Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2002 May;68(5):2359–2367. doi: 10.1128/AEM.68.5.2359-2367.2002

Cre-loxP Recombination System for Large Genome Rearrangements in Lactococcus lactis†

Nathalie Campo 1, Marie-Line Daveran-Mingot 1, Kees Leenhouts 2,‡, Paul Ritzenthaler 1,*, Pascal Le Bourgeois 1
PMCID: PMC127585  PMID: 11976109

Abstract

We have used a new genetic strategy based on the Cre-loxP recombination system to generate large chromosomal rearrangements in Lactococcus lactis. Two loxP sites were sequentially integrated in inverse order into the chromosome either at random locations by transposition or at fixed points by homologous recombination. The recombination between the two chromosomal loxP sites was highly efficient (approximately 1 × 10−1/cell) when the Cre recombinase was provided in trans, and parental- or inverted-type chromosomal structures were isolated after removal of the Cre recombinase. The usefulness of this approach was demonstrated by creating three large inversions of 500, 1,115, and 1,160 kb in size that modified the lactococcal genome organization to different extents. The Cre-loxP recombination system described can potentially be used for other gram-positive bacteria without further modification.


Over the last decade, our knowledge of the structure and organization of the bacterial chromosome has increased largely thanks to the use of physical mapping methods such as pulsed-field gel electrophoresis (PFGE) and large-scale sequencing. Genome map comparisons have revealed unexpected and substantial differences in replicon geometry, genome size, and organization (for a review, see reference 7). However, there is now evidence that physical constraints or selective pressures exist to maintain gene position and orientation relative to the chromosomal replication origin (34), to control exogenous gene transfer in preferred chromosomal regions (17), and to conserve the relative order of some loci even in distantly related bacterial genomes (13). One aspect that remains an enigma is the dynamic state of the bacterial genomes, in particular the nature of the physical constraints or the selective pressures that act to preserve the genome organization. A direct approach to this matter consists of experimental genome shuffling by construction of artificial large genome rearrangements such as inversions, which disrupt the organization of the bacterial chromosome without altering its genetic context, and studying the phenotypic consequences of these inversions. To date, large genome inversions in bacteria have been experimentally constructed by homologous recombination between two inverse-order inactivated copies of a selectable marker (33, 35, 39). These recombination events were phenotypically selected because they led to the reconstitution of one functional copy of the marker. An alternative strategy for the generation of such rearrangements would be the use of site-specific recombination systems, such as the Flp-FRT system from Saccharomyces cerevisiae (6) or the Cre-loxP system from coliphage P1 (1). The Cre recombinase belongs to the λ integrase family and catalyzes recombination between two identical 34-bp sites called loxP (locus of crossing-over). Its main function in Escherichia coli is to ensure stable maintenance of the plasmid form of the phage P1 by resolving DNA dimers into plasmid monomers. Both the Flp-FRT and Cre-loxP recombination systems have been successfully used for chromosome engineering in eukaryotic cell lines and whole organisms (18) as well as for excision of chromosomal DNA in bacteria (14, 16). However, site-specific recombination tools have never been described for the construction of large chromosomal rearrangements in bacteria, except in Pseudomonas aeruginosa, where a 1.59-Mb inversion was fortuitously isolated by use of the Flp-FRT system (4).

Lactococcus lactis is a mesophilic lactic acid bacterium that is extensively used as a starter culture in the manufacture of dairy products. It is a low-G+C, gram-positive coccus phylogenetically related to the genus Streptococcus and has a relatively small circular genome (2,500 kb). Due to its industrial importance, L. lactis serves as a model organism for genetic and biochemical studies of lactic acid bacteria, and considerable efforts have been made to develop gene tagging and targeting techniques to facilitate chromosomal gene analysis and gene cloning. The complete sequence of the genome of L. lactis subsp. lactis strain IL-1403 was recently determined (5) and revealed a structure that can be considered typical of eubacteria: the chromosome is divided into two replication arms of nearly equal length (47 and 53% of the genome), and each replication arm shows a strong bias of gene orientations, GC skew, and Chi-site orientation with respect to the direction of replication. Several studies on genome plasticity in lactococci have revealed that although the overall gene order is conserved even at the intersubspecies level, some chromosomal regions are more prone to rearrangements (10, 23). To produce artificial chromosome shuffling in L. lactis, we designed a new recombination strategy based on the phage P1 recombinase Cre and demonstrated the usefulness of this approach by generating three large inversions that modify the genome organization to different extents.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

The strains used in this work are listed in Table 1. L. lactis strains were grown at 30°C in M17 (38) broth (Merck, Darmstadt, Germany) supplemented with 0.5% glucose (GM17). E. coli was grown at 37°C in Luria-Bertani broth (Difco Laboratories, Detroit, Mich.). Antibiotics were used at the following concentrations for E. coli: erythromycin (Em), 150 μg/ml; chloramphenicol (Cm), 10 μg/ml; spectinomycin (Spc), 100 μg/ml; tetracycline (Tc), 2 μg/ml; and kanamycin, 40 μg/ml. For L. lactis, the concentrations were as follows: Em, 5 μg/ml; Cm, 5 μg/ml; Spc, 200 μg/ml; and Tc, 2 μg/ml.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid Relevant property(s)a Source or reference
Strains
    L. lactis
        MG1363 Plasmid-free strain 12
        NZ9000 MG1363 pepN::nisRK 21
        NZ9700 Nisin-producing transconjugant containing Tn5276 20
        CL307/1 NZ9000, Emr, chromosome::(pCL307)n This work
        CL307/1-311 CL307/1, Spcr, pcp region::(pCL311)n This work
        CL307/5 NZ9000, Emr, chromosome::(pCL307)n This work
        CL307/5-311 CL307/5, Spcr, pcp region::(pCL311)n This work
        CL307/1-324 CL307/1, Spcr, ilvD::(pCL324)1 This work
    E. coli
        DH5α F− φ80dlacZΔM15 Δ(lacZYA-argF)U169 endA1 recA1 hsdR17(rK− mK+) deoR thi-1 supE44 λ−gyrA96 relA1 Life Technologies
        EC1000 MC1000 glgB::repA 28
Plasmids
    pLS1 Tcr, broad-host-range plasmid 37
    pILOX1204 Apr, reporter plasmid for measuring Cre recombinase activity; corresponds to pIL253 with P59-loxP1-T1T2Trep-loxP2-lacZ cloned into the multiple cloning site K. J. Leenhouts, laboratory collection
    pRL1 Emr, 5-kb integrative vector 25
    pR324 Apr, Emr, Spcr, aad9 in pR244 9
    pCL50 Apr, pBSIIKS(−) (Stratagene) with an I-CeuI site inserted at the AflIII site Laboratory collection
    pCL52 Emr, 2.4-kb cloning vector; corresponds to pCL50 where bla gene and phage f1 ori are replaced by the ermAM gene This work
    pCL57 Spcr, 2.45-kb cloning vector; corresponds to pCL50 where bla gene and phage f1 ori are replaced by the aad9 gene This work
    pCL60 Emr, 3.26-kb transpositional vector; ISS1 insertion sequence cloned at the SapI site of pCL52 This work
    pCL302 Spcr, pCL57 with loxP1 cassette cloned at the BamHI site This work
    pCL307 Emr, pCL60 with loxP2 cassette cloned at the EcoRI site This work
    pCL311 Spcr, pCL302 with a 4.5-kb fragment of pcp region cloned at the EcoRI and HindIII sites This work
    PCL324 Spcr, pCL302 with a 2.8-kb fragment of ilv operon cloned at the HindIII site This work
    pGh9 Emr, 3.7-kb cloning vector with a thermosensitive replicon [repA (Ts)] 31
    pNZ8048 Cmr, 3.4-kb expression vector 11
    pNG8048-Cre Cmr, pNZ8048 with cre gene cloned at the NcoI and HindIII sites K. J. Leenhouts, laboratory collection
    pGh-Cre Cmr, 4.8-kb pNG8048-Cre derivative with thermosensitive replicon of pGh9 This work
a

Ap, ampicillin.

Growth kinetics were determined in GM17 broth as follows. Culture tubes (diameter, 16 mm) containing 5 ml of prewarmed medium were inoculated with 2% of an overnight culture and incubated at 30°C without shaking in a water bath. Bacterial growth was monitored by spectrophotometric measurements of the optical density at 600 nm (model UV-1205; Shimadzu, Kyoto, Japan) every 30 min until the culture reached the stationary phase. The growth curve of each strain was constructed from the results of six to eight independent experiments.

DNA manipulations.

Restriction enzymes, Klenow polymerase, Vent polymerase, and T4 DNA ligase were purchased from either Roche Molecular Biochemicals (Mannheim, Germany) or New England Biolabs (Beverly, Mass.) and used as recommended by the suppliers. L. lactis strains were electrotransformed according to the method of Le Bourgeois et al. (24) with 5 μg of integrative plasmid or 50 ng of the replicative plasmid pGh-Cre and plated onto GM17 plates containing the appropriate antibiotic (Em, Spc, or Cm). E. coli DH5α was electrotransformed by use of a gene pulser device (Bio-Rad, Richmond, Calif.) according to the manufacturer's recommendations. E. coli plasmid DNA was isolated by use of a Qiaprep spin kit (small scale) or a plasmid midi kit (large scale) (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. Preparation of lactococcal genomic DNA embedded in agarose matrix, the PFGE method, and Southern hybridizations on dried gels were performed as previously described (26). Hybridization signals were detected with a bioimaging analyzer BAS1000 system (Fuji Photo Film Co., Tokyo, Japan) and analyzed with Tina version 2.07c software (Raytest Isotopenmeβgeräte GmbH, Straubenhardt, Germany).

Plasmids.

The plasmids used in this work are listed in Table 1. The bla gene and the phage f1 replication origin of pCL50 were replaced by different antibiotic resistance genes as follows (in all cloning steps, blunt-ended fragments were generated by using Klenow polymerase before ligation). The 1,464-bp SspI/BspHI fragment (containing the colE1 replication origin and the lacZ peptide α regions) of pCL50 was ligated to the 919-bp DdeI/AccI fragment of pAMβ1 (the wild-type ermAM gene) (32) to give pCL52 and to the 983-bp NdeI/XbaI fragment of pR324 (the wild-type aad9 gene from pDL269) (22) to give pCL57. A 934-bp DNA fragment containing the functional ISS1 insertion sequence was amplified by PCR from pRL1 with the following primers: ISS1-5 (TGAAAAATTTACAATTCTACTATCA) and ISS1-3 (CGCTTATTTGGACGACAATGA) (Eurogentec, Seraing, Belgium). The fragment was then ligated with SapI-digested pCL52 to give the transpositional integrative plasmid pCL60.

pGh-Cre was obtained by ligating a 2.3-kb AccI fragment (corresponding to the cat and the PnisA-cre genes) from pNG8048-Cre to a 2.55-kb XbaI-HindIII fragment [corresponding to the ori(Ts) region] of pGh9. Transformation, selection, and propagation of pGh-Cre were performed in E. coli EC1000. pGh-Cre can replicate in L. lactis at 28°C but not at 37°C.

Construction of loxP cassettes.

The 1,187-bp loxP1 cassette (P59-loxP-T1T2Trep) from pILOX1204 was amplified by PCR with the following primers: P59lox1T1T2-1 (CGGGATCCATGATGTTGTTTCTAAA) and P59lox1T1T2-2 (CTCAGGATCCATCGCAACATCAAA). The PCR product was then digested with BamHI (underlined sequences) and cloned into the BamHI site of the integration plasmid, pCL57, to generate pCL302. The loxP2 cassette (T1T2Trep-loxP-tetL open reading frame [ORF]) was constructed in a two-step cloning procedure: a 649-bp DNA fragment containing the three transcription terminators and a loxP site from pILOX1204 was first amplified by PCR with the primers T1T2lox2-1 (GGAATTCCCCTGTTTTGGCGGATGAGA) and T1T2lox2-2 (CCTCCGGATCCTAGCGACAATAACTT). The PCR product was then digested with BamHI (underlined sequence in T1T2lox2-2) and ligated to a 1,495-bp DNA fragment (corresponding to the tetL ORF with its own transcription terminator) that had been generated by PCR amplification of pLS1 with the primers Tetra3 (CCCTATAAACTACAGATCTGCCCTCATTAT) and Tetra2 (GCCCTCTTGAATTCCTGTT) and digested with BglII (underlined sequence in Tetra3). The resulting 2,144-bp fragment (T1T2Trep-loxP-tetL ORF) was amplified by PCR from an aliquot of the ligation mixture with primers T1T2lox2-1 and Tetra2, digested with EcoRI (boldface sequences in T1T2lox2-1 and Tetra2), and cloned into the EcoRI site of pCL60 to generate pCL307.

Chromosomal location and orientation of integrated plasmids.

All of the integrative plasmids described in this study contain unique ApaI, SmaI, NotI, and I-CeuI restriction sites. Their integration sites, as well as their orientations, on the chromosome of lactococcal strains were determined by Southern hybridization of PFGE-separated chromosomal restriction fragments as previously described (25).

Induction of the cre gene by nisin.

Strains carrying pGh-Cre were grown overnight at 28°C in GM17-Cm, diluted 100-fold in the same medium supplemented with a 1:1,000 dilution of the supernatant of the nisin-producing strain NZ9700 (20), and allowed to grow at 28°C to an optical density at 600 nm of 1.0.

Stabilization of chromosomal rearrangements.

The loss of pGh-Cre was provoked as described by Maguin et al. (31) with minor modifications: strains containing pGh-Cre were grown overnight in GM17-Cm medium at 28°C, diluted 100-fold in 5 ml of GM17 without antibiotics, and incubated for 2 h at 28°C (water bath) to allow exponential growth to resume. The cultures were then shifted to 37.5°C for 7 h (water bath), and 50 μl of a 10−5 dilution was plated on GM17 plates (nonselective medium) and incubated at 28°C. One hundred colonies were transferred with toothpicks to nonselective or Cm-containing GM17 plates and incubated at 28°C. Approximately 25% of the colonies were phenotypically Cms, and the loss of pGh-Cre plasmid was confirmed by Southern hybridization with the cre gene as a probe. The genomic structure (parental type or inverted) of the Cms colonies was determined by PFGE and Southern hybridization by use of the tetL ORF probe.

RESULTS

Scheme for generation of chromosomal inversions by use of the inducible Cre-loxP recombination system.

The general scheme of the strategy (Fig. 1) involved a three-step procedure. The first step was the integration of two inverse-order loxP cassettes into the chromosome of L. lactis subsp. cremoris strain NZ9000, either randomly or at a fixed point depending on the integrative plasmid used. Strain NZ9000 is a derivative of strain MG1363, in which the nisRK constitutive operon was integrated into the dispensable gene pepN, allowing the use of the nisin induction-controlled expression system (21). Briefly, this food-grade gene expression system is based on the use of the promoter of the nisA gene (the structural gene of nisin), PnisA, which is inducible by the addition of nisin via the two-component regulatory system consisting of the response regulator protein NisR and the nisin sensor histidine kinase NisK. In nonproducing nisin strains that contain the nisRK operon, genes under the control of PnisA are expressed at a very low level. When nisin is added to the growth medium, transcription of these genes is activated. The physical chromosome map of NZ9000 is thought to be identical to that of MG1363 (26), because no restriction pattern variations were revealed by PFGE after ApaI, SmaI, NotI, or I-CeuI digestions (data not shown). One loxP cassette, the loxP1 cassette (Fig. 2A), consisted of the lactococcal constitutive promoter P59 (40) followed by a loxP site and three lactococcal transcription terminators (T1T2Trep). The second cassette, the loxP2 cassette (Fig. 2A), corresponded to the three transcription terminators, T1T2Trep, followed by a loxP site and the promoterless tetL ORF from pLS1 (37). The function of the terminators in the loxP1 cassette was to stop transcription from the P59 promoter, and the loxP2 cassette terminators prevented any readthrough from a chromosomal promoter that could activate expression of the tetL ORF. Integration of the loxP cassettes into the chromosome via replicative transposition (ISS1 transposition) or single crossing-over (homologous recombination) generally gives rise to multicopy insertion of the integrative plasmids (8, 27, 29, 31).

FIG. 1.

FIG. 1.

Schematic representation of the Cre-loxP recombination system. A, B, C, and D represent the chromosome order. The letter n represents the number of AU of the integrated plasmids. The loxP sites, represented by triangles, are drawn in inverse orientation in order to yield an inversion after Cre-mediated recombination. The other option, whereby the loxP sites would be oriented as direct repeats, has been omitted from the figure.

FIG. 2.

FIG. 2.

(A) Structures of the loxP cassettes used in the Cre-loxP recombination system. The loxP sites are represented by triangles. (B) Plasmids used for the Cre-loxP recombination. Abbreviations: N, NotI; C, I-CeuI; A, ApaI; H, HindIII; E, EcoRI; S, SmaI; Ac, AccI; X, XbaI. (C) Schematic representation of the chromosomal organization of strain NZ9000 showing the location of the inversion endpoints. Different gray scales indicate inverted fragments. Arrows indicate the orientation of the loxP sites.

The second step was the transformation of the double integrant (containing the loxP1 and loxP2 sites in its chromosome) with the thermosensitive replication plasmid pGh-Cre (Fig. 2B), which contains the cre gene regulated by the inducible promoter PnisA (11). In permissive conditions for pGh-Cre replication and cre expression, the Cre recombinase catalyzes recombination between two loxP sites. The result of the recombination depends on the relative orientation of the loxP sites: if they are oriented as direct repeats, the recombination event leads to the deletion of the DNA segment between the sites, and if they are oriented as inverse repeats, the DNA segment between the sites is inverted.

The last step was the recovery of cells harboring either parental- or inverted-type chromosome structures. This was achieved by removing pGh-Cre by growing bacteria at 37.5°C, a temperature not permissive for pGh-Cre replication. Cells that acquired the inverted-type chromosome could be screened for their ability to grow in the presence of Tc, because the recombination between the loxP1 and loxP2 sites generated a transcriptional fusion between the P59 promoter and the tetL ORF. To illustrate the usefulness of this genetic system, we constructed large inversions at four positions in the NZ9000 chromosome (Fig. 2C).

Construction of a 500-kb inversion in the same replication arm of the NZ9000 chromosome. (i) Integration of the loxP cassettes.

The transpositional plasmid pCL307 (Fig. 2B) was first integrated at random into the chromosome of NZ9000. The pCL307 integration sites of 40 Emr clones were located and oriented on the physical map of the NZ9000 genome. The chromosomal structure of one of them, named CL307/1 (Fig. 3A, panel 1), which was localized near the oriC site (Fig. 2C), was analyzed after I-CeuI digestion and hybridization with the tetL ORF as a probe. In addition to the 180-kb hybridizing fragment representative of the pCL307 integration, a 5.4-kb fragment was observed (Fig. 3B, lane 1). This hybridizing fragment corresponded to plasmid amplification at an undetermined copy number, but the amplification unit (AU) number was found to vary from 1 to 50 depending on the integration event (N. Campo, unpublished data). The integrative plasmid pCL311 (Fig. 2B) was then inserted into the chromosome of strain CL307/1, generating strain CL307/1-311. Plasmid pCL311 integrates at the pcp locus by homologous recombination, and its correct integration site, together with the resulting chromosomal structure (Fig. 3A, panel 2), was verified by PFGE after ApaI, SmaI, and I-CeuI digestion and hybridization with pcp or pBSIIKS as a probe (data not shown). An amplification of integrated pCL311 plasmid has been also observed (data not shown).

FIG. 3.

FIG. 3.

(A) Theoretical chromosome structures of strain CL307/1 (panel 1), strain CL307/1-311 (panel 2), and parental- (panel 3) and inverted (panel 4)-type strains. The predicted sizes of the I-CeuI restriction fragments are indicated, and those hybridizing with the tetL probe are indicated in boldface. Fragment sizes are not drawn to scale. C, I-CeuI. (B) Hybridization of I-CeuI-digested chromosomes with the tetL probe after separation by PFGE (electrophoresis conditions were 10 V/cm and 17 s of pulse time for 13 h). Lanes: M, lambda DNA concatemer size standards; L, HindIII-digested lambda DNA; 1, CL307/1-311; 2, CL307/1-311 × pGh-Cre in permissive replication conditions; 3, parental-type strain; 4, inverted-type strain. Hybridization was performed in the presence of 32P-labeled lambda DNA.

(ii) Cre-mediated recombination between the loxP sites.

Strain CL307/1-311 was transformed by the pGh-Cre plasmid. The resulting strain was cultured in conditions permissive for plasmid replication and used to determine the optimal experimental conditions for Cre-mediated recombination. First, the AU numbers of pCL307 and pCL311 were monitored during growth for 100 generations with or without antibiotics by Southern analysis of I-CeuI-digested chromosomes with a pBSIIKS probe. In the absence of pGh-Cre, the AU number was relatively stable, regardless of the growth conditions (Fig. 4, left lanes). As expected, the presence of pGh-Cre led to a strong decrease in the AU copy number, but only under nonselective growth conditions (Fig. 4, right lanes), suggesting that plasmid amplification was necessary to confer an Em and Spc resistance phenotype to the strain. Chromosomal inversion by recombination between the loxP1 and loxP2 sites generated a new 330-kb I-CeuI fragment (Fig. 3A, panel 4) that was identified by hybridization with tetL as a probe. This property was used to evaluate the recombination efficiency between loxP1 and loxP2 sites during growth without selective pressure. Unexpectedly, induction of the cre gene reduced the recombination efficiency between the loxP sites (data not shown). A hypothesis to explain this behavior is given in Discussion. Altogether, these results demonstrated that the most optimal experimental conditions for Cre-mediated recombination between the direct- or inverse-order loxP sites were the noninduction of the cre gene and nonselective growth of the cells (i.e., the absence of the antibiotics Em and Spc). Under these conditions, the ratio of the hybridization signals of the 330- and 180-kb I-CeuI fragments allowed us to estimate that 15% of the chromosomes of the cell population contained the 500-kb inversion (Fig. 3B, lane 2).

FIG. 4.

FIG. 4.

Visualization of the pCL307 and pCL311 amplification units in strains CL307/1-311 and CL307/1-311 × pGh-Cre in different conditions by hybridization of PFGE-separated chromosomal DNA after ApaI digestion with pBSIIKS(−) as a probe. The number above each lane indicates the generation number. The signs − and + correspond to the absence and presence, respectively, of Em and Spc in the growth medium.

(iii) Isolation of strains with a parental- or inverted-type chromosome.

Strains carrying either the parental (Fig. 3A, panel 3)- or the inverted (Fig. 3A, panel 4)-type chromosome were isolated after removal of pGh-Cre by growth at a nonpermissive temperature for its replication. Although inverted-type strains can be selected for their ability to grow in the presence of Tc, the high recombination efficiency allowed the recovery of parental- and inverted-type strains directly from colonies obtained from GM17 plates at 37°C without selective pressure after I-CeuI digestion of individual chromosomal DNA, PFGE separation, and hybridization with tetL as a probe (Fig. 3B, lanes 3 and 4). It should be pointed out that every parental- and inverted-type strain analyzed at this step contained only one copy of each loxP cassette (data not shown), indicating that the removal of AU by recombination between the proximal direct-order loxP sites has an efficiency of 100%.

Inversions of half of the L. lactis chromosome in two different regions.

Two other large chromosomal inversions were constructed through the same experimental procedure. First, a 1,160-kb inversion was generated by integration of pCL311 in the pcp locus of the strain CL307/5 (Fig. 2C). This inversion of half of the chromosome altered neither the length of the two replication arms nor the location and orientation of genes with respect to oriC. The proper integration of these plasmids and the resulting chromosomal structure of the double integrant were verified by Southern hybridation with tetL, pcp, or ISS1 probes (data not shown). Both plasmids were integrated into the chromosome in multiple copies. In addition to the removal of the amplification units of the pCL307 and pCL311 plasmids, the introduction of pGh-Cre into the double integrant led to chromosomal inversion in 50% of the cell population, as determined by the ratio of hybridization signals from fragments that signed the inverted or parental structure (Fig. 5, lane 1), and parental- or inverted-type strains were easily isolated after elimination of the pGh-Cre plasmid (Fig. 5, lanes 2 and 3).

FIG. 5.

FIG. 5.

Hybridization of ApaI-digested chromosomes with the tetL probe after separation by PFGE (electrophoresis conditions were 10 V/cm and 7 s of pulse time for 13 h). Lanes: M, lambda DNA concatemer size standards; L, HindIII-digested lambda DNA; 1, CL307/5-311 × pGh-Cre in permissive replication conditions; 2, parental-type strain isolated after pGh-Cre curing; 3, inverted-type strain isolated after pGh-Cre curing. Hybridization was performed in the presence of 32P-labeled lambda DNA. The letter I corresponds to the ApaI fragment that signs the inverted structure, whereas P corresponds to the ApaI fragment characteristic of the parental structure.

Second, a 1,115-kb inversion, which largely modifies the length of the two replication arms by shifting the terC site at 180 kb to the oriC position (Fig. 2C), was constructed by transforming strain CL307/1 with pCL324 (Fig. 2B), a plasmid able to integrate at the ilv locus of the NZ9000 chromosome. pCL324 was integrated in a single copy into the CL307/1 chromosome (data not shown). Introduction of pGh-Cre into the double integrant led to a recombination event between the different loxP sites, removing the AU of pCL307 from every cell in the population and inverting the chromosomal DNA located between the inverse-order loxP1 and loxP2 sites in 6% of the population (data not shown). The proper chromosomal structures of parental- and inverted-type strains were confirmed by Southern analysis with the tetL ORF as a probe after I-CeuI digestion and separation by PFGE (data not shown).

Effect of the chromosomal inversion on the growth rate in rich medium.

In E. coli and Salmonella enterica serovar Typhimurium, large chromosomal inversions can affect the fitness of the cells to various extents depending on the positions of their endpoints (15, 30, 35). Each inversion constructed in this study was evaluated for a direct effect on cell fitness by comparing the growth rates of the parental- and inverted-type strains in GM17. All inverted-type strains have a reduced growth rate compared to that of their isogenic parental-type counterpart (Table 2), with a decrease in the specific growth rate ranging from 8% for the strains with the 1,160-kb inversion that altered neither the length of the two replication arms nor the location and orientation of genes with respect to oriC to 18% for the strains with the 1,115-kb inversion that largely modified the lengths of the two replication arms.

TABLE 2.

Specific growth rates of L. lactis strains in GM17 medium

Inversion interval Specific growth rate (per hour) ± SE with indicated chromosomal structure
Parental Inverted
307/1-pcp 1.35 ± 0.03 1.15 ± 0.03
307/5-pcp 1.33 ± 0.04 1.23 ± 0.08
307/1-ilvD 1.30 ± 0.03 1.09 ± 0.04

DISCUSSION

With the aim of studying the dynamics of the L. lactis chromosome, we proposed to experimentally construct large inversions from different locations of the chromosome by using the homologous recombination strategy described for Bacillus subtilis (39). Unfortunately, we observed that single crossing-over and transpositional integration of exogenous DNA in L. lactis generally lead to the amplification of the integrated DNA, regardless of the selective marker used (data not shown). Similar observations have been made by different groups (8, 27, 29, 31). As inversions can only be easily obtained if the two targets are both present on the chromosome in single copies, this amplification phenomenon constituted a major drawback. To overcome this difficulty, we devised new genetic tools based on the use of the recombinase Cre from E. coli phage P1 (1) to obtain chromosomal inversions between two inverse-order loxP sites integrated at various positions on the chromosome of L. lactis. Paradoxically, the Cre-loxP recombination system is commonly used to generate efficient chromosomal rearrangements in eukaryotic cell lines and whole organisms (18) but is rarely used to promote in vivo recombination in bacteria (2, 41). In L. lactis, the highest recombination efficiency was obtained without induction of cre and in the absence of selective pressure. This indicates that the basal level of Cre recombinase in the cell, caused by a low level of leakiness of the nisA promoter, is sufficient to promote efficient recombination between the loxP sites, suggesting that very few Cre protein molecules are necessary in the cell to allow the full recombination process. The decrease of the inversion efficiency between the two distal loxP sites observed after overexpression of the cre gene by nisin induction can be explained in light of a recent study which demonstrated that in E. coli, overexpression of the Cre recombinase altered the directionality for recombination, leading to deletion instead of inversion in substrates carrying two loxP sites as inverted repeats (3).

To demonstrate the usefulness of the Cre-loxP recombination system, three large chromosomal inversions have been constructed at different locations in the genome of L. lactis. The first inversion (interval, 307/1-pcp) changes the orientation of one half of the right replication arm without modifying the chromosome symmetry with respect to oriC. The second inversion (interval, 307/1-ilvD) results in strong asymmetrical chromosome replication: the “lower” (counterclockwise-moving) fork replicates about 92% of the chromosome and meets the opposite fork 180 kb from oriC. The last inversion (interval, 307/5-pcp) does not alter the length of the two replication arms or the location or orientation of genes with respect to oriC. All inversions have an effect on the cell fitness compared to that associated with the corresponding isogenic parental structure, with a decrease in growth rate ranging from 8 to 18% depending on the extent of the chromosome disorganization. Experimentation involving additional large-scale inversions with endpoints located at various sites on the chromosome and investigation of the genetic behavior of these rearrangements (by monitoring their stability) as well as of their phenotypic consequences for cell fitness (by directly comparing the growth rates of isogenic parental- and inverted-type strains in different culture conditions) should provide data on the constraints acting to preserve the lactococcal genome organization.

The Cre-loxP recombination system has several major advantages over the other strategies used to generate genome rearrangements in bacteria. First, the recombination efficiency is high enough for an easy recovery of rearranged clones without any selection system and seemed to be independent of the nature of the chromosomal DNA to be inverted. Thus, it can potentially be used for generating rearrangements in any region of the bacterial chromosome. Second, the efficiency of Cre-mediated recombination does not depend on the length of the DNA fragment located between the two inverted loxP sites, because 500-, 1,115-, and 1,160-kb inversions were easily obtained. These results contrast with those found for eukaryotic cells, in which the recombination frequencies decrease as the genetic distance between the two loxP sites increases (42). Third, the Cre recombinase does not need any host factors or additional processes for catalyzing the complete recombination between the loxP sites, in contrast to what has been observed for S. enterica serovar Typhimurium, in which inversions generated by a homologous recombination mechanism require the RecA and RecBCD proteins (36) and thus may proceed through extensive DNA replication (19).

In conclusion, the Cre-loxP recombination system described in this paper appears to be a powerful tool for purposes such as control of the copy number of integrated exogenous DNA in gene expression investigations or shuffling of the bacterial chromosome (by deletions or inversions) for applied and fundamental genome studies. This recombination system can potentially be used in other gram-positive species without further modifications, since all of the components described here (selectable markers, ISS1 insertion sequence, and pGhost replicon) are functional in alternative gram-positive bacteria (9, 31).

Acknowledgments

This work was supported by grants from the Centre National de la Recherche Scientifique (UMR5100), the Region Midi-Pyrénées (RECH 97002182), and the EC BIOTECH program (BIO4-CT96-0498). N. Campo was supported by a fellowship from the Ministère de l'Enseignement Supérieur et de la Recherche.

We thank M. Dias, A. Edelman, and M. J. Pillaire for helping to improve the manuscript.

Footnotes

†

This paper is dedicated to the memory of Patrick Duwat (5 January 2000).

REFERENCES

  • 1.Abremski, K., R. Hoess, and N. Sternberg. 1983. Studies on the properties of P1 site-specific recombination: evidence for topologically unlinked products following recombination. Cell 32:1301-1311. [DOI] [PubMed] [Google Scholar]
  • 2.Altier, C., and M. Suyemoto. 1999. A recombinase-based selection of differentially expressed bacterial genes. Gene 240:99-106. [DOI] [PubMed] [Google Scholar]
  • 3.Aranda, M., C. Kanellopoulou, N. Christ, M. Peitz, K. Rajewsky, and P. Droge. 2001. Altered directionality in the Cre-loxP site-specific recombination pathway. J. Mol. Biol. 311:453-459. [DOI] [PubMed] [Google Scholar]
  • 4.Barekzi, N., K. Beinlich, T. T. Hoang, X. Q. Pham, R. Karkhoff-Schweizer, and H. P. Schweizer. 2000. High-frequency Flp recombinase-mediated inversions of the oriC-containing region of the Pseudomonas aeruginosa genome. J. Bacteriol. 182:7070-7074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bolotin, A., P. Wincker, S. Mauger, O. Jaillon, K. Malarme, J. Weissenbach, S. D. Ehrlich, and A. Sorokin. 2001. The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res. 11:731-753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Broach, J. R., V. R. Guarascio, and M. Jayaram. 1982. Recombination within the yeast plasmid 2μ circle is site-specific. Cell 29:227-234. [DOI] [PubMed] [Google Scholar]
  • 7.Casjens, S. 1998. The diverse and dynamic structure of bacterial genomes. Annu. Rev. Genet. 32:339-377. [DOI] [PubMed] [Google Scholar]
  • 8.Chopin, M. C., A. Chopin, A. Rouault, and N. Galleron. 1989. Insertion and amplification of foreign genes in the Lactococcus lactis subsp. lactis chromosome. Appl. Environ. Microbiol. 55:1769-1774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Claverys, J. P., A. Dintilhac, E. V. Pestova, B. Martin, and D. A. Morrison. 1995. Construction and evaluation of new drug-resistance cassettes for gene disruption mutagenesis in Streptococcus pneumoniae, using an ami test plaform. Gene 164:123-128. [DOI] [PubMed] [Google Scholar]
  • 10.Davidson, B. E., N. Kordias, M. Dobos, and A. J. Hillier. 1996. Genomic organization of lactic acid bacteria, p. 65-87. In G. Venema, J. H. J. Huis in’t Veld, and J. Hugenholtz (ed.), Lactic acid bacteria: genetics, metabolism and applications. Kluwer Academic Publishers, Dordrecht, The Netherlands.
  • 11.de Ruyter, P. G., O. P. Kuipers, M. M. Beerthuyzen, I. J. van Alen-Boerrigter, and W. M. de Vos. 1996. Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis. J. Bacteriol. 178:3434-3439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gasson, M. J. 1983. Plasmid complements of Streptococcus lactis NCDO712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol. 154:1-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Glaser, P., L. Frangeul, C. Buchrieser, C. Rusniok, A. Amend, F. Baquero, P. Berche, H. Bloecker, P. Brandt, T. Chakraborty, A. Charbit, F. Chetouani, E. Couve, A. de Daruvar, P. Dehoux, E. Domann, G. Dominguez-Bernal, E. Duchaud, L. Durant, O. Dussurget, K. D. Entian, H. Fsihi, F. G. Portillo, P. Garrido, L. Gautier, W. Goebel, N. Gomez-Lopez, T. Hain, J. Hauf, D. Jackson, L. M. Jones, U. Kaerst, J. Kreft, M. Kuhn, F. Kunst, G. Kurapkat, E. Madueno, A. Maitournam, J. M. Vicente, E. Ng, H. Nedjari, G. Nordsiek, S. Novella, B. de Pablos, J. C. Perez-Diaz, R. Purcell, B. Remmel, M. Rose, T. Schlueter, N. Simoes, A. Tierrez, J. A. Vazquez-Boland, H. Voss, J. Wehland, and P. Cossart. 2001. Comparative genomics of Listeria species. Science 294:849-852. [DOI] [PubMed] [Google Scholar]
  • 14.Hasan, N., M. Koob, and W. Szybalski. 1994. Escherichia coli genome targeting. I. Cre-lox-mediated in vitro generation of ori− plasmids and their in vivo chromosomal integration and retrieval. Gene 150:51-56. [DOI] [PubMed] [Google Scholar]
  • 15.Hill, C. W., and J. A. Gray. 1988. Effects on chromosomal inversion on cell fitness in Escherichia coli K-12. Genetics 119:771-778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Huang, L. C., E. A. Wood, and M. M. Cox. 1991. A bacterial model system for chromosomal targeting. Nucleic Acids Res. 19:443-448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Janssen, P. J., B. Audit, and C. A. Ouzounis. 2001. Strain-specific genes of Helicobacter pylori: distribution, function and dynamics. Nucleic Acids Res. 29:4395-4404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kilby, N. J., M. R. Snaith, and J. A. Murray. 1993. Site-specific recombinases: tools for genome engineering. Trends Genet. 9:413-421. [DOI] [PubMed] [Google Scholar]
  • 19.Kogoma, T. 1996. Recombination by replication. Cell 85:625-627. [DOI] [PubMed] [Google Scholar]
  • 20.Kuipers, O. P., M. M. Beerthuyzen, R. J. Siezen, and W. M. de Vos. 1993. Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis. Requirement of expression of the nisA and nisI genes for development of immunity. Eur. J. Biochem. 216:281-291. [DOI] [PubMed] [Google Scholar]
  • 21.Kuipers, O. P., P. G. de Ruyter, and M. Kleerebezem. 1998. Quorum sensing-controlled gene expression in lactic acid bacteria. J. Biotechnol. 64:15-21. [Google Scholar]
  • 22.LeBlanc, D. J., L. N. Lee, and J. M. Inamine. 1991. Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase AAD(9) determinant from Enterococcus faecalis. Antimicrob. Agents Chemother. 35:1804-1810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Le Bourgeois, P., M. L. Daveran-Mingot, and P. Ritzenthaler. 2000. Genome plasticity among related Lactococcus strains: identification of genetic events associated with macrorestriction polymorphisms. J. Bacteriol. 182:2481-2491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Le Bourgeois, P., P. Langella, and P. Ritzenthaler. 2000. Electrotransformation of Lactococcus lactis, p. 56-65. In J. Teissié and N. Eynard (ed.), Electrotransformation of bacteria, Springer lab manual. Springer, Heidelberg, Germany.
  • 25.Le Bourgeois, P., M. Lautier, M. Mata, and P. Ritzenthaler. 1992. New tools for the physical and genetic mapping of Lactococcus strains. Gene 111:109-114. [DOI] [PubMed] [Google Scholar]
  • 26.Le Bourgeois, P., M. Lautier, L. van den Berghe, M. J. Gasson, and P. Ritzenthaler. 1995. Physical and genetic map of the Lactococcus lactis subsp. cremoris MG1363 chromosome: comparison with that of Lactococcus lactis subsp. lactis IL1403 reveals a large genome inversion. J. Bacteriol. 177:2840-2850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Leenhouts, K. J., A. Bolhuis, G. Venema, and J. Kok. 1998. Construction of a food-grade multiple-copy integration system for Lactococcus lactis. Appl. Microbiol. Biotechnol. 49:417-423. [DOI] [PubMed] [Google Scholar]
  • 28.Leenhouts, K. J., G. Buist, A. Bolhuis, A. ten Berge, J. Kiel, I. Mierau, M. Dabrowska, G. Venema, and J. Kok. 1996. A general system for generating unlabelled gene replacements in bacterial chromosomes. Mol. Gen. Genet. 253:217-224. [DOI] [PubMed] [Google Scholar]
  • 29.Leenhouts, K. J., J. Kok, and G. Venema. 1989. Campbell-like integration of heterologous plasmid DNA into the chromosome of Lactococcus lactis subsp. lactis. Appl. Environ. Microbiol. 55:394-400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Louarn, J. M., J. P. Bouché, F. Legendre, J. Louarn, and J. Patte. 1985. Characterization and properties of very large inversions of the E. coli chromosome along the origin-to-terminus axis. Mol. Gen. Genet. 201:467-476. [DOI] [PubMed] [Google Scholar]
  • 31.Maguin, E., H. Prévots, S. D. Ehrlich, and A. Gruss. 1996. Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178:931-935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Martin, B., G. Alloing, V. Méjean, and J. P. Claverys. 1987. Constitutive expression of erythromycin resistance mediated by the ermAM determinant of plasmid pAMβ1 results from deletion of 5′ leader peptide sequences. Plasmid 18:250-253. [DOI] [PubMed] [Google Scholar]
  • 33.Rebollo, J. E., V. François, and J. M. Louarn. 1988. Detection and possible role of two large nondivisible zones on the Escherichia coli chromosome. Proc. Natl. Acad. Sci. USA 85:9391-9395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Rocha, E. P., A. Danchin, and A. Viari. 1999. Universal replication biases in bacteria. Mol. Microbiol. 32:11-16. [DOI] [PubMed] [Google Scholar]
  • 35.Segall, A. M., M. J. Mahan, and J. R. Roth. 1988. Rearrangement of the bacterial chromosome: forbidden inversions. Science 241:1314-1318. [DOI] [PubMed] [Google Scholar]
  • 36.Segall, A. M., and J. R. Roth. 1994. Approaches to half-tetrad analysis in bacteria: recombination between repeated, inverse-order chromosomal sequences. Genetics 136:27-39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Stassi, D. L., P. Lopez, M. Espinosa, and S. A. Lacks. 1981. Cloning of chromosomal genes in Streptococcus pneumoniae. Proc. Natl. Acad. Sci. USA 78:7028-7032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Terzaghi, B. E., and W. E. Sandine. 1975. Improved medium for lactic streptococci and their bacteriophages. Appl. Microbiol. 29:807-813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Toda, T., T. Tanaka, and M. Itaya. 1996. A method to invert DNA segments of the Bacillus subtilis 168 genome by recombination between homologous sequences. Biosci. Biotech. Biochem. 60:773-778. [DOI] [PubMed] [Google Scholar]
  • 40.van der Vossen, J. M., D. van der Lelie, and G. Venema. 1987. Isolation and characterization of Streptococcus cremoris Wg2-specific promoters. Appl. Environ. Microbiol. 53:2452-2457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Yoon, Y. G., J. H. Cho, and S. C. Kim. 1998. Cre/loxP-mediated excision and amplification of large segments of the Escherichia coli genome. Genet. Anal. 14:89-95. [DOI] [PubMed] [Google Scholar]
  • 42.Zheng, B., M. Sage, E. A. Sheppeard, V. Jurecic, and A. Bradley. 2000. Engineering mouse chromosomes with Cre-loxP: range, efficiency, and somatic applications. Mol. Cell. Biol. 20:648-655. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES