell types [16,17]. Transgene silencing of different myeloid-specific promoters has been observed during the differentiation of iPSCs into myeloid cells [17]. In addition, DNA methylation of the exogenous promoter is an important epigenetic mechanism leading to gene silencing [18]. Therefore, assessing exogenous promoter-driven gene expression in iPSCs is important for the advancement and optimization of iPSC-based research and applications.

Thus, this study aimed to validate the efficiency of CRISPR/Cas9- and PiggyBac-mediated gene integration and investigate whether promoter methylation underlies transgene silencing in iPSCs. By addressing these objectives, this study sought to clarify the epigenetic barriers to the direct genetic modification of iPSCs. These findings will provide critical insights into optimizing gene editing strategies for iPSCs.

Materials and methods

HEK293T culture

HEK293T cells were kindly provided by Stem Cell Bank, Chinese Academy of Sciences. The cells were cultured in Dulbecco’s modified Eagle’s medium with high glucose (Bio-Channel, Nanjing, China) supplemented with 10% fetal bovine serum (FBS; Bio-Channel, Nanjing, China) and 1% penicillin-streptomycin-amphotericin B solution (Bio-Channel, Nanjing, China). Cells were passaged when the cells grew until they reached 90% confluence.

iPSCs culture and neural progenitor cell differentiation

iPSCs (DYR0100, serial NO. SCSP-1301) were provided by Stem Cell Bank, Chinese Academy of Sciences, which were generated from human foreskin fibroblasts via transduction of the Yamanaka factors (OCT4, SOX2, KLF4, and c-MYC). iPSCs were routinely cultured in Petri dishes coated with Matrigel (no less than 2 h at 37°C, Corning, NY, USA) using mTeSR™ Plus complete medium (STEMCELL, Vancouver, Canada). Cells were passaged by washing once with DPBS (without Ca²⁺ and Mg²⁺; Bio-Channel, Nanjing, China), followed by incubation with EDTA (0.5 mM) for 3 min. Subsequently, iPSCs were resuspended in mTeSR plus complete medium supplemented with a ROCK inhibitor (Y-27632, 10 µM, MedChemExpress, NJ, USA) on the first day and seeded into Matrigel-coated dishes at a 1:20 ratio. The medium was changed every other day.

When the density of iPSCs reached 90% confluence, the medium was changed to neural induction medium containing 50% DMEM/F12 (Bio-Channel, Nanjing, China), 50% NeuroGro® Neuronal basic culture medium (Basalmedia, Shanghai, China), 10 µM SB431542 (Selleck, TX, USA), 100 nM LDN193189 (TargetMol, MA, USA), 1% N2 Supplement (100×) (Basalmedia, Shanghai, China), and 1% GlutaMAX™ Supplement (ThermoFisher Scientific, MA, USA). Thereafter, the medium was changed every day for 9 days. The cells were then digested with Accutase Cell Detachment Solution (BioLegend). After centrifugation, cells were resuspended in neural progenitor cell (NPC) medium, containing a 1:1 mixture of DMEM/F12 and NeuroGro® Neuronal basic culture medium, 1% N2 Supplement, 0.5% B27 Supplement without vitamin A (Basalmedia, Shanghai, China), and 1% GlutaMAX™, and seeded in fresh Matrigel-coated cell culture plates. The NPC medium was changed daily until the cells showed ‘neural rosette’ morphology. The cells were then passaged in two Matrigel-coated cell culture plates. After ‘neural rosettes’ formation, the cells were dissociated with Accutase and cryopreserved in liquid nitrogen until use.

Construction of recombinant plasmids

The sequence of ChR2-hM4Di was amplified via polymerase chain reaction (PCR) using the plasmid CAG:ChR2HA-2a-hM4Di (Addgene, Cat No. 52,520) as the template. The PCR-amplified DNA product was separated through a 1.5% agarose gel electrophoresis, and the product was purified using an Agarose Gel Extraction Kit (Cat No. DP209-03, Tiangen, Beijing, China). To generate the recombinant plasmids AAVS1-3 G-puro-tetOn-ChR2-hM4Di and PiggyBac-ChR2-hM4Di, the AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep (Addgene, Cat No. 92,099) and PiggyBac-dual-promoter vector (Cat No. BR452, Fenghuishengwu, Wuhan, Hubei, China) were linearized using specific restriction endonucleases NotI or XbaI/NotI respectively. Linearized vectors were recombined with PCR-amplified products using the seamless assembly method (Cat No. RK21020, ABclonal, Wuhan, Hubei, China) according to the manufacturer’s standard protocol. The seamless assembly reaction was transformed into DH5α Competent Cells. On the subsequent day, individual colonies were selected for screening to verify the presence of the target inserted genes via colony PCR. Plasmid DNA isolated from positive bacterial colonies was verified for sequence accuracy via Sanger sequencing.

Gene editing of HEK293T cells and iPSCs

HEK293T and iPSCs were separately seeded into 6-well culture plates at a density of 3 × 10 [5] cells per well. The next day, the cells were transfected with corresponding plasmids using Lipo8000™ Transfection Reagent (for HEK293T cells, Beyotime, Shanghai, China) or Lipomaster 3000 transfection reagent (for iPSCs, Vazyme, Wuhan, China) according to the manufacturer’s instructions. For the CRISPR/Cas9 system, cells were co-transfected with AAVS1-3 G-puro-tetOn-ChR2-hM4Di (1 µg) and AAVS1 gRNA all-in-one CRISPR/Cas9 plasmid (0.5 µg, Addgene, Cat No. 196,139). For the PiggyBac transposon system, cells were co-transfected with PiggyBac-ChR2-hM4Di (1 µg) and PiggyBac-transposase plasmids (0.5 µg, Cat No. BR453, Fenghuishengwu, Wuhan, Hubei, China). After 24 h, puromycin was added to screen HEK293T cells (2 µg/mL) and iPSCs (0.5 µg/mL). This selection process was maintained until the formation of single, discrete cell colonies. Single-cell clones were acquired using limiting dilution. The selected colonies were cultured in a medium supplemented with puromycin at a concentration equivalent to half of the screening concentration to maintain selective pressure and promote transgene retention. Junction PCR was employed to identify the CRISPR/Cas9-edited corrected clone, and green fluorescent protein 2 from the copepod Pontellina plumata (CoGFP) was used to identify successful gene insertion by PiggyBac gene editing.

Genomic DNA extraction and junction PCR amplification

Genomic DNA was isolated from the cell clones using a MolPure® Cell/Tissue DNA Kit (Yeasen, Shanghai, China). Validation of either the 5’ or 3’ AAVS1 homology arms for donor integration was performed using junction PCR with specific primers (Table 1). 5’-junction PCR yields a 1757 bp amplicon in successfully integrated clones, while 3’-junction PCR generates a 1282 bp amplicon in these clones. Monoallelic or biallelic targeting was assessed by amplification of the WT sequence using the 5’-junction PCR forward primer and 3’-junction PCR reverse primer to produce a 1922 bp amplicon in the non-integration clone. A total of 100 ng genomic DNA was amplified with a 2 × Taq Master Mix kit (Vazyme, Wuhan, China) using the touchdown PCR protocol below: 1) 95°C for 3 min; 2) 95°C for 15 s, 60°C (−0.5 °C/cycle) for 15 s, 72°C for 2 min, for 10 cycles; 3) 95°C for 15 s, 55°C for 15 s, 72°C for 2 min, for 25 cycles; 4) 72°C for 5 min. The PCR reactions were electrophoresed on a 1.5% agarose gel to confirm the junction PCR results.

Table 1.

Primer sequences.

Primers	Primer sequences (5’-3’)
3’−junction PCR	Forward: CGAGTCTAGACGTTTAAACCCTGC Reverse: CCTGGGATACCCCGAAGAGT
5’−junction PCR	Forward: TCCTGAGTCCGGACCACTTT Reverse: CACCGCATGTTAGAAGACTTCC
Bacterial colony PCR	Forward: ATTGTGTAAAACGACGGCCAGTG Reverse: TGCTATGGACAGGAAACAGCTATGAC
Methylation CMV	Forward: GGAGTTTGTTTTGGTATTAAAATTAA Reverse: TAATCCATAATAACATCTTCTATAAAAATC
Methylation EF1α	Forward: GGTATTGTTAGGTGAAAGGATTTG Reverse: CAATTCAAAAAACACCACAAAC
Methylation Tre3G	Forward: AGTTTTGTTTATATAGGTTTTTTAT Reverse: TAAAACAAAAATATTATAAAATTACTCCAAA
Puromycin resistance gene (PuroR) for qPCR	Forward: TGCAAGAACTCTTCCTCACG Reverse: CCGGGAACCGCTCAACTC
ChR2 for qPCR	Forward: CATCGGGACTATCGTGTGGG Reverse: GCGCCATAGCACAATCCAAG
GAPDH for qPCR	Forward: GTCTCCTCTGACTTCAACAGCG Reverse: ACCACCCTGTTGCTGTAGCCAA

Western blotting

To assess the protein expression levels of the transgenes, Western blotting analysis was conducted. For doxycycline-induced expression cell clones, cells were collected 24 hours after doxycycline treatment. Cells were lysed in ice-cold radioimmunoprecipitation assay (RIPA) lysis buffer with a proteinase inhibitor cocktail (Vicmed, Cat No. VPI012, Xuzhou, Jiangsu, China). Cell lysates were centrifuged at 12,000 rpm for 15 min at 4°C to pellet insoluble cellular debris. The supernatant was collected and subjected to protein concentration quantification using a BCA protein assay kit (Beyotime, Cat No. P0010, Beijing, China). The quantified cell lysates were mixed with loading buffer and boiled at 95°C for 10 min to denature proteins. The samples were electrophoresed in 10% SDS-PAGE gel, then electrotransferred onto a nitrocellulose (NC) membrane (0.22 μm pore size, Amersham Biosciences GE). The NC membrane was blocked with 5% skim milk in Tris-buffered saline with 0.1% Tween 20 (TBST) for 1 h at room temperature (RT). The membrane was then incubated overnight at 4°C with a mouse anti-HA antibody (1:2000, Abclonal, Cat No. AE008, Wuhan, Hubei, China). After rinsing with TBST, the blotting membrane was incubated with a horseradish peroxidase (HRP) conjugated goat anti-mouse IgG (1:10,000, Proteintech, Wuhan, Hubei, China) for 2 h (RT). The membranes were then washed with TBST and incubated with an enhanced chemiluminescence (ECL) substrate (NCM Biotech, Suzhou, Jiangsu, China). Chemiluminescent signals were visualized using a FluorChem FC3 Imaging System (ProteinSimple, San Jose, CA, USA).

Fluorescence immunostaining

Cells seeded on coverslips were fixed with 4% paraformaldehyde for 10 min, followed by three consecutive washes with phosphate-buffered saline (PBS). For permeabilization and blocking, cells were treated with a solution containing 0.3% Triton X-100 and 10% goat serum for 1 hour (RT). Subsequently, cells were incubated overnight at 4°C with the corresponding primary antibodies, and the specific antibodies used are listed as follows: rabbit anti-SOX2 (1:500, Abclonal, Cat No. A0561, Wuhan, Hubei, China), rabbit anti-PAX6 (1:500, Proteintech, Cat No. 12,323–1-AP, Wuhan, Hubei, China), and mouse anti-NESTIN (1:500, Proteintech, Cat No. 66,259–1-Ig, Wuhan, Hubei, China). Following PBS washes, the cells were incubated with Alexa Fluor™ 488-conjugated goat anti-rabbit IgG (Invitrogen, Cat No. A-11008, Waltham, MA, USA) or Alexa Fluor™ 594-conjugated goat anti-mouse IgG (Invitrogen, Cat No. A-11005, Waltham, MA, USA) for 2 h (RT). After rinsing with PBS, cells were counterstained with 4,’6-diamidino-2-phenylindole (DAPI) and mounted on glass slides. Cells were imaged using a Zeiss confocal microscope (LSM710, Carl Zeiss, Oberkochen, Germany) under a 40× oil objective lens.

Bisulfite sequencing

To investigate the methylation of exogenous promoters in iPSCs, genomic DNA was extracted from selected iPSC clones with confirmed exogenous gene integration using a MolPure® Cell/Tissue DNA Kit (Yeasen, Shanghai, China). Subsequently, bisulfite conversion was performed using the Hieff® Mag DNA Methylation Bisulfite Kit (Yeasen, Shanghai, China) according to the manufacturer’s instructions. For the bisulfite conversion, 20 μL genomic DNA was mixed with 55 μL conversion fluid and incubated at 98°C for 10 min, 60°C for 2 h, and finally 4°C no more than 20 h. After adsorption and elution of bisulfite-transformed DNA using magnetic beads, the promoter sequences for CMV, EF1α, and mTre3G were amplified by methylation PCR using the EpiArt HS Taq Master Mix (Vazyme, Wuhan, China). Methylation-specific polymerase chain reaction (MSP) primers (Table 1) for CMV, EF1α, and Tre3G promoters were designed utilizing the MethPrimer (https://methprimer.com/cgi-bin/methprimer/methprimer.cgi) [19]. The PCR products were isolated from a 2% agarose gel and cloned into the TA cloning vector using the Hieff Clone® Zero TOPO-TA Simple Cloning Kit (Yeasen, Shanghai, China). After bacterial colony PCR, ten positive colonies were selected from each plate for plasmid isolation. The plasmids were Sanger sequenced using the M13 primer 5’-TGTAAAACGACGGCCAGT-3.’ The chromatograms were inspected manually for errors. The percentage of methylated CpGs was calculated using the following formula: (number of CpG sites where cytosines (Cs) were not converted to thymines (Ts))/(total number of analyzed CpG sites) × 100%.

Real-time quantitative PCR

To validate the methylation-mediated repression of gene expression in iPSCs, selected iPSC clones were seeded into 12-well culture plates. Forty-eight hours later, cells were treated with decitabine (5-Aza-2’-deoxycytidine, a DNA methyltransferase inhibitor, Cat No. HY-A0004, MedChemExpress, Monmouth Junction, NJ, USA) at final concentrations of 2.5, 5, and 10 µM, respectively. For doxycycline inducible overexpression in iPSC clones, cells were first pretreated with decitabine (1 µg/mL) for 8 hours and then exposed to varying concentrations of dexycytidine for an additional 24 hours. Then, total RNA was isolated from iPSCs using NcmSpin Cell/Tissue Total RNA Kit (NCM Biotech, Suzhou, China) according to the manufacturer’s manual. The isolated RNA was subsequently quantified using a NanoDrop ND-2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). A total of 500 ng of RNA was used as the template for the synthesis of complementary DNA (cDNA) using the HiScript III All-in-one RT SuperMix Perfect for qPCR kit (Vazyme, Nanjing, Jiangsu, China). The expression levels of target genes were subsequently evaluated via real-time quantitative PCR (qPCR) amplification using the ChamQ Universal SYBR qPCR Master Mix kit (Vazyme, Nanjing, Jiangsu, China). The sequences of the primers for qPCR are provided in Table 1.

Flow cytometry

To evaluate the expression of CoGFP in iPSCs that have undergone gene editing via the PiggyBac transposon system, the selected positive PiggyBac-ChR2-hM4Di-iPSCs-5 clone (passage 7) was seeded in a 12-well cell culture plate with puromycin (0.25 µg/mL). This experimental group was designated as iPSCs (+P1). After clone formation, cells were harvested, and the percentage of CoGFP-positive cells was assessed using a BD FACSCanto™ II flow cytometer (BD biosciences, NJ, USA). Then, cells were subcultured for an additional two passages designated as iPSCs (+P2) and iPSCs (+P3), respectively. This experiment was conducted in two parallel groups. One group was cultured without puromycin supplementation, and the other group was treated with a high concentration of puromycin (1 µg/mL). Following clone formation in these two groups, the percentage of CoGFP-positive cells was re-evaluated using a BD FACSCanto™ II flow cytometer.

Statistical analysis

The data were presented as the mean ± standard error of the mean (SEM). The equality of variances was examined via the Brown – Forsythe test. For multiple group comparisons, one-way analysis of variance (ANOVA) was conducted to assess the presence of overall statistical differences among group means. For subsequent pairwise comparisons (to identify specific group differences), an unpaired t-test with Welch’s correction was applied. A two-tailed statistical significance test was consistently applied across all analyses in this study, with a predefined significance threshold set at p < 0.05 to denote statistically significant differences.

Results

Successful construction of optochemical genetic receptor ChR2 and hM4di gene-modified iPSCs via CRISPR-Cas9 system

To conditionally induce the expression of ChR2 and hM4Di protein receptors in cells, we initially selected the CRISPR/Cas9 gene editing system. We constructed a donor plasmid AAVS1-3 G-puro-tetOn-ChR2-hM4Di, which expresses ChR2 and hM4Di driven by a doxycycline (Dox)-inducible TRE3G promoter. The expression cassette was spaced by homology arms for insertion into the AAVS1 site of the genome (Figure 1A). To assess the efficacy of the doxycycline (Dox)-induced expression system, a selected stable HEK293T clone was treated with two distinct concentrations of Dox (1 µg/mL and 2 µg/mL). Following a 24-hour incubation, mCherry fluorescent protein expression (a reporter for the inducible system) was visualized and imaged under a microscope. Both concentrations of Dox can effectively induce mCherry expression (Figure 1B). The protein expression of the transgene was validated by Western blotting, wherein an anti-HA antibody was employed to detect the HA-tagged target protein. Our results showed that the expression of target proteins was effectively induced by 1 µg/mL and 2 µg/mL Dox (Figure 1C), indicating that the donor plasmid was successfully constructed.

Figure 1.

Construction and validation of the donor plasmid AAVS1-3 G-puro-Tet-on-ChR2-hM4di in HEK293T and iPSCs. (a) Schematic diagram of the AAVS1 safe harbor locus and the insertion strategy for the ChR2 and hM4di genes. The Cas9 nuclease targets intron 1 of PPPR12C (AAVS1 locus) to induce DNA double-strand breaks, which are then repaired via homology-directed repair using the donor template. (b) Representative images showing mCherry (red fluorescence) expression in the selected HEK293T clone with the transgenes integration after doxycycline (Dox) treatment. Scale bar: 50 µm. (c) Immunoblotting demonstrating the target protein expression in the HEK293T cells transfected with the plasmids express after Dox induction. (d) Characterization of cultured iPSCs. iPSCs demonstrate clonal growth and express key stem cell markers, including SOX2, OCT4 and NANOG. Scale bars: 200 µm and 50 µm. (e) Junction PCR results showing the establishment of monoclonal iPSCs with successful integration of target genes. The clones numbered 103, 104, 106, 108, 111, 112, 116, and 117 were identified as positive clones. Among them, clone 104 was homozygous.

To generate an iPSC clone expressing the optochemical genetic receptors, ChR2 and hM4Di, we cultured iPSCs. Cultured iPSCs grew clonally and expressed the stem cell markers SOX2, OCT4, and NANOG (Figure 1D). Subsequently, the donor plasmid and AAVS1 gRNA all-in-one CRISPR/Cas9 plasmid were co-transfected into iPSCs. Puromycin was then added to screen for positive cells. Single-cell clones were isolated, and the genotypes of the cells were determined by junction PCR. The results showed that clones 103, 104, 106, 108, 111, 112, 116, and 117 were positive. Clone 104 was homozygous, whereas the other lines were heterozygous (Figure 1E). The results demonstrate the successful insertion of the optochemical receptor gene into the AAVS1 locus of iPSCs.

Expression of the target proteins was absent in optochemical genetic receptor ChR2 and hM4di gene-modified iPSCs

To verify the protein expression of the positive iPSC clones, we selected three cell clones for testing: iPSCs-104, iPSCs-106, and iPSCs-112. The results demonstrated that mCherry fluorescent protein expression was absent after induction with Dox (Figure 2A). This finding suggests that the inserted target genes failed to produce the proteins. To further confirm this, we examined the expression of the HA tag by immunoblotting. The results showed that the HA tag was absent in the three selected iPSC lines, whereas HA was detected in HEK-293T positive control cells (Figure 2B). These results indicate that the Tet-On-regulated ChR2 and hM4Di genes inserted into the AAVS1 locus failed to be expressed in iPSCs.

Figure 2.

Gene-edited iPSCs exhibits the absence of target protein expression. (a) Absence of mCherry (red fluorescence) expression in iPSCs after doxycycline induction. Scale bar: 100 µm. (b) Immunoblotting assay confirms no target protein expression in AAVS1-iPSCs-104, AAVS1-iPSCs-106, and AAVS1-iPSCs-112 cell lines after doxycycline induction.

Hypermethylation of the TRE3G bidirectional promoter integrated into the AAVS1 locus of the iPSC genome

Methylation of promoter sequences is an important factor affecting gene expression [20]. To explore the reasons for the failure of Tet-on-regulated ChR2 and hM4Di genes inserted into the AAVS1 locus in iPSCs, we designed methylation primers for the TRE3G bidirectional promoter (TRE3G BI) sequences (Figure 3A). We amplified the targeted promoter sequences using bisulfite methylation PCR (Figure 3B) and ligated the fragments into the TA clone plasmid (Figure 3C). After transformation, ten positive colonies were selected for sequencing (Figure 3D). The results showed that the TRE3G BI promoter was nearly unmethylated (approximately 5.9%) in HEK293T cells (Figure 3E). In contrast, the methylation levels of the TRE3G BI promoter in the selected iPSCs-104, iPSCs-106, and iPSCs-112 cells were 95.3%, 98.2%, and 98.2%, respectively (Figure 3E). Notably, treatment with decitabine (5-aza-2’-deoxycytidine), a DNA methyltransferase inhibitor, significantly enhanced ChR2 expression driven by the TRE3G BI promoter, whereas PuroR expression controlled by the endogenous AAVS1 promoter remained unchanged (Figure 3F). These results indicate that the TRE3G BI promoter of ChR2 and hM4Di genes inserted into the AAVS1 locus were highly methylated in iPSCs, which could potentially account for the failure to detect the expression of proteins.

Figure 3.

Extensive methylation of the TRE3G BI promoter was observed in the gene-edited iPSCs. (a) schematic of methylation-specific primer design for the TRE3G BI promoter using the MethPrimer website. (b) agarose gel electrophoresis of methylation PCR products. Target bands were detected in the AAVS1-HEK293T control and iPSCs-104, iPSCs-106, iPSCs-112 clonal cell lines. (c) schematic representation of methylated PCR products cloned into ta cloned plasmids. (d) agarose gel electrophoresis of colony PCR products from bacterial transformants after TA cloning. Arrows indicate amplicons of the expected size, confirming successful insertion of the target fragment. (e) Methylation profiles showing the methylation levels of CpG islands within TRE3G BI promoter. Unmethylated sites were denoted by pink dots, whereas methylated sites were indicated by blue dots. The findings demonstrated a high level of methylation within the TRE3G BI promoter in iPSCs. (f) quantitative assessment of PuroR and ChR2 gene expression after DNA methyltransferase inhibitor decitabine treatment. One-way ANOVA test followed by unpaired t-test with Welch’s correction was applied, *p < 0.05, **p < 0.01.

PiggyBac transposon-based optochemical genetic receptor ChR2 and hM4di gene-modified iPSC clones fail to express the target proteins

Since the promoters of the genes inserted in the AAVS1 locus of iPSCs were highly methylated and the target gene could not be expressed normally, we next tried to use the PiggyBac transposon system to randomly insert the gene fragment of ChR2 and hM4Di into genomic TTAA sites to explore whether the inserted gene could be expressed in iPSCs. To this end, we constructed a PiggyBac-ChR2-hM4Di plasmid (Figure 4A). To verify the effectiveness of the system, PiggyBac-ChR2-hM4Di and PiggyBac-transposase plasmids were co-transfected into HEK293T cells. After puromycin screening, CoGFP-expressing cells (Figure 4B) were collected, and the expression of HA-tagged target proteins was detected by Western blotting. The results showed that the target protein was expressed in HEK293T cells (Figure 4C), indicating the successful construction of PiggyBac transposon-based ChR2 and hM4Di expression systems.

Figure 4.

The ChR2 and hM4di genes are successfully integrated into HEK293T cells and iPSCs using the PiggyBac transposon system. (a) schematic representation of the stable insertion of the ChR2 and hM4di genes into the genome using the PiggyBac transposon system. (b) Bright-field and fluorescence microscopy images of HEK293T cells showing CoGFP expression (green fluorescence) upon successful transposon integration. Scale bar: 100 µm. (c) immunoblotting results showing the target protein expression in the transfected HEK293T cells. (d) CoGFP expression in iPSCs after gene insertion. Scale bars: 50 µm. (e) immunoblotting assay showing no target protein expression in the PiggyBac-iPSCs clone 1, PiggyBac-iPSCs clone 3, PiggyBac-iPSCs clone 4, and PiggyBac-iPSCs clone 5. HEK-293T-AAVS1-ChR2-hM4di as a positive control. (f) a representative image illustrating the partial loss of CoGFP expression following the passaging of iPscs. Scale bars: 100 µm. (g) comparative quantification of CoGFP-positive iPSCs in puromycin-treated and untreated groups under consecutive passaging conditions. One-way ANOVA test followed by unpaired t-test with Welch’s correction was applied, *p < 0.05, **p < 0.01, ****p < 0.0001.

To determine the PiggyBac transposon-based protein expression of ChR2 and hM4Di in iPSCs, we co-transfected PiggyBac-ChR2-hM4Di and PiggyBac-transposase plasmids into iPSCs. Four positive iPSC clones were selected after puromycin screening. The results showed that CoGFP expression was visible in the positive iPSCs (Figure 4D), suggesting that the target genes were inserted into the iPSC genome. Subsequently, we tested for the expression of the HA-tagged proteins. The results showed that the HA tag was not detected in any of the four selected iPSC clones (Figure 4E). In the process of iPSCs passaging, we found that CoGFP expression was partially silenced (Figure 4F). Flow cytometry analysis demonstrated a gradual reduction in the proportion of CoGFP-positive cells (Figure 4G). Notably, treatment with a higher concentration of puromycin yielded a significant increase in the percentage of CoGFP-positive cells (Figure 4G). However, the positive rate remained below 95% in all experimental groups (Figure 4G), suggesting that there was gradual inactivation of the expression of the inserted gene during iPSCs passaging. The above results indicate that the ChR2 and hM4Di genes inserted into the TTAA sites could not be expressed normally in iPSCs.

Exogenous gene expression in iPSCs is regulated by both promoter methylation and methylation-independent regulatory mechanisms

To explore the methylation levels of exogenous promoters in the genetically modified iPSC clones, we designed methylation primers for the CMV and EF1α promoters (Figure 5A), and the promoters were amplified by bisulfite methylation PCR (Figure 5B). The transformed promoter was cloned into the TA vector for sequencing. The results showed that in HEK293T cells, the CMV promoter exhibited an extremely low methylation level (approximately 0.9%, Figure 5C), whereas the methylation level of the EF1α promoter was approximately 71.7% (Figure 5C). Despite the higher methylation level of the EF1α promoter in HEK293T cells, the downstream CoGFP gene was successfully expressed. Notably, the CoGFP gene was driven by the EF1α core promoter and truncated 5’ long terminal repeat (5’LTR) from human T-cell leukemia virus type 1 (HTLV-1). CoGFP expression could be driven by the 5’-LTR of HTLV-1 conditions of EF1α promoter hypermethylation [21].

Figure 5.

Variable levels of methylation are observed in integrated exogenous CMV and EF1α promoters in iPscs using PiggyBac transposon system. (a) schematic of methylation-specific primer design for the CMV promoter and EF1α promoter using the MethPrimer website. (b) agarose gel electrophoresis of methylation PCR products. Target bands were detected in PiggyBac-HEK293T-5 control as well as PiggyBac-iPSCs-1 and PiggyBac-iPSCs-5 cell lines. (c) methylation profiles showing the methylation levels of CpG islands within CMV promoter and EF1α promoter. Unmethylated sites were denoted by pink dots, whereas methylated sites were indicated by blue dots. The CMV and EF1α promoter regions in PiggyBac-HEK293T-5 and PiggyBac-iPSCs are methylated to varying levels. (d) quantitative assessment of PuroR and ChR2 gene expression after DNA decitabine treatment. One-way ANOVA test followed by unpaired t-test with Welch’s correction was applied, *p < 0.05, **p < 0.01.

In the PiggyBac-iPSCs-1 cells, the methylation level of the CMV promoter was 0%, whereas that of the EF1α promoter was 41.9% (Figure 5C). In the PiggyBac-iPSCs-5 clone, the methylation levels of the CMV and EF1α promoters were 92.6% and 95.2%, respectively (Figure 5C). These results revealed that the methylation level of exogenous promoters in iPSC is integration site-dependent. To further investigate the role of promoter methylation in transgene silencing, the PiggyBac-iPSCs-5 clone harbouring a hypermethylated promoter was treated with varying concentrations of decitabine. The result demonstrated that the expression of both PuroR and ChR2 was upregulated, especially at a concentration of 10 µM (Figure 5D), indicating that DNA methylation contributes to transcriptional repression of the integrated transgenes. Considering that the target protein was undetectable in both PiggyBac-iPSCs-1 (with a hypomethylated CMV promoter) and PiggyBac-iPSCs-5 (with a hypermethylated CMV promoter) clones, these findings indicated that transgene expression in iPSCs is regulated not only by promoter methylation but also by additional regulatory factors, such as intrinsic promoter strength [22]. The above findings further confirm that exogenous gene expression in iPSCs is not only regulated by the methylation level of the promoter but also by methylation-independent regulatory mechanisms within iPSCs.

Differentiation of iPSCs to neural stem cells fails to reverse methylation levels of exogenous promoters

It has been shown that epigenetically induced gene silencing can be reversed [23]. To investigate whether the degree of promoter methylation changes after the differentiation of iPSCs into neural stem cells (NSCs), two iPSC lines, AAVS1-iPSCs-104 and PiggyBac-iPSCs-5, were induced to differentiate into neural stem cells (Figure 6A). The differentiated cells expressed the neural stem cell markers NESTIN and PAX6 (Figure 6B). The methylation levels of the exogenous promoters in the differentiated cells were analyzed (Figure 6C). The results showed that the methylation level of the TRE3G BI promoter in AAVS1-iPSCs-104-neural stem cells was 97.6% (Figure 6D) while the methylation levels of the EF1α promoter and CMV promoter in PiggyBac-iPSCs-5-neural stem cells were 94.4% (Figure 6E) and 91.7% (Figure 6F), respectively. These results were consistent with the findings in undifferentiated iPSCs, indicating that iPSC differentiation cannot reverse the methylation of the exogenous promoters. We further detected the expression of the HA-tagged protein in iPSC-derived NSCs. The results demonstrated that the expression of the HA tag was absent in neural stem cells (Figure 6G). The above results reveal that iPSC differentiation cannot reverse the promoter methylation of exogenous promoters.

Figure 6.

Neural stem cell differentiation of iPSCs does not reverse methylation levels of integrated exogenous promoters. (a) iPSCs differentiate into neural stem cells with a ‘neural rosette’ morphology. Scale bar: 100 µm and 50 µm. (b) immunostaining showing that the expression of the neural stem cell markers NESTIN and PAX6 in the iPSC-derived neural stem cells. Scale bar: 50 µm. (c) agarose gel electrophoresis of methylation PCR products. Target amplification bands were observed in both AAVS1-iPSCs-104-neural stem cells and PiggyBac-iPSCs-5-neural stem cells. (d) methylation profiles of CpG islands within TRE3G bi promoter in AAVS1-iPSCs-104-derived NSCs. (e and f) methylation profiles of CpG islands within EF1α (e) and CMV (f) promoters in PiggyBac-iPSCs-5-derived NSCs. (g) immunoblotting analysis showing no target protein expression in iPSC-derived NSCs.

Discussion

This study demonstrated that both CRISPR/Cas9 and PiggyBac systems successfully integrated optogenetic (ChR2) and chemogenetic (hM4Di) receptor genes into the genomes of human iPSCs, as validated by junction PCR. However, despite successful genomic integration, target protein expression was completely absent in iPSCs and their neural stem cell (NSC) derivatives, as evidenced by fluorescence microscopy and Western blot analyses. In stark contrast, robust protein expression was observed in HEK293T cells following both transfection methods, suggesting that the pluripotent state of iPSCs inherently imposes barriers to transgene expression. The primary mechanism underlying this expression failure was identified as promoter hypermethylation. Bisulfite sequencing revealed that the TRE3G BI promoter inserted at the AAVS1 locus was highly methylated (95.3–98.2%) in iPSCs, compared to minimal methylation (5.9%) in HEK293T cells. For the PiggyBac system, methylation of the CMV and EF1α promoters was integration site-dependent, with some iPSC clones showing low (0% for CMV promoter and 41.9% for EF1α promoter) or high (92.6% for CMV promoter and 95.2% for EF1α promoter) methylation levels. Notably, treatment with a DNA methyltransferase inhibitor upregulated the expression of transgenes under the control of exogenous promoters. This observation directly implicates promoter methylation as a potential regulatory mechanism contributing to transgene silencing in iPSCs. However, even clones with hypomethylated CMV promoters failed to express target proteins, indicating that methylation is not the sole determinant of gene silencing in iPSCs [24,25]. Given that the PiggyBac transposon integrates randomly into genomic TTAA sites, position effects could contribute to the observed differential methylation levels of CMV promoter between PiggyBac-iPSCs-1 and PiggyBac-iPSCs-5 clones. Additionally, differentiation of iPSCs into NSCs did not reverse promoter methylation or restore protein expression, highlighting the stability of epigenetic silencing across cellular states.

CRISPR/Cas9 gene editing technology can effectively perform gene editing operations such as insertion, deletion, and mutation in mammalian cell genomes [13]. The AAVS1 locus, as a well-known safe harbor of the human genome with good transcriptional activity, is a commonly used insertion site for inserting exogenous genes in human cells [2]. However, our experimental findings, along with those of other research groups, demonstrated that the exogenous promoter inserted into AAVS1 can be methylated, which in turn led to the failure of expression of the target proteins [26]. It has also been reported that exogenous promoters integrated into the AAVS1 locus of the iPSC genome can exhibit varying degrees of methylation, characterized by heterogeneous promoter methylation levels [16,17]. Additionally, the differentiation of iPSCs can dynamically alter the methylation status of this locus, which may ultimately result in gene silencing [16,17]. These findings challenge the assumption that the AAVS1 locus is universally permissive for transgene expression, especially in iPSCs.

Previous studies have suggested that different promoters have different activities in initiating gene expression in iPSCs, whereas CMV promoter has weaker expression activity and the EF1α promoter has stronger activity [27,28]. We observed attenuated or even loss of fluorescent protein expression in some cells in some iPSC lines that were still puromycin-resistant, suggesting that the transcriptional activity of the EF1α promoter may randomly diminish with the passaging of iPSCs. In addition, we noticed that green fluorescent protein expression was still observed in iPSCs with high methylation of the EF1α promoter. Notably, the CoGFP gene is driven by a composite promoter. This composite promoter consists of the EF1α core promoter and a truncated 5’ long terminal repeat (5’LTR) derived from human T-cell leukemia virus type 1 (HTLV-1) [21]. The 5’LTR of HTLV-1 May exhibit promoter activity to initiate CoGFP expression when the EF1α promoter undergoes methylation [29].

The genomic integration site of a transgene is one of the primary determinants of its epigenetic modification [30]. In the present study, we found that the level of promoter methylation varied substantially depending on the genomic integration site of PiggyBac-mediated transgene insertions, indicating an integration site-dependent promoter methylation. Of note, in the PiggyBac-ChR2-hM4Di-iPSCs-1 clone, transgene silencing was sustained even in the absence of CMV promoter methylation, implicating alternative epigenetic regulatory pathways. In fact, transgene silencing is regulated by multiple epigenetic mechanisms, extending beyond promoter DNA methylation to include histone modifications, chromatin remodeling, and non-coding RNA-mediated pathways [30–32]. Histone modifications contribute critically to epigenetic gene silencing through constitutive heterochromatin formation [33]. More importantly, DNA methylation can recruit histone deacetylase enzymes (HDACs), thereby initiating the formation of heterochromatin and limiting DNA accessibility, resulting in transcriptional repression of associated genes [30,34]. Non-coding RNAs can modulate gene expression through diverse mechanisms [35]. In particular, non-coding RNAs orchestrate both DNA methylation and histone modifications at specific genomic loci [35,36]. The potential involvement of the abovementioned methylation-independent epigenetic modifications, along with their crosstalk, in the regulation of gene silencing processes in iPSCs needs to be further evaluated.

In summary, in this study, the optochemical genetic receptors were successfully introduced into the genome of iPSCs, but the target genes failed to express proteins due to various reasons, such as epigenetic modifications. This study suggests that although AAVS1 is regarded as a commonly used target cloning site, the introduction of exogenous promoters at this site in iPSCs carries the risk of target gene silencing. Furthermore, epigenetic modifications in iPSCs may induce methylation of multiple promoters, ultimately resulting in the failure of transgenic modification in iPSCs. Therefore, while considering the gene insertion site in the experiments on transgenic modification of iPSCs, we should also pay attention to the activities of different promoters in iPSCs and throughout their lineage-specific differentiation processes.

This study has several limitations. First, our study exclusively examined three promoter types (TRE3G BI, CMV, and EF1α) and a single induced pluripotent stem cell (iPSC) line. Second, the study did not investigate other potential epigenetic and non-epigenetic mechanisms in gene silencing, such as histone modifications, mRNA stability and miRNA regulation. Third, the random integration pattern of the PiggyBac transposon system may have introduced clonal variability in methylation, complicating mechanistic interpretation. Fourth, genome-wide methylation profiling of decitabine-treated iPSC clones requires further investigation to validate the correlative link between DNA methylation dynamics and the transcriptional silencing of target genes. Future studies should test a wider range of synthetic promoters and iPSC lines to robustly validate epigenetic silencing.

Conclusion

In summary, while CRISPR/Cas9 and PiggyBac systems effectively integrate optogenetic and chemogenetic receptors into iPSC genomes, promoter hypermethylation and epigenetic incompatibility with the pluripotent state ultimately silence transgene expression. These findings underscore the need for a deeper understanding of iPSC epigenetics in gene editing applications, and highlight the importance of promoter selection and epigenetic modulation strategies for future studies aiming to engineer functionally integrated iPSC-derived neurons.

Availability of data and materials

The authors confirm that the data supporting the findings of this study are available within the article. Raw data generated is available as supplementary material or from Zenodo: https://doi.org/10.5281/zenodo.16263248.

Funding Statement

This work was supported by the National Natural Science Foundation of China (NSFC; 32100769 and 82371401 to M.L. and 82401625 to X.Q.), Jiangsu Provincial Department of Education (24KJA310011), the Natural Science Foundation of Jiangsu Province (BK20220659), Xuzhou Medical University (D2020054 and JBGS202202), and the faculty development grant of basic medical sciences of Xuzhou Medical University (JC20250005).

Disclosure statement

No potential conflict of interest was reported by the author(s).