Skip to main content
Future Cardiology logoLink to Future Cardiology
. 2025 Dec 2;21(12):1063–1070. doi: 10.1080/14796678.2025.2597095

Plasma expression of lncRNA Wisper in patients with heart failure and patients with myocardial infarction

Jordanka G Doneva a,b,✉, Veselin D Valkov a,c, Ivan S Donev d, Atanas A Atanasov c, Zafer A Sabit e, Ivo N Sirakov f, Yavor K Kashlov a,b, Lylia I Stoyanova a,b, Radka T Hadjiolova e
PMCID: PMC12758281  PMID: 41332245

ABSTRACT

Background

Heart failure (HF) and ST-elevation myocardial infarction (STEMI) are the major causes of morbidity and mortality worldwide. Recent evidence indicates that long noncoding RNAs (lncRNAs) participate in cardiac fibrosis, which develops to varying degrees in these conditions.

Patients and methods

This retrospective study analyzed the plasma expression levels of lncRNA Wisper using RT-qPCR in 28 patients with HF (NYHA class III – IV, reduced ejection fraction), 37 patients with STEMI, and 15 healthy controls. Diagnostic accuracy was assessed using receiver operating characteristic (ROC) curve analysis, and correlations with clinical parameters were evaluated.

Results and conclusions

Patients with HF and STEMI showed significantly higher plasma Wisper expression than that of controls (p = 0.021 and p = 0.03, respectively), with no significant difference between the HF and STEMI groups (p = 1.0). In patients with HF, Wisper expression negatively correlated with age (rho = –0.452, p = 0.016). ROC analysis demonstrated good discriminatory power of Wisper in distinguishing HF (AUC = 0.783, 95% CI: 0.648–0.919, p = 0.002) and STEMI (AUC = 0.780, 95% CI: 0.658–0.903, p = 0.002) from controls. The elevated plasma expression of Wisper in patients with HF and STEMI suggests its potential role as a circulating biomarker of cardiac fibrosis.

KEYWORDS: Long-non coding RNA (lncRnas), marker, cardiovascular, myocardial injury, heart failure

Plain Language Summary

Heart failure and heart attack are serious heart conditions affecting millions of people worldwide. When the heart is damaged, scar tissue often develops, a process known as cardiac fibrosis, which makes it difficult for the heart to effectively pump blood. Scientists are trying to find new ways to detect this process early, using molecules that can be measured in the blood. In this study, we examined a molecule called lncRNA Wisper, which may be linked to the formation of heart scarring. We measured the expression of this lncRNA in the blood of patients with heart failure, patients who recently had a heart attack, and healthy volunteers. We found that both groups of patients had higher levels of lncRNA Wisper compared to that of healthy people. This means that measuring Wisper in the blood might help doctors identify heart problems related to tissue scarring in the future. Although these results are promising, more studies with larger and more uniform groups of patients are needed to confirm these findings and explore how Wisper might be useful in clinical practice.

1. Introduction

The World Health Organization (WHO) rates cardiovascular diseases (CVDs) as the leading cause of mortality and morbidity in Europe. According to statistical data, approximately 4,2 million people in Europe died from CVDs in 2019. This is considered to account for more than two out of five (42,5%) of all deaths. (WHO 17 July 2024).

One of the most common types of CVDs is coronary artery disease (CAD) [1] with the most severe manifestation being myocardial infarction (MI) [2]. According to the European Society of Cardiology (ESC), there are two main types of MI based on electrocardiographic changes: MI with ST-segment elevation (STEMI) and MI without ST-segment elevation acute coronary syndrome (NSTE-ACS) [3]. More than three million people present with STEMI annually, and four million have STEMI as a pathological diagnosis. MI is detected not only in developed countries but also in developing countries [4–7]. Although it is the main cause of human death [8], a decrease in the mortality rate due to MI has been reported. In contrast, the prevalence of heart failure (HF) remains high [9].

Long non-coding RNAs (lncRNAs) are transcripts that belong to a novel class and are more than 200 nt in length and do not have a protein-coding capacity [10]; however, they modulate the transcription of protein-coding genes [11]. Some lncRNAs participate in heart embryogenesis, whereas others are expressed in cardiomyocytes and endothelial muscle cells and control their growth and differentiation [11].

Many studies have reported the association between lncRNAs and various complex processes in CVDs [12–14]. Since they are present in extracellular body fluids, such as plasma, serum, and urine, lncRNAs may be the newest noninvasive biomarkers for the diagnosis and prognosis of CVDs [15–20].

An example of this is Wisp2 super-enhancer-associated long non-coding RNA (lncRNA Wisper), expressed in the post-MI infarct region in mice and patients with aortic stenosis, whose levels tend to correlate with the degree of cardiac fibrosis [21]. Heart tissue expresses the lncRNA Wisper to a greater extent than do other tissues, making it a potentially specific marker of cardiac fibrosis. Blood levels have been examined in patients with diabetes and retinopathy [22]; however, there are no studies examining the blood expression levels of lncRNA Wisper in patients with heart diseases. The exact role of lncRNA Wisper also remains unclear, especially in humans. Our aim was to investigate the expression level of a potentially specific marker of cardiac fibrosis in human blood, the lncRNA Wisper, in the context of MI and HF, acknowledging that the blood expression of this RNA may not fully reflect its tissue expression. Through this analysis, we sought to provide additional insights into an area that has remained insufficiently explored till date.

In the current study, we evaluated the plasma expression of lncRNA Wisper in patients with HF and STEMI and in healthy individuals.

2. Material and methods

2.1. Patient selection

All procedures were approved by the Scientific Research Ethics Committee of Prof. Dr. Paraskev Stoyanov Medical University of Varna. First, this was a retrospective study. The database used in this retrospective study was owned by the medical institution where the data were originally collected. Permission to access and use the database for research purposes was obtained from the data owner before initiation of the study. All data were anonymized before analysis, and the study was conducted in accordance with institutional and ethical guidelines. Blood plasma for lncRNA Wisper expression was analyzed from patients admitted to the University Hospital “St. Marina,” Varna. The study included 28 patients with New York Heart Association (NYHA) class III-IV heart HF, 37 with STEMI, and 15 healthy individuals as the control group. The selected groups were aligned according to their sex and age. Blood was collected from the patients in 5-mL containers and centrifuged for no more than 15 min. All blood samples were placed in heparin anticoagulant tubes and centrifuged at 2,500 g for 20 min to separate the plasma, which content was dispensed and stored at −80°C before RNA extraction.

The expression of Wisper was detected using real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR). The level of Troponin I (ng/ml) was measured using Immulite 2000 (Siemens, Germany).

2.2. Quantitative real-time PCR

Total RNA was isolated from plasma using the Quick-DNA/RNA Miniprep Kit (Zymo Research, USA) according to the manufacturer’s instructions. The miScript II RT Kit (QIANGEN, Germany) was used for reverse transcription of the isolated RNA. The reaction mixture had a total volume of 20 μL and contained 4 μL 5x miScript HiSpec Buffer, 2 μL 10x miScript Nucleics Mix, 2 μL miScript Reverse Transcriptase Mix, and the isolated RNA (up to 12 μL; 100ng/μl). After gentle mixing and brief centrifugation, the sample was incubated at 37°C for 60 min for cDNA synthesis, followed by a 5-min incubation at 95°C to inactivate the reverse transcriptase. The resulting cDNA was stored at −20°C for short term or at −80°C for long term storage. All procedures were performed under strict rules concerning the use of kits and reagents, and RT-qPCR was performed using a QuantiTect SYBR Green PCR Kit (QIANGEN, USA).

PCR amplification was performed using a Real-Time PCR system on a 7900 HT Fast Real-Time PCR system (Applied Biosystems, JAPAN) under the following conditions: initial denaturation and polymerase activation at 95°C for 15 min, followed by 45 cycles including denaturation at 94°C for 15 seconds, annealing at 55°C for 30 seconds and elongation at 72°C for 30 seconds. GAPDH was used as an internal control. Each specimen underwent PCR three times and relative quantification (RQ) of lncRNA Wisper was measured through the 2 −ΔΔC T method. The specific primer sequences are listed in supplementary table.

LncRNAWisper Forward primer Reverse primer
  TTCCTTTGGAGCATCTGGAC ACTGGCTTTCGGACTGGTG

The diagnosis of HF was based on the criteria recommended by the European Society of Cardiology [23]- clinical syndrome characterized by typical symptoms (e.g., breathlessness, ankle swelling, and fatigue) that may be accompanied by signs (e.g., elevated jugular venous pressure, pulmonary crackles, and peripheral edema) caused by a structural abnormality, resulting in reduced cardiac output and/or elevated intracardiac pressures at rest or during stress.

Four of the 28 patients (14.2%) had NYHA functional class IV, and the others had NYHA class III.

In most patients, HF symptoms were the result of ischemic heart disease, previous MI (19/28, 67.9%). In 5/28 patients (17.9%) HF was due to idiopathic dilated cardiomyopathy. Among the remaining 4/28 (14.3%) patients, the causes were heart valve disease or rhythm disorders. The mean ejection fraction of the group was 35.46% ± 5.0.

Patients with MI had the following characteristics: chest pain with significant (minimum 2-mm) ST segment elevation according to at least two contiguous electrocardiogram (ECG) leads, a significant increase in cardiac markers (troponin I > 0.2 ng/mL), and < 12 hours of symptom onset to primary percutaneous intervention (PCI), with no history of MI. All the patients with STEMI underwent PCI as soon as possible.

Group three consisted of 15 healthy individuals serving as controls.

The exclusion criteria for all groups included current infection, inflammatory or autoimmune disease, and advanced cancer.

2.3. Echocardiography

The left ventricular ejection fraction (LVEF) was evaluated using the biplane method of disks (Simpson’s rule) in accordance with the European Association of Cardiovascular Imaging [24]

2.4. Statistical analysis

All data were analyzed using the Statistical Package of Social Science (SPSS/version 23) software.

First, the Shapiro – Wilk test was performed to verify the normality of the distribution of variables. Categorical variables were summarized in frequencies and percentage and variables were expressed using mean (M) ± standard deviation. The chi-squared test was used to assess categorical variables. The Mann – Whitney U test was used to evaluate plasma Wisper expression, demographics (sex, age), and clinical characteristics of the patients. Continuous variables were evaluated for correlation using Spearman’s test. For the interpretation of correlation test findings, Rho values were interpreted as follows: < 0.19, extremely weak; 0.19–0.39, weak; 0.40–0.59, moderate; 0.60–0.79, strong; and > 0.80 very strong. The diagnostic accuracy of Wisper was tested using receiver operating characteristic (ROC) curves. The diagnostic accuracy of plasma lncRNA Wisper expression was examined by reaching the highest area under the curve (AUC) in the ROC analysis. An AUC of 0.5 indicates no discrimination in diagnosing patients with or without the disease, 0.7 to 0.8 is deemed acceptable, 0.8 to 0.9 is regarded as excellent, and over 0.9 is classified as outstanding. p-value < 0,05 was considered statistically significant.

3. Results

3.1. Patients baseline characteristics

The demographic characteristics of the patients with HF (n = 28), STEMI (n = 37), and healthy volunteers (n = 15) are presented in Table 1. Regarding age, there were no significant differences between patients with HF or STEMI and healthy control participants. The average age of the control group was 64.3 ± 11.3 years, for the HF group was 66.2 ± 11 years, and for the STEMI group was 64 ± 13.2 years. In all the three groups, the male population exceeded the female population. All patients in the cohort with HF and STEMI exhibited arterial hypertension. Age (p = 0.64), sex (p = 0.19), diabetes mellitus (p = 0.55), dyslipidaemia (p = 0.15), and renal failure (p = 0.47) were not significantly different between the patients with STEMI and that of those with HF (Table 1).

Table 1.

Baseline characteristics of patients with STEMI, patients with heart failure, and healthy control subjects.

Demographic characteristics Patients with heart failure Patients with STEMI Significance Control subjects
Age; yrs. 66.2 ± 11 64 ± 13.2 p = 0.64 64.3 ± 11.3
Male, % 67.9 54.1 p = 0.19 63.7
Hypertension, % 100 100   –
Diabetes % 39.3 37.8 p = 0.55 –
Dyslipidaemia % 38.0 78.4 p = 0.157 –
Renal failure % 17.9 21.6 p = 0.47 –

3.2. Plasma levels of lncRNA Wisper in the three groups

Wisper distribution across the three groups was not normal. In plasma, patients with HF (HF) exhibited a mean lncRNA Wisper level of M = 90.5 ± 431.1; in STEMI patients, the mean was M = 101.6 ± 529.92, while the control group had a mean of M = 25.2 ± 63.8.

Kruskal – Wallis one-way ANOVA indicated a disparity in the plasma expression of lncRNA Wisper across the three groups. Pairwise comparison revealed that the plasma Wisper expression level in the HF group was significantly higher than that in the control group (p = 0.021). Furthermore, we observed that the plasma expression level of Wisper in the STEMI group was significantly elevated compared with that in the control group (p = 0.03). There was no substantial difference in the plasma expression levels of Wisper between the HF and STEMI groups (p = 1.0) (Figure 1).

Figure 1.

Figure 1.

Bar graph, representing plasma expression of lncRNA Wisper in healthy controls, patients with class III-IV NYHA heart failure (HF), and patients with myocardial infarction with ST elevation (STEMI). Using Kruskal-Wallis one-way ANOVA analysis we detect significantly elevated plasma lncRNA Wisper expression levels in the HF group compared to the control group (p = 0.021). Plasma expression levels of lncRNA Wisper in the STEMI group were significantly elevated compared to the control group (p = 0.03).

3.3. Expression of lncRNA Wisper in patients with HF and healthy individuals

ROC analysis indicated that at the optimal cutoff value, Wisper effectively distinguished patients with HF from controls, yielding an AUC of 0.783 (95% CI: 0.648–0.919, p = 0.002), with a sensitivity of 80% and a specificity of 67% (Figure 2).

Figure 2.

Figure 2.

Receiver operating characteristic (ROC) analysis revealed that lncRNA Wisper discriminated heart failure HF patients and healthy controls at AUC = 0.783 (95% CI: CI: 0.648–0.919, p = 0.002) with 80% sensitivity and 67% specificity.

A moderate inverse association was observed between the expression level of lncRNA Wisper and the age of the patients with HF (p = 0.016), with a Spearman correlation coefficient of rho = −0.452. Plasma expression of Wisper was elevated in younger patients compared to that in older individuals (Figure 3).

Figure 3.

Figure 3.

Scatter/dot graph, representing the correlation between plasma expression of lncRNA Wisper and Age of the patients with heart failure with Spearman correlation coefficient (rho = −0,452) and (p = 0,016).

Using the Spearman test, we observed no significant association between the expression level of Wisper and the ejection fraction % (p = 0.68).

The Mann – Whitney U test revealed no significant difference in the plasma expression of Wisper according to sex (p = 0.46), presence or absence of diabetes mellitus (p = 0.47), renal failure (p = 0.51), and dyslipidaemia (p = 0.57).

3.4. Expression of lncRNA Wisper in patients with STEMI and healthy controls

The diagnostic significance of plasma lncRNA Wisper expression in patients with STEMI was assessed using ROC curve analysis. ROC analysis indicated that the best cutoff value of Wisper effectively distinguished STEMI patients from controls, with an AUC of 0.780 (95% CI: 0.658–0.903, p = 0.002), sensitivity of 80%, and specificity of 71% (Figure 4). Utilizing the Spearman test, we identified no significant connection between circulating lncRNA Wisper, levels of Troponin I, and ejection fraction (EF). The Mann – Whitney U test also revealed no significant difference in the expression level of lncRNA Wisper concerning sex (p = 0.46), the presence of diabetes mellitus (p = 0.47), the presence of renal failure (p = 0.51), and dyslipidaemia (p = 0.57).

Figure 4.

Figure 4.

Receiver operating characteristic (ROC) analysis revealed that at the optimal cutoff value of lncRNA Wisper discriminated patients with myocardial infarction with ST elevation and healthy controls an AUC = 0.780 (95% CI: 0.658–0.903, p = 0.002) with 80% sensitivity and 71% specificity.

4. Discussion

Although the exact origin and function of circulating lncRNAs remain unknown, they are variably expressed at stable levels in the blood of patients with various CVDs and in healthy individuals. These findings highlight their potential use as biomarkers [25]. In cases of myocardial injury, they are released into the circulation, similar to proteins [26]. The current study demonstrated that the plasma expression of Wisper differentiates patients with acute MI and HF from healthy individuals. Furthermore, younger patients with HF exhibit elevated plasma Wisper levels compared to that of older patients with HF. To the best of our knowledge, this is the first study to investigate the potential of the circulating lncRNA Wisper as a biomarker for MI and HF.

Although the expression of lncRNA Wisper has been evaluated in cardiac tissues [21,27] there is a lack of studies evaluating the expression of lncRNA Wisper in the blood samples of patients with heart diseases. This indirect approach to examine the expression of lncRNA Wisper provides new insights and additional information about the potential role of this marker, although it cannot determine its comparability with its expression in cardiac tissues.

Cardiac fibrosis is considered a major driver of the increasing burden of HF and a key factor in its progression [28]. Moreover, myocardial fibrosis positively correlates with the extent of pathological left ventricular remodeling and the clinical manifestations of HF [29]. The development of a specific marker for the early detection of myocardial fibrosis could facilitate early diagnosis, prognosis, and treatment of patients with HF.

Furthermore, although we did not include patients with implantable cardioverter-defibrillator (ICD) and/or cardiac resynchronization therapy defibrillator (CRT-d) in the group of patients with HF, we speculate that lncRNA Wisper has the potential to be a helpful biomarker for precise selection of patients with heart failure as candidates for ICD or CRT-d. The risk of ventricular arrhythmia independent of EF ( > 35%) was higher in patients with cardiac fibrosis when evaluated using MRT [30]. Thus, these patients may benefit from ICD implantation independent of their EF. However, cardiac fibrosis evaluated using MRT in patients with CRT-D and non-ischemic dilated cardiomyopathy (DCM) has an unfavorable LVEF response [31]. These data support the need for a specific marker for cardiac fibrosis, which could be the lncRNA Wisper.

A recent study discovered the expression of lncRNA Wisper in cardiac fibroblasts of mouse models of experimentally induced MI (MI) [21]. Wisper expression in cardiac tissue was associated with the intensification of cardiac remodeling following myocardial injury, with maximum expression noted 14 days after MI. Furthermore, the application of modified antisense oligonucleotides (ASOs), known as GapmeRs, that triggers nuclear ribonuclease H-mediated degradation of the transcript and diminishes Wisper levels in both the nucleus and cytoplasm 3 days prior to MI (MI), resulted in a reduced MI zone and a notable decrease in myocardial fibrosis, as observed by the authors [21]. The tissue specificity of Wisper expression in mouse tissues was assessed, indicating that the heart exhibited higher levels of Wisper than in the other tissues. This study also indicated the presence of the lncRNA Wisper in the heart tissue of patients with aortic stenosis, where it was linked to excessive rather than moderate fibrotic tissue formation. The expression of Wisper is correlated with the progression of cardiac fibrosis in both mouse models and humans [21].

The current study investigated the expression of lncRNA Wisper in patients with STEMI, utilizing blood samples collected within 12 h of symptom onset, prior to PCI. The elevated plasma expression in patients with STEMI compared to that in a healthy control group is likely linked to the activation of fibrotic processes following acute myocardial damage in patients with STEMI. Pathophysiologically, following acute MI, the myocardium undergoes remodeling and fibrosis. This process includes an inflammatory response (days 1 to 3 post-injury), proliferation and granulation tissue production (days 7 to 14), and scar maturation (days 21 to 28) [32]. We noted elevated plasma Wisper expression compared to that in the control group within 12 hours of the onset of MI, with no link to troponin I levels. The elevated expression of Wisper is likely attributable to the early genetic activation of fibrosis development or additional mechanisms, of which we are unaware.

We also observed significantly elevated plasma Wisper expression in patients with HF compared to that in the control group. The patients included in this study were individuals with HF and a low ejection fraction (EF < 40%), which presumably indicates more significant myocardial fibrosis. We propose that elevated expression levels of Wisper correlate with increased fibrosis development, as this lncRNA is recognized for its role in regulating fibroblast proliferation and growth [21]. According to this concept and the findings of this study, lncRNA Wisper may have prognostic relevance as a biomarker for fibrosis progression in HF. Despite the expectation that increased fibrosis correlates with lower EF, we did not observe a link between lncRNA Wisper expression levels and EF (p = 0.68). This was attributed to the study population in which all patients with HF exhibited a poor EF (EF < 40%). In the majority of instances, HF resulted from previous MI accompanied by established fibrosis, preexisting left ventricular impairment, and systolic dysfunction with reduced EF, without indications of acute MI upon hospitalization.

The results suggest increased expression in our study in early myocardial injury- patients with STEMI and in patients with a low EF with chronic HF, suggesting that Wisper may play a role in both myocardial injury and fibrosis formation.

According to our results, older patients, who were expected to have more pronounced myocardial fibrosis, expressed lower levels of Wisper compared to that of younger patients. This may be due to the existing fibrosis in the HF group, which had a low average EF of 35.46%. Another possible reason is the dominance of different fibrotic mechanisms at various stages of ventricular remodeling [33]. This result may reflect sampling variability due to the relatively small sample size, rather than a true biological difference.

5. Limitation of the study

The relatively small size of the control group (n = 15) was a limitation of the present study. A limited sample size inevitably reduced the statistical power to detect differences between the selected groups. To mitigate this limitation, control participants were carefully selected to match the study group, considering key demographic and clinical variables, thereby minimizing confounding effects. Extensive multicentre investigations are necessary to clarify the significance of lncRNA Wisper as a possible biomarker for the risk of MI and HF. Second, the mechanisms underlying the correlation between upregulated Wisper expression and the severity of HF require further investigation. A further limitation of the study is the unidentified origin of Wisper in the bloodstream, which is produced from necrotic cells in the failing heart or secreted by blood cells in response to cardiac damage.

Our results require validation using larger independent cohorts. We could not ascertain whether the observed connections indicated a causal relationship. Our data did not identify the tissue origin of circulating lncRNA Wisper. Furthermore, the biological functions of Wisper in heart physiology and cardiovascular diseases remain unknown.

6. Conclusion

The lncRNA Wisper was considerably expressed in patients with HF and STEMI compared to that in the control group. There was a significant association between the expression level of lncRNA Wisper and the age of patients with HF, suggesting the potential of this lncRNA as a marker for myocardial injury and myocardial fibrosis. However, the expression mechanisms and clinical applications of lncRNA Wisper require further investigation.

Supplementary Material

Supplemental Material

Acknowledgments

The authors express their sincere gratitude for the continuous support and guidance provided throughout this study. Appreciation was also extended to the members of the research team for their collaboration in data acquisition. Additionally, we would like to thank UMHAT St. Marina, Varna and the Medical University of Varna for their involvement, support, and participation in the study.

Funding Statement

This paper was not funded.

Article highlights

  • Plasma expression level of long-non coding RNA Wisper is elevated in heart injuries.

  • Older patients with heart failure with a reduced ejection fraction expressed lower levels of lncRNA Wisper than that of younger patients.

  • Long-non coding RNA Wisper may have prognostic relevance as a biomarker for fibrosis progression in heart failure and early fibrosis activation in myocardial infarction.

  • Long-non coding RNA Wisper may be a specific marker for fibrosis activation in the myocardium in cases of chronic or acute heart injury. However, further investigation is required to confirm this hypothesis.

Author contributions

Yordanka Doneva, Veselin Valkov, Yavor Kashlov, and Ivan Donev were responsible for the conceptualization and methodology of the study. Zafer Sabit, Ivo Sirakov, and Radka Hadjiolova contributed to the investigation, data curation, and sample processing. Formal analysis and interpretation of the results were carried out by Yordanka Doneva, Veselin Valkov, Atanas Atanasov and Ivan Donev. Yordanka Doneva took the lead in writing the original draft of the manuscript, while all authors contributed to the review and editing of the text especially Lylia Stoyanova. Doneva and Donev supervised the project and were involved in its administration. All the authors provided critical feedback, contributed to the research and analysis, and approved the final version of the manuscript.

Disclosure statement

The authors have no relevant affiliations or financial involvement with any organization or entity with a financial interest or financial conflict with the subject matter or materials discussed in this manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, and royalties.

Reviewer disclosures

Peer reviewers on this manuscript have no relevant financial or other relationships to disclose.

Ethical declaration

This study was conducted in accordance with the principles outlined in the Declaration of Helsinki for ethical medical research involving human subjects. Given the retrospective, observational nature of the study and the use of de-identified patient data, the requirement for formal Institutional Review Board (IRB) approval was waived by the University Hospital ‘’St.Marina,’’ Medical University of Varna. No direct patient intervention or private information was involved and the study complied with ethical standards while ensuring patient confidentiality and data protection. The official approval is held by the Medical University of Varna Administration and is available upon reasonable request.

Data availability statement

The authors certify that this manuscript reports original clinical trial data. These data are not available publicly.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/14796678.2025.2597095

References

Papers of special note have been highlighted as either of interest (•) or of considerable interest (••) to readers.

  • 1.Cheung AK, Sarnak MJ, Yan G, et al. Atherosclerotic cardiovascular disease risks in chronic hemodialysis patients. Kidney Int. 2000;58(1):353–362. doi: 10.1046/j.1523-1755.2000.00173.x [DOI] [PubMed] [Google Scholar]
  • 2.Yeh RW, Sidney S, Chandra M, et al. Population trends in the incidence and outcomes of acute myocardial infarction. N Engl J Med. 2010;362(23):2155–2165. doi: 10.1056/NEJMoa0908610 [DOI] [PubMed] [Google Scholar]
  • 3.Collet JP, Thiele H, Barbato E, et al. 2020 ESC guidelines for the management of acute coronary syndromes in patients presenting without persistent ST-segment elevation. Eur Heart J. 2021;42(14):1289–1367. doi: 10.1093/eurheartj/ehaa575 [DOI] [PubMed] [Google Scholar]
  • 4.Fox KA, Steg PG, Eagle KA, et al. Decline in rates of death and heart failure in acute coronary syndromes, 1999–2006. JAMA. 2007;297(17):1892–1900. doi: 10.1001/jama.297.17.1892 [DOI] [PubMed] [Google Scholar]
  • 5.Furman MI, Dauerman HL, Goldberg RJ, et al. Twenty-two year (1975 to 1997) trends in the incidence, in-hospital and long-term case fatality rates from initial Q-wave and non-Q-wave myocardial infarction: a multi-hospital, community-wide perspective. J Am Coll Cardiol. 2001;37(6):1571–1580. doi: 10.1016/S0735-1097(01)01203-7 [DOI] [PubMed] [Google Scholar]
  • 6.Mandelzweig L, Battler A, Boyko V, et al. The second euro heart survey on acute coronary syndromes: characteristics, treatment, and outcome of patients with ACS in Europe and the Mediterranean Basin in 2004. Eur Heart J. 2006;27(19):2285–2293. [DOI] [PubMed] [Google Scholar]
  • 7.Liew R, Sulfi S, Ranjadayalan K, et al. Declining case fatality rates for acute myocardial infarction in South Asian and white patients in the past 15 years. Heart. 2006;92(8):1030–1034. doi: 10.1136/hrt.2005.078634 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Moraes-Silva IC, Rodrigues B, Coelho-Junior HJ, et al. Myocardial infarction and exercise training: evidence from basic science. Adv Exp Med Biol. 2017;999:139–153. [DOI] [PubMed] [Google Scholar]
  • 9.Velagaleti RS, Pencina MJ, Murabito JM, et al. Long-term trends in the incidence of heart failure after myocardial infarction. Circulation. 2008;118(20):2057–2062. doi: 10.1161/CIRCULATIONAHA.108.784215 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Young RS, Ponting CP.. Identification and function of long non-coding RNAs. Essays Biochem. 2013;54:113–126. doi: 10.1042/bse0540113 [DOI] [PubMed] [Google Scholar]; • This is one of the study that motivated our research.
  • 11.Kohlmaier A, Holdt LM, Teupser D. Long noncoding RNAs in cardiovascular disease. Curr Opin Cardiol. 2023;38(3):179–192. doi: 10.1097/HCO.0000000000001041 [DOI] [PMC free article] [PubMed] [Google Scholar]; •• To our opinion it reveals a connection between long noncoding RNAs and cardiovascular disease.
  • 12.Jiang X, Ning Q. The emerging roles of long noncoding RNAs in common cardiovascular diseases. Hypertens Res. 2015;38(6):375–379. doi: 10.1038/hr.2015.26 [DOI] [PubMed] [Google Scholar]
  • 13.Huang Y. The novel regulatory role of lncRNA-miRNA-mRNA axis in cardiovascular diseases. J Cell Mol Med. 2018;22(12):5768–5775. doi: 10.1111/jcmm.13866 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Xu S, Kamato D, Little PJ, et al. Targeting epigenetics and non-coding RNAs in atherosclerosis: from mechanisms to therapeutics. Pharmacol Ther. 2019;196:15–43. doi: 10.1016/j.pharmthera.2018.11.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ishii N, Ozaki K, Sato H, et al. Identification of a novel non-coding RNA, MIAT, that confers risk of myocardial infarction. J Hum Genet. 2006;51(12):1087–1099. doi: 10.1007/s10038-006-0070-9 [DOI] [PubMed] [Google Scholar]
  • 16.Kumarswamy R, Bauters C, Volkmann I, et al. Circulating long noncoding RNA, LIPCAR, predicts survival in patients with heart failure. Circ Res. 2014;114(10):1569–1575. doi: 10.1161/CIRCRESAHA.114.303915 [DOI] [PubMed] [Google Scholar]
  • 17.de Gonzalo-Calvo D, Kenneweg F, Bang C, et al. Circulating long-non coding RNAs as biomarkers of left ventricular diastolic function and remodelling in patients with well-controlled type 2 diabetes. Sci Rep. 2016;6(1):37354. doi: 10.1038/srep37354 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Pan JX. LncRNA H19 promotes atherosclerosis by regulating MAPK and NF-kB signaling pathway. Eur Rev Med Pharmacol Sci. 2017;21(2):322–328. [PubMed] [Google Scholar]
  • 19.Kitow J, Derda AA, Beermann J, et al. Mitochondrial long noncoding RNAs as blood based biomarkers for cardiac remodeling in patients with hypertrophic cardiomyopathy. Am J Physiol Heart Circ Physiol. 2016;311(3):H707–12. doi: 10.1152/ajpheart.00194.2016 [DOI] [PubMed] [Google Scholar]
  • 20.Li D, Chen G, Yang J, et al. Transcriptome analysis reveals distinct patterns of long noncoding RNAs in heart and plasma of mice with heart failure. PLOS ONE. 2013;8(10):e77938. doi: 10.1371/journal.pone.0077938 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Micheletti R, Plaisance I, Abraham BJ, et al. The long noncoding RNA Wisper controls cardiac fibrosis and remodeling. Sci Transl Med. 2017;9(395). doi: 10.1126/scitranslmed.aai9118 [DOI] [PMC free article] [PubMed] [Google Scholar]; •• A novel study for lncRNA Wisper and it’s role for fibrosis formation.
  • 22.Biswas S, Coyle A, Chen S, et al. Expressions of serum lncrnas in diabetic retinopathy a potential diagnostic tool. Front Endocrinol. 2022;13:851967. [DOI] [PMC free article] [PubMed] [Google Scholar]; •• Тhese results encourage us that lncRNA Wisper can be detected in human blood.
  • 23.Ponikowski P, Voors AA, Anker SD, et al. 2016 ESC guidelines for the diagnosis and treatment of acute and chronic heart failure: the task force for the diagnosis and treatment of acute and chronic heart failure of the European Society of Cardiology (ESC) developed with the special contribution of the Heart Failure Association (HFA) of the ESC [practice guideline]. Eur Heart J. 2016;37(27):2129–2200. doi: 10.1093/eurheartj/ehw128 [DOI] [PubMed] [Google Scholar]
  • 24.Lang RM, Badano LP, Mor-Avi V, et al. Recommendations for cardiac chamber quantification by echocardiography in adults: an update from the American Society of Echocardiography and the European Association of Cardiovascular Imaging. Eur Heart J Cardiovasc Imag. 2015;16(3):233–271. doi: 10.1093/ehjci/jev014 [DOI] [PubMed] [Google Scholar]
  • 25.Busch A, Eken SM, Maegdefessel L. Prospective and therapeutic screening value of non-coding RNA as biomarkers in cardiovascular disease. Ann Transl Med. 2016;4(12):236. doi: 10.21037/atm.2016.06.06 [DOI] [PMC free article] [PubMed] [Google Scholar]; • The following study evaluates the potential role of Lnc RNA as a biomarker for cardiovascular diseases.
  • 26.Araszkiewicz A, Janus M, Prech M, et al. Relations of diabetes mellitus, microvascular reperfusion and left ventricular remodelling in patients with acute myocardial infarction treated with primary coronary intervention. Kardiol Pol. 2014;72(1):20–26. doi: 10.5603/KP.a2013.0185 [DOI] [PubMed] [Google Scholar]
  • 27.Ounzain S, Micheletti R, Beckmann T, et al. Genome-wide profiling of the cardiac transcriptome after myocardial infarction identifies novel heart-specific long non-coding RNAs. Eur Heart J. 2015;36(6):353–368. doi: 10.1093/eurheartj/ehu180 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Frangogiannis NG, Kovacic JC. Extracellular matrix in ischemic heart disease, part 4/4. JACC Focus Seminar J Am Coll Cardiol. 2020;75(17):2219–2235. doi: 10.1016/j.jacc.2020.03.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Puls M, Beuthner BE, Topci R, et al. Impact of myocardial fibrosis on left ventricular remodelling, recovery, and outcome after transcatheter aortic valve implantation in different haemodynamic subtypes of severe aortic stenosis. Eur Heart J. 2020;41(20):1903–1914. doi: 10.1093/eurheartj/ehaa033 [DOI] [PMC free article] [PubMed] [Google Scholar]; • This study underlines the importance of myocardial fibrosis in left ventricular remodelling.
  • 30.Rizzello V. Selection of patients eligible for implantable cardioverter defibrillator: beyond left ventricular ejection fraction. Eur Heart J Suppl. 2022;24(Supplement_I):I139–I142. doi: 10.1093/eurheartjsupp/suac087 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Song Y, Chen X, Yang K, et al. Cardiac MRI-derived myocardial fibrosis and ventricular dyssynchrony predict response to cardiac resynchronization therapy in patients with nonischemic dilated cardiomyopathy. Radiol Cardiothorac Imag. 2023;5(5):e220127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Frangogiannis NG. The inflammatory response in myocardial injury, repair, and remodelling. Nat Rev Cardiol. 2014;11(5):255–265. doi: 10.1038/nrcardio.2014.28 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Biernacka A, Frangogiannis NG. Aging and cardiac fibrosis. Aging Dis. 2011;2(2):158–173. [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Material

Data Availability Statement

The authors certify that this manuscript reports original clinical trial data. These data are not available publicly.


Articles from Future Cardiology are provided here courtesy of Taylor & Francis

RESOURCES