Skip to main content
NCBI home page
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2026 Jan 3;12(1):e70742. doi: 10.1002/vms3.70742

Efficacy of Probiotic Lactobacillus spp. Isolated From Healthy Korean Indigenous Calves

Ji‐Yeong Ku 1, Mi‐Jin Lee 2, Youngwoo Jung 1, Youngjun Kim 1, Kwang‐Man Park 1, Jonghun Baek 1, Byoungsoo Kim 1, Ji‐Seon Yoon 1, Jinho Park 1,✉
PMCID: PMC12759306  PMID: 41482829

ABSTRACT

Background

A healthy gut microbiota enhances immune function and reduces infection susceptibility in neonatal calves.

Objectives

This study evaluated the probiotic efficacy of Lactobacillus amylovorus, Lactobacillus reuteri and Lactobacillus johnsonii isolated from Korean indigenous calves in improving gut microbiota, inhibiting pathogen colonization and enhancing immunity in newborn calves.

Methods

These strains were fed orally at 109 colony‐forming unit (CFU)/g in a mixture, five times every 2 days. Experiment 1 targeted calves under 10 days old, and Experiment 2 targeted calves less than 1 day old. Faecal and blood samples were collected for microbial, pathogen and blood analyses.

Results

Probiotic‐fed calves (LA group) showed significantly increased gut microbial diversity on Day 10 compared to Day 0 and control group (C group), as indicated by higher Shannon and Simpson indices. Beneficial bacteria such as Faecalibacterium prausnitzii showed higher abundance, whereas potentially harmful bacteria like Bacteroides fragilis showed lower abundance. On Day 20, pathogens were detected in 25% of calves in the LA group, compared to 100% in the C group, which was significantly lower. Blood parameters in the LA group remained stable, whereas the C group showed fluctuations. Mild metabolic acidosis was observed in the C group in Experiment 2. In Experiment 2, the LA group had significantly higher total protein and γ‐globulin than the C group on Day 5.

Conclusions

The LA group showed beneficial bacteria proliferation, harmful bacteria suppression, pathogenic infection inhibition and improved serum protein status, suggesting that these strains may contribute to the health management of calves under 10 days old.

Keywords: blood parameter, gut microbiota, intestinal pathogen, Korean indigenous calf, Lactobacillus spp, probiotics

We investigated the probiotic efficacy of a Lactobacillus mixture from calves. This mixture contributes to beneficial bacteria proliferation and harmful bacteria suppression in the gut microbiota, as well as inhibition of pathogenic infections and improved immunity.

graphic file with name VMS3-12-e70742-g005.jpg

1. Introduction

Diarrhoea in calves under 1 month of age is considered one of the most critical signs throughout the life cycle of cattle (de Verdier et al. 2003; Torsein et al. 2011). In the United States, 56% of female calves reported to have diseases showed digestive signs (Urie et al. 2018), and digestive disorders accounted for 68.7% of the causes of death in calves on a Korean indigenous cattle farm (Kim et al. 2015). Diarrhoea is caused by a complex interplay of infectious agents, including viruses, bacteria and protozoa, and non‐infectious factors, including poor environmental conditions and diet, which alter the intestinal environment by increasing intestinal motility and fluid secretion (Cho and Yoon 2014; Klein‐Jöbstl et al. 2014). In newborn calves, the gut microbiota is initially unstable and undergoes dynamic changes influenced by various factors, gradually leading to the establishment of a stable microbial community within the intestinal environment. Given its potential long‐term effect on host physiology, the gut microbiome established during this early developmental stage plays a pivotal role in the overall growth and development of calves (Amin and Seifert 2021; Kerr et al. 2015). Lactobacillus is known to play an important role in inhibiting the growth of pathogenic microorganisms, enhancing the protective function of the intestinal mucosa and stimulating the immune response in calf diarrhoea (Aureli et al. 2011). In addition, faecal microbiota transplantation and probiotic feeding with probiotics consisting of various microbial species have been reported to induce changes in the gut microbiota composition, which has been associated with a reduced incidence or severity of diarrhoea (Kim, Whon, et al. 2021; Liu et al. 2022; Fernández‐Ciganda et al. 2022; Varada et al. 2022).

Probiotics have various health benefits, including regulating the host gut microbiota, reducing inflammation, enhancing immunity and suppressing pathogen colonization, when consumed in appropriate amounts (Chuang et al. 2022; Kechagia et al. 2013). Feeding probiotics to cattle has been reported to be effective in reducing the incidence of diarrhoea, enhancing feed efficiency and weight gain, increasing milk production and maintaining the gut microbiota balance under stress conditions, thereby improving livestock productivity (Chaucheyras‐Durand and Durand 2010; Kober et al. 2022; O'Hara et al. 2020; Uyeno et al. 2015; Xu et al. 2017). In addition, probiotics have demonstrated potential as adjuncts to antibiotic therapy or as alternative treatments for calves exhibiting diarrhoea (Renaud et al. 2019; Alagawany et al. 2018; Hempel et al. 2012). Due to concerns regarding antibiotics, probiotics are being used as alternatives to promote the health and growth of calves (Cammarota et al. 2014; McAllister et al. 2011).

In addition, it was reported that blood indices in Korean indigenous calves with diarrhoea differed more from those in healthy calves as diarrhoea became more severe (Lee et al. 2020). Blood urea nitrogen (BUN) levels, which are closely related to dehydration due to diarrhoea, have been reported as potential indicators for predicting the prognosis of diarrhoeal calves (Kim, Yu, et al. 2021; Chae et al. 2022). γ‐Globulins, which are mainly composed of immunoglobulins such as IgG, IgA and IgM, are transferred through colostrum and gradually decrease as active immunity is acquired (An et al. 2022). The α2‐globulin fraction significantly increased in newborn Korean indigenous calves with diarrhoea, whereas the γ‐globulin level significantly decreased (Choi et al. 2021). These blood changes may vary depending on the growth and clinical severity of the calf.

There is increasing interest in establishing a balanced gut microbiome in Korean indigenous calves and evaluating the efficacy of probiotics for this purpose. In a previous study, feeding a mixture of Lactobacillus plantarum and Bacillus subtilis was found to significantly reduce the population of Enterobacteriaceae in calves (Lee et al. 2012). However, differences in gut microbiome exist between hosts, and for the ingested microorganisms to survive in the indigenous microbiota and exert their effects, strains derived from the same host are expected to be more effective as probiotics (Kim et al. 2011; Park et al. 2016). Nevertheless, there have been few studies on the efficacy of probiotics using strains isolated from Korean indigenous calves. Moreover, as the gut microbiome changes with the growth of the host, it is necessary to select probiotic strains that are appropriate for the host's growth stage (Kaur et al. 2023; Du et al. 2023). Furthermore, the effects of feeding probiotics to these calves on changes in the gut microbiota and the resulting impact on immune function and pathogen infection rates have not yet been elucidated.

Neonatal calf health, including gut microbiota balance and diarrhoea prevention, is a critical issue worldwide, affecting various breeds and production systems. In our previous study, Lactobacillus amylovorus, Lactobacillus reuteri and Lactobacillus johnsonii were isolated from the faeces of healthy Korean indigenous calves, and their safety as probiotics was verified. In this study, we orally fed probiotics derived from strains isolated from Korean indigenous calves to newborn calves and compared their physiological indices with those of calves that were not fed to evaluate the efficacy of the strains as probiotics. To the best of our knowledge, this is the first study to comprehensively evaluate the combined efficacy of Lactobacillus strains isolated from Korean indigenous calves. Therefore, insights gained from this study may have broader implications for improving calf health beyond Korean indigenous calves.

2. Materials and Methods

2.1. Preparation of a Mixture of Lactobacillus spp

Lactobacillus spp., including L. amylovorus (Oh et al. 2021), L. johnsonii (Oh et al. 2023) and L. reuteri, isolated from the faeces of healthy calves, were streaked onto De Man, Rogosa and Sharpe (MRS) agar plates (Becton Dickinson, Franklin Lakes, NJ, USA) and incubated at 37°C for 24–48 h. Subsequently, colonies from the agar plates were inoculated into MRS broth (Becton Dickinson, Franklin Lakes, NJ, USA) and incubated for 8–16 h, after which the cultures were centrifuged to collect the bacterial cells. Each bacterial pellet was mixed at a 1:1 ratio with a cryoprotectant solution containing 10% skim milk, 15% trehalose, 0.5% glycerin and 1% NaCl, followed by freezing at −20°C for 24 h (Jeong et al. 2015). The frozen bacterial cells were lyophilized using a freeze dryer (Scanvac Coolsafe, LaboGene, Lillerød, Denmark) for 48 h, then resuspended in sterilized phosphate‐buffered saline (PBS) and streaked onto MRS agar plates. The plates were incubated at 37°C for 24–48 h, and colony‐forming units (CFUs) were counted to determine the viable cell count. Subsequently, each Lactobacillus strain was aliquoted at 109 CFU/g, and the three strains were mixed to create a mixture of Lactobacillus spp. The mixture was then transferred into 15 mL conical tubes (Conical Tube, SPL Life Sciences, Pocheon, Korea), sealed and stored at 4°C.

2.2. Feeding a Mixture of Lactobacillus spp

Two independent experiments were conducted in this study. Both experiments were performed at a large‐scale Korean farm housing over 3000 Korean indigenous cattle. Newborn calves born around the same period for each experiment, clinically healthy and without congenital abnormalities, were randomly selected for inclusion. Within each experiment, the selected calves were assigned to either the probiotic feeding group (LA group) or the control group (C group), with the group sizes determined based on farm management conditions and experimental feasibility. All calves in both experiments were reared under the same farm management programme, with consistent environmental conditions, including feeding, thermal regulation and hygiene management. All calves received sufficient colostrum immediately after birth and were housed together with their dams following parturition. The health of the calves was monitored daily by a veterinarian. According to the standard scoring procedure, faecal scores of 2–3 were considered diarrhoea, and the onset date was recorded. The study design was approved by the appropriate ethics review board (JBNU IACUC No. NON2023‐123).

Experiment 1: Fourteen healthy Korean indigenous calves under 10 days of age (median age = 7 days; 7 males and 7 females) were randomly selected. The LA group (n = 8) was orally fed a mixture of Lactobacillus spp. with water five times in total at approximately 2‐day intervals. Faecal and blood samples were collected on Days 0 (LA0), 5 (LA5), 10 (LA10) and 20 (LA20). LA20 represents the sampling point 10 days after the last feed of the mixture. Similarly, faecal and blood samples were collected from the C group (n = 6), which did not receive the Lactobacillus spp. mixture, at the same time points (C0, C5, C10, C20). Calves in Experiment 1 were analysed for faecal microbiota, pathogen detection, blood parameters and serum protein concentrations (Table 1).

TABLE 1.

Calf classification and sampling information from Experiments 1 and 2 conducted in this study.

Group name Supplementation of a Lactobacillus spp. mixture n Days Sampling
Experiment 1 LA group 5 times at 2‐day intervals 8 Under 10 days Before supplementations (LA0), after 5 days (LA5), after 10 days (LA10), 10 days after the completion of the supplementation (LA20)
C group No feeding 6 Day 1 (C0), Day 5 (C5), Day 10 (C10), Day 20 (C20)
Experiment 2 LA group 5 times at 2‐day intervals 5 1 days Before supplementation (LA0), after 5 days (LA5), after 10 days (LA10), 20 days after the completion of the supplementation (LA30)
C group No feeding 5 Day 1 (C0), Day 5 (C5), Day 10 (C10), Day 30 (C30)
Open in a new tab

Experiment 2: Ten healthy 1‐day‐old Korean indigenous calves (sex not specified) were selected, and the probiotic feeding group (n = 5) was orally fed a mixture of Lactobacillus spp. with water five times in total at approximately 2‐day intervals. Faecal and blood samples were collected on Days 0 (LA0), 5 (LA5), 10 (LA10) and 30 (LA30), with LA30 representing the sampling point 20 days after the last feed of the mixture. Blood and faecal samples were collected from the control group (C group; n = 5), which did not receive the mixture of Lactobacillus spp., at the same time points (Table 1).

The faecal samples were transported to the laboratory under refrigerated conditions and stored at −20°C until analysis. Additionally, blood gases were analysed immediately after collection. Blood was aliquoted into serum collection tubes, transported to the laboratory under refrigerated conditions and centrifuged at 3000 × g for 10 min. The separated serum was stored at −20°C until analysis. All analyses were performed in a blinded manner.

2.3. DNA Extraction and Amplification

The genomic DNA of microorganisms in faecal samples collected from the LA group and C group calves in Experiment 1 was extracted using a DNA extraction kit (FastDNA SPIN Kit for Soil, MP Biomedicals). The extracted microbial metagenomic DNA served as a template for polymerase chain reaction (PCR) amplification of the V3/V4 region of the 16S rRNA gene using primers 341F and 805R. PCR was performed on a thermal cycler (PTC‐200 Peltier Thermal Cycler, MJ Research, Waltham, MA, USA). The initial PCR conditions consisted of a pre‐denaturation step at 94°C for 3 min, followed by 28 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 40 s and elongation at 72°C for 1 min. The final extension step was performed at 72°C for 5 min. Subsequently, a secondary PCR was performed using i5 and i7 index primers to attach the Illumina Nextera barcodes. The PCR conditions consisted of an initial denaturation at 94°C for 3 min, followed by eight cycles of denaturation at 94°C for 30 s, annealing at 53°C for 40 s and extension at 72°C for 1 min, with a final extension step at 72°C for 5 min. The sequences of the primers used for the PCR are listed in Table 2.

TABLE 2.

Primers and gene sequences of polymerase chain reaction (PCR).

Primer Sequence (5′ → 3′)
341F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG
805R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC
Illumina index i5 S502 ATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCGGCAGCGTC
i7 index i7 N701 CAAGCAGAAGACGGCATACGAGATTCGCCTTGTCTCGTGGGCTCGG
Open in a new tab

The amplified PCR products were purified using a QIAquick PCR Purification Kit (Qiagen, Valencia, CA, USA) and size‐selected using agarose gel electrophoresis to retain DNA fragments longer than 300 bp. Fragment sizes were verified using an Agilent 2100 Bioanalyser (Agilent Technologies, Santa Clara, CA, USA). After verification, sequencing libraries were constructed from the purified amplicons and sequenced using the Illumina MiSeq platform.

2.4. Microbiota Analysis

Nucleotide sequence data obtained by MiSeq were processed using the Mothur software package (https://www.mothur.org). Sequences were initially assigned to individual samples, and paired‐end reads were assembled into contigs. Quality filtering was performed to remove sequences that did not meet the established criteria. Filtered reads were subjected to alpha diversity analysis using the EzBioCloud platform (www.ezbiocloud.net) and CL community software (ChunLab Inc., Seoul, Republic of Korea). The taxonomic composition and microbial community structure were identified at various taxonomic levels, including phylum, class, order, family, genus and species. Hierarchical clustering was performed using the unweighted pair group method with arithmetic average (UPGMA), and beta diversity was assessed using the unweighted unique fraction metric (UniFrac) analysis. Principal coordinate analysis (PCoA) was used to visualize differences in microbial communities. Linear discriminant analysis (LDA) effect size (LEfSe) was conducted using the Galaxy workflow framework (https://huttenhower.sph.harvard.edu/galaxy/) to identify significantly different bacterial taxa, applying a threshold of p < 0.05 and an LDA score >2.0.

2.5. Detection of Pathogens

A diagnostic investigation was conducted to detect seven major intestinal pathogens commonly associated with gastrointestinal diseases in calves: Bovine Viral Diarrhoea Virus (BVDV), Bovine Rotavirus (BRV), Bovine Coronavirus (BCoV), Cryptosporidium spp., Giardia spp., Eimeria zuernii and Eimeria bovis.

Faecal samples were mixed with 10 mL of PBS and centrifuged at 3000 rpm for 10 min. DNA and RNA were extracted from the supernatant using an automated extraction kit (AutoXT PGS DNA/RNA Kit; Intron). The extracted RNA was then subjected to real‐time PCR analysis using a commercial triplex detection kit (PowerChek Bovine Disease Virus Triplex Real‐Time PCR Kit, Kogene Biotech, Seoul, Korea) for the simultaneous identification of BVDV, BRV and BCoV.

For protozoan examination, faecal samples were mixed with a saturated sugar solution and filtered to remove debris. The filtrate was transferred to a 15 mL conical tube (SPL Life Sciences, Pocheon, Korea), which was then filled with a saturated solution until a convex meniscus was formed. A cover glass was carefully placed on the top and allowed to stand for 10 min. The cover glass was mounted onto a glass slide for microscopic examination. The oocysts of Giardia spp., E. zuernii, E. bovis and Cryptosporidium spp. were identified under a microscope at magnifications ranging from 100× to 400×.

2.6. Blood Gas Analysis

Immediately after blood collection, the blood parameters were analysed using an i‐STAT analyser with EC8 + i‐STAT cartridges. The measured parameters included haematocrit (HCT), haemoglobin (Hb), pH, total carbon dioxide (tCO2), partial pressure of carbon dioxide (pCO2), bicarbonate (HCO3 −), base excess (BE), anion gap (AG), glucose and BUN. The strong ion difference (SID) was calculated on the basis of the electrolyte concentrations using the following formula: SID = ([Na+] + [K+]) − [Cl−].

2.7. Serum Protein Analysis

To analyse the five major protein fractions: albumin, α1‐globulin, α2‐globulin, β‐globulin and γ‐globulin, a semi‐automated agarose gel electrophoresis system (HYDRASYS 2; Sebia, Lisses, France) was used according to the manufacturer's protocol. Briefly, 300 µL of serum was utilized for the microtechnique analysis. Electrophoresis was performed for 35 min, followed by staining for 5 min, destaining for 5 min, and clearing for 30 s. The remaining solution was removed using a glass rod, and the sample was dried for 10 min. Optical density scanning was conducted using a HYDRASYS system (Sebia, Lisses, France) to measure the results.

2.8. Statistical Analysis

The relative abundances of major phyla, classes, orders, families (median relative abundance > 0.1%) and genera (median relative abundance >0.01%) in the intestinal microbiota were calculated. Group comparisons were performed using GraphPad Prism version 6. Statistical differences between control and experimental groups were analysed using the SPSS software package (SPSS, Chicago, IL, USA). The detection rates of pathogens were analysed using the chi‐square test. In contrast, haematological values were analysed using the two‐tailed independent t‐test or Mann–Whitney U‐test and one‐way ANOVA or Kruskal–Wallis test, depending on the results of the normality test. Data are expressed as mean ± standard deviation (SD), and statistical significance was set at p < 0.05.

3. Results

3.1. Microbiota Analysis

Microbiome taxonomic profiling was conducted to analyse the intestinal microbiota of the 14 calves in Experiment 1. One calf from the LA group was excluded from the analysis because of failed sequencing quality control (QC), and 52 faecal samples from the remaining 13 calves were used for comparative analysis of the intestinal microbiota.

3.1.1. Alpha Diversity

Alpha diversity analysis was conducted to compare microbial richness and evenness in faecal samples from two groups of calves: the LA group (n = 7), which received a mixture of Lactobacillus spp. (LA0, LA5, LA10 and LA20), and the C group (n = 6), which did not receive a mixture. Richness indices, including ACE, Chao1 and Jackknife, increased progressively from LA0 to LA5, LA10 and LA20. Notably, the Jackknife index showed a statistically significant difference between LA0 and LA20 (p < 0.05). The evenness indices showed significant differences over time. Specifically, the Shannon index significantly increased in LA10 and LA20 compared to LA0, whereas the Simpson index significantly decreased in LA10 and LA20 compared to LA0 (p < 0.05) (Figure 1).

FIGURE 1.

FIGURE 1

Open in a new tab

Alpha diversity analysis of the gut microbiota in calves from the probiotic feeding group in Experiment 1, which were fed a mixture of Lactobacillus spp. Days after the start of the experiment: LA0 (0 days), LA5 (5 days), LA10 (10 days), LA20 (20 days). * p < 0.05.

A total of 13 faecal samples, 7 from the LA group (LA10) and 6 from the C group (C10), were analysed on Day 10 after the start of the experiment. The richness indices were higher in LA10 than in C10, although the differences were not statistically significant. However, the evenness indices were significantly different between LA10 and C10 (p < 0.05) (Figure 2).

FIGURE 2.

FIGURE 2

Open in a new tab

Comparison of alpha diversity of the gut microbiota in calves in Experiment 1 between calves from the control group that did not receive a mixture of Lactobacillus spp. (C10) and the probiotic feeding group fed the mixture (LA10) on Day 10 after the start of the experiment. * p < 0.05.

3.1.2. Beta Diversity

Beta diversity analysis was performed using PCoA and hierarchical clustering to assess microbial community dissimilarities in faecal samples collected from the LA group (LA0, LA5, LA10 and LA20) and the C group (C0, C5, C10 and C20). The results show that the temporal clustering patterns of the microbial communities in both the LA group and C group followed similar trajectories over time (Figure S1). The LA group appeared to show separate clustering of gut microbiota between LA0 and LA10. Additionally, separate clustering of the gut microbiota was observed between LA10 and the C10 on Day 10 (Figure 3).

FIGURE 3.

FIGURE 3

Open in a new tab

Comparison of beta diversity in calves in Experiment 1. (A) Comparison between the probiotic feeding group (LA group) on Days 0 (LA0) and 10 (LA10) after the start of the experiment with a mixture of Lactobacillus spp. (B) Comparison between calves from the control group (C10) and the LA group (LA10) on Day 10 after the start of the experiment.

3.1.3. Taxonomic Composition

The taxonomic composition of LA0, LA5, LA10 and LA20 in the LA group was analysed. All calves exhibited a dominance of Firmicutes and Bacteroidetes at the phylum level, and no significant differences were observed between the groups at the phylum, class, order or family levels (Figure S2). At the genus level, the relative abundance of Lactobacillus significantly increased, Faecalibacterium remained stable, whereas Escherichia significantly decreased over time. At the species level, L. reuteri, Lactobacillus helveticus and Lactobacillus gasseri abundances showed an increase, although these changes were not statistically significant, whereas Escherichia coli abundances decreased significantly (Figure 4).

FIGURE 4.

FIGURE 4

Open in a new tab

The taxonomic composition of the gut microbiome at the genus (A) and species (B) levels in calves from the probiotic feeding group on Days 0 (LA0) and 10 after the start of the experiment (LA10), and 10 after the start of the experiment in the control group (C10) in Experiment 1. * p < 0.05, ** p < 0.01.

The taxonomic composition of the gut microbiome was analysed in the LA group (LA0, LA10) and the C group (C10). No significant differences were observed between the groups at the phylum, class, order and family levels (Figure S3). The relative abundance of Lactobacillus increased in both LA10 and C10 compared to C0, although this change was not statistically significant, whereas Escherichia significantly decreased. However, the relative abundance of Faecalibacterium significantly decreased and Bacteroides significantly increased in C10; significant differences were found between LA10 and C10. At the species level, in LA10, Faecalibacterium prausnitzii remained stable, whereas Bacteroides fragilis abundance decreased although this change was not statistically significant compared to LA0. Although F. prausnitzii significantly decreased and B. fragilis significantly increased in C10, significant differences were observed between LA10 and C10. However, E. coli significantly decreased in both LA10 and C10 (Figure 5).

FIGURE 5.

FIGURE 5

Open in a new tab

The taxonomic composition of the gut microbiota at the genus (A) and species (B) levels in the LA group before supplementation (LA0), 10 days after supplementation (LA10), and in the C group calves of the same age as LA30, which did not receive the mixture of Lactobacillus spp. (C10). * p < 0.05, ** p < 0.01, *** p < 0.001.

3.1.4. The Identified Key Microorganisms

Differences in the gut microbiota of the LA group on Day 0 (LA0) and after 10 days from the start of the experiment (LA10) were analysed using LEfSe. The analysis identified 13 taxa that showed differences before and after feeding: four taxa in LA0 (E. coli, Klebsiella, Clostridium butyricum, Enterobacteriaceae_uc) and nine taxa in LA10 (Bacillus, Catonella, Frisingicoccus, Alistipes, Sporobacter_uc, Blautia_uc, Dorea massiliensis, Ruminococcus torques, Blautia glucerasea). Furthermore, analysis of the microbial communities between LA group (LA10) and the C group (C10) on Day 10 after the start of the experiment. A total of 10 differentially abundant taxa were identified, including three taxa enriched in the C10 (Bacteroides pyogenes, Bacteroides massiliensis, Alloprevotella) and seven taxa in the LA10 (Eisenbergiella, Corynebacterium, Romboutsia timonensis, Oscillibacter, Roseburia inulinivorans, Roseburia, Romboutsia) (Figure 6).

FIGURE 6.

FIGURE 6

Open in a new tab

Differential gut microbial taxa identified by linear discriminant analysis effect size (LEfSe) with a linear discriminant analysis (LDA) score greater than 2.0 at the genus and species levels in calves in Experiment 1. (A) Comparison between the probiotic feeding group (LA group) on Days 0 (LA0) and 10 after the start of the experiment (LA10). (B) Comparison between the LA group (LA10) and the control group (C10) on Day 10 after the start of the experiment.

3.2. Detection of Pathogens

In Experiment 1, a pathogen test was conducted on faecal samples collected from calves. No pathogens were detected in the six calves in C0. In C5, Cryptosporidium spp. was detected in one of six calves (16.7%). In C10, Giardia spp. (2/4, 50.0%) and Cryptosporidium spp. (1/4, 25.0%) were detected in two of four calves. Furthermore, in the C20, BCoV (1/6, 16.7%), BRV (2/6, 33.3%), BVDV (2/6, 33.3%), Giardia spp. (1/6, 16.7%), Cryptosporidium spp. (2/6, 33.3%), E. bovis (1/6, 16.7%) and E. zuernii (3/6, 50.0%) were detected in six calves. In contrast, pathogens were detected in three calves in LA0: Cryptosporidium spp. (1/8, 12.5%), E. bovis (1/8, 12.5%) and E. zuernii (2/8, 25.0%). In LA5, Cryptosporidium spp. were detected in one calf (1/8, 12.5%). In LA10, Giardia spp. were detected in two calves (2/8, 25.0%). In LA20, BCoV (1/8, 12.5%), Cryptosporidium spp. (1/8, 12.5%) and E. zuernii (1/8, 12.5%) were detected in two calves. A significant difference in the pathogen detection rates was observed between LA20 and C20 (p < 0.01) (Table 3).

TABLE 3.

Results of gastrointestinal pathogen analysis of calves in Experiments 1 and 2.

BVDV BRV BCoV Cryptosporidium spp. Giardia spp. Eimeria bovis Eimeria zuernii
Before
C group (Experiment 1)
LA group (Experiment 1) 1/8 (12.5%) 1/8 (12.5%) 2/8 (25.0%)
5 days
C group (Experiment 1) 1/6 (16.7%)
LA group (Experiment 1) 1/8 (12.5%)
10 days
C group (Experiment 1) 1/4 (25.0%) 2/4 (50.0%)
LA group (Experiment 1) 2/8 (25.0%)
C group (Experiment 2) 2/5 (40.0%)
LA group (Experiment 2)
20 days
C group (Experiment 1) 2/6 (33.3%) 2/6 (33.3%) 1/6 (16.7%) 2/6 (33.3%) 1/6 (16.7%) 1/6 (16.7%) 3/6 (50.0%)
LA group (Experiment 1) 1/8 (12.5%) 1/8 (12.5%) 1/8 (12.5%)
C group (Experiment 2) 2/5 (40.0%) 3/5 (60.0%) 5/5 (100.0%) 1/5 (20.0%)
LA group (Experiment 2) 2/5 (40.0%) 2/5 (40.0%)
30 days
C group (Experiment 2) 2/5 (40.0%) 2/5 (40.0%) 1/5 (20.0%)
LA group (Experiment 2) 1/5 (20.0%) 1/5 (20.0%) 2/5 (40.0%)
Open in a new tab

Abbreviations: BCoV, Bovine Coronavirus; BRV, Bovine Rotavirus; BVDV, Bovine Viral Diarrhoea Virus.

In Experiment 2, in the C group, two of five calves showed severe diarrhoea on Days 8 and 10, and BRV was detected in their faeces. In C20, pathogens were detected in all five calves, including BCoV (3/5, 60.0%), BVDV (2/5, 40.0%), Giardia spp. (1/5, 20.0%) and Cryptosporidium spp. (5/5, 100.0%). In C30, BCoV (2/5, 40.0%), Giardia spp. (1/5, 20.0%) and Cryptosporidium spp. (2/5, 40.0%) were detected in all five calves. From five calves in the LA group, no pathogens were detected in LA10. In LA20, BCoV (2/5, 40.0%) and Cryptosporidium spp. (2/5, 40.0%) were revealed in three calves. In LA30, BCoV (1/5, 20.0%), BVDV (1/5, 20.0%) and Cryptosporidium spp. (2/5, 40.0%) were detected in two calves. Although the difference was not statistically significant, the LA group showed a lower pathogen detection rate than the C group (Table 3).

3.3. Blood Gas Analysis

Blood gas analysis in Experiment 1 revealed that calves in LA5 had significantly reduced HCT (32.7 ± 4.1 vs. 25.4 ± 3.9) and Hb (11.1 ± 1.4 vs. 8.6 ± 1.3) compared to those in C5 (p < 0.05). In addition, tCO2 was significantly lower in C5 compared to LA5 (28.5 ± 2.2 vs. 32.0 ± 2.9) (p < 0.05) (Table S1, Figure 7).

FIGURE 7.

FIGURE 7

Open in a new tab

Comparison of blood parameters between calves from the control group (C group) and the probiotic feeding group (LA group) in Experiment 1 (A) and Experiment 2 (B). The labels ‘0 day’, ‘5 days’, ‘10 days’, ‘20 days’ and ‘30 days’ correspond to C0/LA0, C5/LA5, C10/LA10, C20/LA20 and C30/LA30 in Experiments 1 and 2, respectively. AG, anion gap; BE, base excess; BUN, blood urea nitrogen; Hb, haemoglobin; HCT, haematocrit; SID, strong ion difference. * p < 0.05, ** p < 0.01.

In Experiment 2, calves in the C group exhibited a reduction in HCT and Hb levels on Days 5 and 10 compared with those in the LA group; however, these differences were not statistically significant. LA10 demonstrated significantly higher pH (7.26 ± 0.09 vs. 7.38 ± 0.08) and SID (42.6 ± 3.9 vs. 48.8 ± 1.4) (p < 0.05), and BE (0.2 ± 5.4 vs. 7.4 ± 4.6) was higher (p = 0.052) compared to C10. LA30 showed significantly lower AG (13.4 ± 1.1 vs. 11.4 ± 1.1) and glucose (97.4 ± 7.5 vs. 67.4 ± 5.2), as well as significantly higher pCO2 (58.5 ± 5.1 vs. 71.2 ± 6.0) compared to C30 (p < 0.05) (Table S2, Figure 7).

3.4. Serum Protein Analysis

In Experiment 1, the serum protein analysis results for calves in the C group and LA group on Days 0, 5, 10 and 20 after the start of experiment revealed no significant differences in serum protein levels between the two groups. However, in contrast to the C group, β‐globulin levels remained consistent until LA10 but showed a marked decrease at LA20 (Table S3, Figure 8).

FIGURE 8.

FIGURE 8

Open in a new tab

Comparison of serum protein concentrations between calves from the control (C group) and the probiotic feeding group (LA group) in Experiment 1 (A) and Experiment 2 (B). The labels ‘0 day’, ‘5 days’, ‘10 days’, ‘20 days’ and ‘30 days’ correspond to C0/LA0, C5/LA5, C10/LA10, C20/LA20 and C30/LA30 in Experiments 1 and 2, respectively. * p < 0.05.

In Experiment 2, LA5 had a significantly lower A/G ratio (0.44 ± 0.04 vs. 0.35 ± 0.06) and higher γ‐globulin (1.30 ± 0.40 vs. 2.08 ± 0.57) compared to C5 (p < 0.05). In contrast, C5 had a lower α1‐globulin (0.72 ± 0.07 vs. 0.86 ± 0.15) compared to LA5 (p > 0.05). In addition, total protein levels were significantly higher in LA10 compared to C10 (6.44 ± 0.38 vs. 7.36 ± 0.63) (p < 0.05) (Tables S4 and S5, Figure 8).

4. Discussion

Probiotics colonize the host's intestinal mucosa through competitive adhesion, contributing to the establishment of a symbiotic relationship between the host and the microorganisms. Lactobacillus spp. are generally considered not host‐specific, and it has been reported that their ability to adhere to the intestinal mucosa varies depending on the strain rather than the species from which the strain is derived (Rinkinen et al. 2003; Buck et al. 2005). In this study, a mixture of L. amylovorus, L. reuteri and L. johnsonii strains, which were isolated from healthy Korean indigenous calves and are safe probiotics, was fed to neonatal calves to investigate the changes in various physiological parameters.

In Experiment 1, the calves in the C group, from C0 to C10, showed a decrease in the beneficial bacteria and an increase in the harmful bacteria in the gut microbiome from C0 to C10, which resulted in a decrease in the diversity of the microbiome. Previous studies have reported that Lactobacillus spp. are abundant in neonatal calves but decrease as they grow (Klein‐Jöbstl et al. 2014; Uyeno et al. 2010). This creates a favourable environment for pathogen colonization in the intestines, which can lead to various diseases in calves and is a major cause of intestinal diseases in neonatal calves. In contrast, calves in the LA group showed an increase in gut microbiota diversity, with a higher proportion of beneficial bacteria, such as Lactobacillus, and a decrease in the proportion of harmful bacteria, such as Escherichia, at LA5, LA10 and LA20 compared to LA0. This suggests that the feeding of a mixture of Lactobacillus spp. in Korean indigenous calves may increase the proportion of beneficial bacteria in the gut microbiota, contributing to the establishment of a healthy microbiome, as previously reported for probiotics (Cai et al. 2024; Li et al. 2023; Liu et al. 2022; Mansilla et al. 2022). However, the results show no differences in the gut microbiota between calves in the Lactobacillus spp. LA group and C group after Day 10, when the gut microbiota had stabilized.

LEfSe analysis revealed that LA0 had a higher abundance of potentially pathogenic taxa such as E. coli and Klebsiella, whereas LA10 was enriched with beneficial taxa such as Bacillus and Blautia. Blautia is a butyrate‐producing genus, a major short‐chain fatty acid (SCFA), contributing to gut health and exhibiting decreased relative abundance in diarrhoeic calves, suggesting a potential association with diarrhoea (Ma et al. 2020). Previous studies have also reported a higher abundance of Blautia in calves supplemented with multispecies probiotics containing L. plantarum (Liu et al. 2022; Wu et al. 2021). Despite differences in probiotic composition from those used in this study, similar effects on gut microbiota modulation were observed. Additionally, comparison between the LA group and C group revealed that C10 was enriched with inflammation‐associated genera such as Bacteroides and Alloprevotella, whereas LA10 exhibited a healthy microbial community enriched with SCFA‐producing genera like Romboutsia. Therefore, feeding neonatal calves with a mixture of Lactobacillus spp. can replenish the beneficial bacteria lacking in the gut environment, help maintain gut balance and ultimately support overall calf health. However, in this study, the calves had a relatively short duration of mixture feeding, and comparisons between LA20 and C20 after the feeding period were not conducted, limiting the ability to fully assess the progression and persistence of the effects. Previous studies reported that administration of Lactobacillus to calves for 10 days resulted in sustained changes in the gut microbiota for 11 days post‐administration, and levels of inflammatory cytokines such as IL‑1β and IL‑6 remained significantly lower for approximately 3 weeks post‐supplementation (Osawa et al. 2024; Fernández‐Ciganda et al. 2022). Conversely, certain Lactobacillus strains increased only during administration and did not persist in the gut after stopping administration (Fernández et al. 2018). These results suggest the need to evaluate the persistence of effects after discontinuation of feeding. In addition, previous studies showed that calves continuously fed compound probiotics for 60 days exhibited more significant changes in the faecal microbiome compared to those fed for 30 days, with 26 microbial strains being continuously upregulated throughout the 60 days (Cai et al. 2024). Long‐term (>42 days) probiotic supplementation significantly improved faecal consistency compared to short‐term (<28 days) supplementation (Wang et al. 2023). Therefore, further long‐term studies are needed to evaluate both the effects during prolonged feeding and the sustained efficacy after cessation of the Lactobacillus mixture used in this study.

Lactobacillus spp. lower pH by producing various organic acids, creating an antagonistic environment for intestinal pathogens, while also playing a competitive exclusion role against pathogens adhering to the intestinal mucosa and producing bacteriocins to inhibit pathogenic microorganisms (Cotter et al. 2005; Forestier et al. 2001; La Ragione et al. 2004; Reuben et al. 2022). In particular, L. reuteri produces the antimicrobial compound hydroxypropionaldehyde, also known as reuterin, using glycerol (Bertin et al. 2017; Cleusix et al. 2007; Lüthi‐Peng et al. 2002). In Experiment 2, two calves from C10 showed severe diarrhoea compared to calves from LA10. In the detection results of major intestinal pathogens, LA10 (12.5%) and LA20 (25.0%) were lower than C10 (50.0%) and C20 (100.0%) in Experiment 1, and LA20 (60.0%) and LA30 (40.0%) were lower than C20 (100.0%) and C30 (100.0%) in Experiment 2. The strains of L. amylovorus, L. reuteri and L. johnsonii used as probiotics are thought to reduce pathogenic infections; therefore, the development of beneficial bacteria using these strains is expected to help prevent pathogenic infections in Korean indigenous calves (Fan et al. 2021; Li et al. 2023).

In Experiment 1, the LA5 group had significantly lower HCT and Hb values than the C5 group, but they were within the normal range (Kim, Yu, et al. 2021; Lee et al. 2015) and no anaemia was observed. Blood composition in newborn calves has been observed to show significant interindividual differences and dynamic changes according to growth stage (Adams et al. 1992), and the results of our study are likely to be transient and physiologically normal. Furthermore, the observed tCO2 and pCO2 decrease trends in the C5 group may reflect mild metabolic acid load or decreased buffering capacity. However, these changes did not clearly progress to acid–base disorder. In contrast, calves in the LA group show stable tCO2 and pCO2 levels up to LA10, suggesting better maintenance of acid–base homeostasis. Feeding of the Lactobacillus spp. mixture may have contributed to maintaining metabolic homeostasis by modulating the gut microbiome and systemic metabolism, which may help maintain bicarbonate levels. In Experiment 2, two calves in the C10 exhibited severe diarrhoea, resulting in decreased pH, SID, HCO3 − and tCO2 levels, with metabolic acidosis being observed. Dehydration due to diarrhoea increased intestinal electrolyte loss and BUN values. In contrast, blood parameters in the LA groups showed a relatively constant trend compared to those in the C groups in both Experiments 1 and 2. The large fluctuations in blood parameters in the C group may be due to the higher frequency of intestinal pathogen detection. However, haematological indicators can be affected by various physiological factors such as water intake and stress, so caution is warranted when interpreting these results as a direct result of probiotic intake. In addition, in the LA group of Experiment 2, blood parameters remained relatively stable up to LA10. However, at LA30, a sharp shift was observed, including decreases in pH, SID and AG levels. As newborn calves are very sensitive to various factors, further studies are needed on changes after 30 days. Lactobacillus spp. are known to enhance the absorptive capacity of the intestinal mucosa, which may explain the higher glucose levels observed in the LA group (Rooj et al. 2010; Tian et al. 2020). The Lactobacillus spp. mixture developed in this study is expected to help improve blood parameters, and the results of this experiment will allow future studies to clearly elucidate the effects of the Lactobacillus spp. mixture (Bayatkouhsar et al. 2013; Ojha et al. 2020).

In contrast to Experiment 1, Experiment 2 showed a significant increase in total protein and γ‐globulin levels in the LA group compared with those in the C group. However, these measures should be considered indirect proxies rather than definitive evidence of immune enhancement. In this study, immunological indicators such as cytokines or IgA were not evaluated, limiting the evaluation of the potential immunomodulatory effects of the administered probiotic strains. Nevertheless, the observed increase in γ‐globulin and total protein levels can be considered a strong proxy for improved immune status, as γ‐globulins are mainly composed of immunoglobulins, including IgG, IgA and IgM, and their elevation suggests a more robust immune response. Future studies should include a comprehensive immune panel to directly measure cytokines, immunoglobulins and other immune markers, which would clarify whether the probiotics directly stimulate the immune system or contribute indirectly by promoting overall health. The stronger effects observed in Experiment 2 suggest that feeding the mixture of Lactobacillus spp. immediately after birth improves the protein status of calves and particularly improves gut function, which is consistent with the previous studies (Abe et al. 1995; Liu et al. 2015; Li et al. 2023). As the intestinal microbiota gradually stabilizes with calf growth, it is believed that feeding probiotic immediately after birth may have a greater effect on calf health. However, neonatal calves exhibit considerable individual variability, and their gut microbiota undergoes rapid changes, which may result in variable effects of Lactobacillus feeding on gut colonization and overall health. To clarify the mechanisms underlying the stronger effects observed with feeding shortly after birth, further studies are needed to comprehensively evaluate the relationships between gut microbiota changes and immune parameters according to the timing of Lactobacillus feeding. In addition, long‐term studies comparing the effects and persistence of Lactobacillus feeding at different time points would help determine the optimal timing and efficacy of neonatal feeding.

Existing information on the gut microbiota of Korean indigenous calves is insufficient, and there has been little evaluation of the efficacy of strains derived from the faeces of these calves. Due to the relatively small number of calves included in this study and their selection from limited number of farms, the findings may not be fully generalizable to all Korean indigenous calves. Nevertheless, this study serves as a preliminary evaluation of host‐derived Lactobacillus strains and provides a proof of concept for their potential benefits. Despite the small sample size, significant differences were observed in microbial diversity, pathogen detection and specific blood parameters, suggesting that the effects are biologically meaningful. These promising results lay the groundwork for future larger‐scale clinical trials involving a more diverse calf population to confirm and extend these findings, ultimately contributing to the health and management of Korean indigenous calves.

5. Conclusion

Feeding Lactobacillus spp. mixture to newborn Korean indigenous calves showed that it suppressed the growth of pathogenic bacteria and created an intestinal environment in which beneficial bacteria were dominant. In addition, it has been shown that feeding immediately after birth suppresses pathogen infection and improves serum protein status, which may contribute to health management. However, these findings are preliminary and exploratory, as the study involved a small number of calves and a relatively short observation period. Therefore, further research with larger sample sizes and longer‐term follow‐up is necessary to validate these results. Nevertheless, this study provides important insights into the potential of host‐derived Lactobacillus strains as probiotics. These strains may serve as a promising basis for microbial preparations aimed at improving gut health and disease resistance in Korean indigenous calves.

Author Contributions

Ji‐Yeong Ku: writing – original draft. Mi‐Jin Lee: writing – review and editing, original draft. Youngwoo Jung: formal analysis. Youngjun Kim: investigation, resources. Kwang‐Man Park: investigation, resources. Jonghun Baek: investigation, resources. Byoungsoo Kim: visualization. Ji‐Seon Yoon: writing – review and editing, validation. Jinho Park: writing – review and editing, funding acquisition, conceptualization, methodology, project administration, supervision.

Ethics Statement

The authors confirm that the ethical policies of the journal, as noted on the journal's author guidelines page, have been adhered to and the appropriate ethical review committee approval has been received. This study involving live animals was conducted in accordance with the ethical standards for animal research and was approved by the Institutional Animal Care and Use Committee of the National Institute of Animal Science, Republic of Korea (JBNU IACUC No. NON2023‐123).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1 Beta diversity analysis of faecal microbiota in the control group at Day 0 (C0), Day 5 (C5), Day 10 (C10) and Day 20 (C20) (A), and in the probiotic group supplemented with a mixture of Lactobacillus spp. before supplementation (LA0), and 5, 10 and 20 days after supplementation (LA5, LA10 and LA20) (B).

VMS3-12-e70742-s002.jpg (494KB, jpg)

Figure S2 The taxonomic composition of the gut microbiota at the phylum (A), class (B), order (C) and family (D) levels in calves from the probiotic group was analysed before supplementation (LA0), and at 5 (LA5), 10 (LA10) and 20 (LA20) days after supplementation with a mixture of Lactobacillus spp.

VMS3-12-e70742-s003.jpg (556KB, jpg)

Figure S3 The taxonomic composition of the gut microbiota at the phylum (A), class (B), order (C) and family (D) levels in the probiotic group before supplementation (LA0), 10 days after supplementation (LA10), and in the control group of the same age as LA30, which did not receive the mixture of Lactobacillus spp. (C10).

VMS3-12-e70742-s004.jpg (427.1KB, jpg)

Table S1 Comparison of blood gas parameters of calves in probiotic and the control groups in Experiment 1. * p < 0.05, ** p < 0.01.

Table S2 Comparison of blood gas parameters between calves in the probiotic and control groups in Experiment 2. * p < 0.05, ** p < 0.01.

Table S3 Comparison of serum protein levels between calves in probiotic and control groups in Experiment 1.

Table S4 Comparison of serum protein levels between calves in probiotic and control groups in Experiment 2. * p < 0.05.

Table S5 Summary of study results.

VMS3-12-e70742-s001.docx (42.5KB, docx)

Acknowledgements

This study was funded by the Korea Institute of Planning and Evaluation for Technology in Veterinary Drugs and Medical Devices for Economic Animal Domestic Production Technology Development (No. RS‐2025‐02216600) and partially supported by the Regional Innovation Mega Project Program through the Korea Innovation Foundation, funded by the Ministry of Science and ICT (No. 2023‐DD‐UP‐0031).

Ku, J.‐Y. , Lee M.‐J., Jung Y., et al. 2026. “Efficacy of Probiotic Lactobacillus spp. Isolated From Healthy Korean Indigenous Calves.” Veterinary Medicine and Science 12, no. 1: e70742. 10.1002/vms3.70742

Ji‐Yeong Ku and Mi‐Jin Lee should be considered joint first author.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  1. Abe, F. , Ishibashi N., and Shimamura S.. 1995. “Effect of Administration of Bifidobacteria and Lactic Acid Bacteria to Newborn Calves and Piglets.” Journal of Dairy Science 78, no. 12: 2838–2846. 10.3168/jds.S0022-0302(95)76914-4. [DOI] [PubMed] [Google Scholar]
  2. Adams, R. , Garry F., Aldridge B., et al. 1992. “Hematologic Values in Newborn Beef Calves.” American Journal of Veterinary Research 53, no. 6: 944–950. [PubMed] [Google Scholar]
  3. Alagawany, M. , Abd El‐Hack M. E., Farag M. R., et al. 2018. “The Use of Probiotics as Eco‐Friendly Alternatives for Antibiotics in Poultry Nutrition.” Environmental Science and Pollution Research International 25: 10611–10618. 10.1007/s11356-018-1687-x. [DOI] [PubMed] [Google Scholar]
  4. Amin, N. , and Seifert J.. 2021. “Dynamic Progression of the Calf's Microbiome and Its Influence on Host Health.” Computational and Structural Biotechnology Journal 19: 989–1001. 10.1016/j.csbj.2021.01.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. An, J. , Yang M., Kang J.‐H., et al. 2022. “Age‐Related Changes in the Electrophoresis Pattern of Serum Proteins in Korean Indigenous Calves.” Canadian Journal of Veterinary Research 86, no. 3: 233–237. [PMC free article] [PubMed] [Google Scholar]
  6. Aureli, P. , Capurso L., Castellazzi A. M., et al. 2011. “Probiotics and Health: An Evidence‐Based Review.” Pharmacological Research 63, no. 5: 366–376. [DOI] [PubMed] [Google Scholar]
  7. Bayatkouhsar, J. , Tahmasebi A., Naserian A. A., et al. 2013. “Effects of Supplementation of Lactic Acid Bacteria on Growth Performance, Blood Metabolites and Fecal Coliform and Lactobacilli of Young Dairy Calves.” Animal Feed Science and Technology 186, no. 1–2: 1–11. 10.1016/j.anifeedsci.2013.04.015. [DOI] [Google Scholar]
  8. Bertin, Y. , Habouzit C., Dunière L., et al. 2017. “ Lactobacillus reuteri Suppresses E. coli O157: H7 in Bovine Ruminal Fluid: Toward a Pre‐Slaughter Strategy to Improve Food Safety?” PLoS ONE 12, no. 11: e0187229. 10.1371/journal.pone.0187229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Buck, B. L. , Altermann E., Svingerud T., et al. 2005. “Functional Analysis of Putative Adhesion Factors in Lactobacillus acidophilus NCFM.” Applied and Environmental Microbiology 71, no. 12: 8344–8351. 10.1128/AEM.71.12.8344-8351.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cai, X. , Yi P., Chen X., et al. 2024. “Intake of Compound Probiotics Accelerates the Construction of Immune Function and Gut Microbiome in Holstein Calves.” Microbiology Spectrum 12, no. 6: e01909–01923. 10.1128/spectrum.01909-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cammarota, G. , Ianiro G., Bibbò S., et al. 2014. “Gut Microbiota Modulation: Probiotics, Antibiotics or Fecal Microbiota Transplantation?” Internal and Emergency Medicine 9: 365–373. 10.1007/s11739-014-1069-4. [DOI] [PubMed] [Google Scholar]
  12. Chae, J.‐B. , Ku J.‐Y., Park K.‐M., et al. 2022. “Hematology, Serum Biochemistry, and Acute Phase Proteins in Hanwoo (Bos taurus coreanae) Calves With Diarrhea.” Journal of Veterinary Clinics 39, no. 6: 342–352. 10.17555/jvc.2022.39.6.342. [DOI] [Google Scholar]
  13. Chaucheyras‐Durand, F. , and Durand H.. 2010. “Probiotics in Animal Nutrition and Health.” Beneficial Microbes 1, no. 1: 3–9. 10.3920/BM2008.1002. [DOI] [PubMed] [Google Scholar]
  14. Cho, Y.‐I. , and Yoon K.‐J.. 2014. “An Overview of Calf Diarrhea‐Infectious Etiology, Diagnosis, and Intervention.” Journal of Veterinary Science 15, no. 1: 1–17. 10.4142/jvs.2014.15.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Choi, K.‐S. , Kang J.‐H., Cho H.‐C., et al. 2021. “Changes in Serum Protein Electrophoresis Profiles and Acute Phase Proteins in Calves With Diarrhea.” Canadian Journal of Veterinary Research 85, no. 1: 45–50. [PMC free article] [PubMed] [Google Scholar]
  16. Chuang, S.‐T. , Chen C.‐T., Hsieh J.‐C., et al. 2022. “Development of Next‐Generation Probiotics by Investigating the Interrelationships Between Gastrointestinal Microbiota and Diarrhea in Preruminant Holstein Calves.” Animals 12, no. 6: 695. 10.3390/ani12060695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Cleusix, V. , Lacroix C., Vollenweider S., et al. 2007. “Inhibitory Activity Spectrum of Reuterin Produced by Lactobacillus reuteri Against Intestinal Bacteria.” BMC Microbiology 7: 101. 10.1186/1471-2180-7-101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Cotter, P. D. , Hill C., and Ross R. P.. 2005. “Bacteriocins: Developing Innate Immunity for Food.” Nature Reviews: Microbiology 3, no. 10: 777–788. 10.1038/nrmicro1273. [DOI] [PubMed] [Google Scholar]
  19. de Verdier, K. , Christensson B., Svensson C., et al. 2003. “ Cryptosporidium parvum and Giardia intestinalis in Calf Diarrhoea in Sweden.” Acta Veterinaria Scandinavica 44: 145–152. 10.1186/1751-0147-44-145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Du, Y. , Gao Y., Hu M., et al. 2023. “Colonization and Development of the Gut Microbiome in Calves.” Journal of Animal Science and Biotechnology 14: 46. 10.1186/s40104-023-00856-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Fan, P. , Kim M., Liu G., et al. 2021. “The Gut Microbiota of Newborn Calves and Influence of Potential Probiotics on Reducing Diarrheic Disease by Inhibition of Pathogen Colonization.” Frontiers in Microbiology 12: 772863. 10.3389/fmicb.2021.772863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Fernández‐Ciganda, S. , Fraga M., and Zunino P.. 2022. “Probiotic Lactobacilli Administration Induces Changes in the Fecal Microbiota of Preweaned Dairy Calves.” Probiotics and Antimicrobial Proteins 14, no. 5: 804–815. 10.1007/s12602-021-09834-z. [DOI] [PubMed] [Google Scholar]
  23. Fernández, S. , Fraga M., Silveyra E., et al. 2018. “Probiotic Properties of Native Lactobacillus spp. Strains for Dairy Calves.” Beneficial Microbes 9, no. 4: 613–624. 10.3920/BM2017.0131. [DOI] [PubMed] [Google Scholar]
  24. Forestier, C. , De Champs C., Vatoux C., et al. 2001. “Probiotic Activities of Lactobacillus casei rhamnosus: In Vitro Adherence to Intestinal Cells and Antimicrobial Properties.” Research in Microbiology 152, no. 2: 167–173. 10.1016/S0923-2508(01)01188-3. [DOI] [PubMed] [Google Scholar]
  25. Hempel, S. , Newberry S. J., Maher A. R., et al. 2012. “Probiotics for the Prevention and Treatment of Antibiotic‐Associated Diarrhea: A Systematic Review and Meta‐Analysis.” Journal of the American Medical Association 307, no. 18: 1959–1969. 10.1001/jama.2012.3507. [DOI] [PubMed] [Google Scholar]
  26. Jeong, E. J. , Moon D. W., Oh J. S., et al. 2015. “Analysis of Ingredient Mixtures for Cryoprotection and Gastrointestinal Stability of Probiotics.” Korean Society for Biotechnology and Bioengineering Journal 30, no. 3: 109–113. 10.7841/ksbbj.2015.30.3.109. [DOI] [Google Scholar]
  27. Kaur, H. , Kaur G., Gupta T., et al. 2023. “Integrating Omics Technologies for a Comprehensive Understanding of the Microbiome and Its Impact on Cattle Production.” Biology 12, no. 9: 1200. 10.3390/biology12091200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kechagia, M. , Basoulis D., Konstantopoulou S., et al. 2013. “Health Benefits of Probiotics: A Review.” International Scholarly Research Notices 2013: 481651. 10.5402/2013/481651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kerr, C. A. , Grice D. M., Tran C. D., et al. 2015. “Early Life Events Influence Whole‐of‐Life Metabolic Health via Gut Microflora and Gut Permeability.” Critical Reviews in Microbiology 41, no. 3: 326–340. 10.3109/1040841X.2013.837863. [DOI] [PubMed] [Google Scholar]
  30. Kim, H. S. , Whon T. W., Sung H., et al. 2021. “Longitudinal Evaluation of Fecal Microbiota Transplantation for Ameliorating Calf Diarrhea and Improving Growth Performance.” Nature Communications 12: 161. 10.1038/s41467-020-20389-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kim, M.‐K. , Lee H.‐G., Park J.‐A., et al. 2011. “Effect of Feeding Direct‐Fed Microbial as an Alternative to Antibiotics for the Prophylaxis of Calf Diarrhea in Holstein Calves.” Asian‐Australasian Journal of Animal Sciences 24, no. 5: 643–649. 10.5713/ajas.2011.10322. [DOI] [Google Scholar]
  32. Kim, S. , Yu D.‐H., Jung S., et al. 2021. “Biological Factors Associated With Infectious Diarrhea in Calves.” Pakistan Veterinary Journal 41, no. 4: 531–537. 10.29261/pakvetj/2021.078. [DOI] [Google Scholar]
  33. Kim, U.‐H. , Jung Y.‐H., Choe C., et al. 2015. “Korean Native Calf Mortality: The Causes of Calf Death in a Large Breeding Farm Over a 10‐Year Period.” Korean Journal of Veterinary Research 55, no. 2: 75–80. 10.14405/kjvr.2015.55.2.75. [DOI] [Google Scholar]
  34. Klein‐Jöbstl, D. , Schornsteiner E., Mann E., et al. 2014. “Pyrosequencing Reveals Diverse Fecal Microbiota in Simmental Calves During Early Development.” Frontiers in Microbiology 5: 622. 10.3389/fmicb.2014.00622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kober, A. H. , Riaz Rajoka M. S., Mehwish H. M., et al. 2022. “Immunomodulation Potential of Probiotics: A Novel Strategy for Improving Livestock Health, Immunity, and Productivity.” Microorganisms 10, no. 2: 388. 10.3390/microorganisms10020388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. La Ragione, R. , Narbad A., Gasson M., et al. 2004. “In Vivo Characterization of Lactobacillus johnsonii FI9785 for Use as a Defined Competitive Exclusion Agent Against Bacterial Pathogens in Poultry.” Letters in Applied Microbiology 38, no. 3: 197–205. 10.1111/j.1472-765X.2004.01474.x. [DOI] [PubMed] [Google Scholar]
  37. Lee, S.‐H. , Choi E. W., and Kim D.. 2020. “Relationship Between the Values of Blood Parameters and Physical Status in Korean Native Calves With Diarrhea.” Journal of Veterinary Science 21, no. 2: e17. 10.4142/jvs.2020.21.e17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lee, S.‐H. , Ok S.‐H., Kwon H.‐H., et al. 2015. “Arterial and Venous Blood Gas, Electrolytes, Biochemical and Hematological Values in Healthy Korean Native Calves.” Journal of Veterinary Clinics 32, no. 6: 499–503. 10.17555/jvc.2015.12.32.6.499. [DOI] [Google Scholar]
  39. Lee, Y.‐E. , Kang I.‐J., Yu E.‐A., et al. 2012. “Effect of Feeding the Combination With Lactobacillus plantarum and Bacillus subtilis on Fecal Microflora and Diarrhea Incidence of Korean Native Calves.” Korean Journal of Veterinary Service 35, no. 4: 343–346. 10.7853/kjvs.2012.35.4.343. [DOI] [Google Scholar]
  40. Li, Y. , Li X., Nie C., et al. 2023. “Effects of Two Strains of Lactobacillus Isolated From the Feces of Calves After Fecal Microbiota Transplantation on Growth Performance, Immune Capacity, and Intestinal Barrier Function of Weaned Calves.” Frontiers in Microbiology 14: 1249628. 10.3389/fmicb.2023.1249628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Liu, B. , Wang C., Huasai S., et al. 2022. “Compound Probiotics Improve the Diarrhea Rate and Intestinal Microbiota of Newborn Calves.” Animals 12, no. 3: 322. 10.3390/ani12030322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Liu, H. , Ji H., Zhang D., et al. 2015. “Effects of Lactobacillus brevis Preparation on Growth Performance, Fecal Microflora and Serum Profile in Weaned Pigs.” Livestock Science 178: 251–254. 10.1016/j.livsci.2015.06.002. [DOI] [Google Scholar]
  43. Lüthi‐Peng, Q. , Schärer S., and Puhan Z.. 2002. “Production and Stability of 3‐Hydroxypropionaldehyde in Lactobacillus reuteri .” Applied Microbiology and Biotechnology 60: 73–80. 10.1007/s00253-002-1099-0. [DOI] [PubMed] [Google Scholar]
  44. Ma, T. , Villot C., Renaud D., et al. 2020. “Linking Perturbations to Temporal Changes in Diversity, Stability, and Compositions of Neonatal Calf Gut Microbiota: Prediction of Diarrhea.” ISME Journal 14, no. 9: 2223–2235. 10.1038/s41396-020-0678-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Mansilla, F. I. , Ficoseco C. A., Miranda M. H., et al. 2022. “Administration of Probiotic Lactic Acid Bacteria to Modulate Fecal Microbiome in Feedlot Cattle.” Scientific Reports 12: 12957. 10.1038/s41598-022-16786-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. McAllister, T. , Beauchemin K., Alazzeh A., et al. 2011. “The Use of Direct Fed Microbials to Mitigate Pathogens and Enhance Production in Cattle.” Canadian Journal of Animal Science 91, no. 2: 193–211. 10.4141/cjas10047. [DOI] [Google Scholar]
  47. O'Hara, E. , Neves A. L., Song Y., et al. 2020. “The Role of the Gut Microbiome in Cattle Production and Health: Driver or Passenger?” Annual Review of Animal Biosciences 8: 199–220. 10.1146/annurev-animal-021419-083952. [DOI] [PubMed] [Google Scholar]
  48. Oh, Y. J. , Kim J. Y., Lee J., et al. 2021. “Complete Genome Sequence of Lactobacillus amylovorus 1394N20, a Potential Probiotic Strain, Isolated From a Hanwoo Calf.” Journal of Animal Science and Technology 63, no. 5: 1207–1210. 10.5187/jast.2021.e100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Oh, Y. J. , Lee J., Lim S. K., et al. 2023. “Complete Genome Sequence of Probiotic Lactobacillus johnsonii 7409N31 Isolated From a Healthy Hanwoo Calf.” Journal of Animal Science and Technology 65, no. 4: 890–893. 10.5187/jast.2022.e98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Ojha, L. , Kumar S., Kewalramani N., et al. 2020. “Effect of Dietary Supplementation of Lactobacillus acidophilus on Blood Biochemical Profile, Antioxidant Activity and Plasma Immunoglobulin Level in Neonatal Murrah Buffalo Calves.” Indian Journal of Animal Sciences 90, no. 1: 48–54. [Google Scholar]
  51. Osawa, K. , Taharaguti S., Ito C., et al. 2024. “Growth Promotion and Economic Benefits of the Probiotic Lactiplantibacillus plantarum in Calves.” International Journal of Translational Medicine 4, no. 4: 595–607. 10.3390/ijtm4040041. [DOI] [Google Scholar]
  52. Park, B. H. , Kim U. H., Jang S. S., et al. 2016. “Biological Effects of Dietary Probiotics on Blood Characteristics in Hanwoo Heifers Subjected to Lipopolysaccharide (LPS) Challenge.” Korean Journal of Agricultural Science 43, no. 5: 818–827. 10.7744/kjoas.20160086. [DOI] [Google Scholar]
  53. Renaud, D. , Kelton D., Weese J., et al. 2019. “Evaluation of a Multispecies Probiotic as a Supportive Treatment for Diarrhea in Dairy Calves: A Randomized Clinical Trial.” Journal of Dairy Science 102, no. 5: 4498–4505. 10.3168/jds.2018-15793. [DOI] [PubMed] [Google Scholar]
  54. Reuben, R. C. , Elghandour M. M., Alqaisi O., et al. 2022. “Influence of Microbial Probiotics on Ruminant Health and Nutrition: Sources, Mode of Action and Implications.” Journal of the Science of Food and Agriculture 102, no. 4: 1319–1340. 10.1002/jsfa.11643. [DOI] [PubMed] [Google Scholar]
  55. Rinkinen, M. , Westermarck E., Salminen S., et al. 2003. “Absence of Host Specificity for In Vitro Adhesion of Probiotic Lactic Acid Bacteria to Intestinal Mucus.” Veterinary Microbiology 97, no. 1–2: 55–61. 10.1016/S0378-1135(03)00183-4. [DOI] [PubMed] [Google Scholar]
  56. Rooj, A. K. , Kimura Y., and Buddington R. K.. 2010. “Metabolites Produced by Probiotic Lactobacilli Rapidly Increase Glucose Uptake by Caco‐2 Cells.” BMC Microbiology 10: 16. 10.1186/1471-2180-10-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Tian, Z. , Cui Y., Lu H., et al. 2020. “Effects of Long‐Term Feeding Diets Supplemented With Lactobacillus reuteri 1 on Growth Performance, Digestive and Absorptive Function of the Small Intestine in Pigs.” Journal of Functional Foods 71: 104010. 10.1016/j.jff.2020.104010. [DOI] [Google Scholar]
  58. Torsein, M. , Lindberg A., Sandgren C. H., et al. 2011. “Risk Factors for Calf Mortality in Large Swedish Dairy Herds.” Preventive Veterinary Medicine 99, no. 2–4: 136–147. 10.1016/j.prevetmed.2010.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Urie, N. , Lombard J., Shivley C., et al. 2018. “Preweaned Heifer Management on US Dairy Operations: Part V. Factors Associated With Morbidity and Mortality in Preweaned Dairy Heifer Calves.” Journal of Dairy Science 101, no. 10: 9229–9244. 10.3168/jds.2017-14019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Uyeno, Y. , Sekiguchi Y., and Kamagata Y.. 2010. “rRNA‐Based Analysis to Monitor Succession of Faecal Bacterial Communities in Holstein Calves.” Letters in Applied Microbiology 51, no. 5: 570–577. 10.1111/j.1472-765X.2010.02937.x. [DOI] [PubMed] [Google Scholar]
  61. Uyeno, Y. , Shigemori S., and Shimosato T.. 2015. “Effect of Probiotics/Prebiotics on Cattle Health and Productivity.” Microbes and Environments 30, no. 2: 126–132. 10.1264/jsme2.ME14176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Varada, V. V. , Kumar S., Chhotaray S., et al. 2022. “Host‐Specific Probiotics Feeding Influence Growth, Gut Microbiota, and Fecal Biomarkers in Buffalo Calves.” AMB Express 12: 118. 10.1186/s13568-022-01460-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Wang, L. , Sun H., Gao H., et al. 2023. “A Meta‐Analysis on the Effects of Probiotics on the Performance of Pre‐Weaning Dairy Calves.” Journal of Animal Science and Biotechnology 14: 3. 10.1186/s40104-022-00806-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Wu, Y. , Wang L., Luo R., et al. 2021. “Effect of a Multispecies Probiotic Mixture on the Growth and Incidence of Diarrhea, Immune Function, and Fecal Microbiota of Pre‐Weaning Dairy Calves.” Frontiers in Microbiology 12: 681014. 10.3389/fmicb.2021.681014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Xu, H. , Huang W., Hou Q., et al. 2017. “The Effects of Probiotics Administration on the Milk Production, Milk Components and Fecal Bacteria Microbiota of Dairy Cows.” Science Bulletin 62, no. 11: 767–774. 10.1016/j.scib.2017.04.019. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1 Beta diversity analysis of faecal microbiota in the control group at Day 0 (C0), Day 5 (C5), Day 10 (C10) and Day 20 (C20) (A), and in the probiotic group supplemented with a mixture of Lactobacillus spp. before supplementation (LA0), and 5, 10 and 20 days after supplementation (LA5, LA10 and LA20) (B).

VMS3-12-e70742-s002.jpg (494KB, jpg)

Figure S2 The taxonomic composition of the gut microbiota at the phylum (A), class (B), order (C) and family (D) levels in calves from the probiotic group was analysed before supplementation (LA0), and at 5 (LA5), 10 (LA10) and 20 (LA20) days after supplementation with a mixture of Lactobacillus spp.

VMS3-12-e70742-s003.jpg (556KB, jpg)

Figure S3 The taxonomic composition of the gut microbiota at the phylum (A), class (B), order (C) and family (D) levels in the probiotic group before supplementation (LA0), 10 days after supplementation (LA10), and in the control group of the same age as LA30, which did not receive the mixture of Lactobacillus spp. (C10).

VMS3-12-e70742-s004.jpg (427.1KB, jpg)

Table S1 Comparison of blood gas parameters of calves in probiotic and the control groups in Experiment 1. * p < 0.05, ** p < 0.01.

Table S2 Comparison of blood gas parameters between calves in the probiotic and control groups in Experiment 2. * p < 0.05, ** p < 0.01.

Table S3 Comparison of serum protein levels between calves in probiotic and control groups in Experiment 1.

Table S4 Comparison of serum protein levels between calves in probiotic and control groups in Experiment 2. * p < 0.05.

Table S5 Summary of study results.

VMS3-12-e70742-s001.docx (42.5KB, docx)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES