Abstract
Background
Radiation Dermatitis (RD) is the most common side effect of radiotherapy, severely affecting the implementation of the antitumor treatment plan. The traditional Chinese medicine(TCM) compound Danxiong Granules (TDX105) is an external formulation used clinically for over a decade with notable efficacy, though its pharmacological mechanisms remain unclear, This study delves into the intricate mechanism by which TDX105 confers protection against RD by modulating the inflammation-related pathway, employing a combination of network pharmacology and experimental validation.
Methods
The active components and potential targets of TDX105 were gathered from databases such as TCMSP, PubChem, PharmMapper and Swiss Target Prediction, disease-related target genes were collected by retrieving the Genecards and DisGeNET databases; STRING database was used for protein-protein interaction analysis and mapping; Cytoscape software was applied for core target analysis and network diagram construction; GO functional and KEGG pathway enrichment analyses were performed using the Metascape database.Subsequent validation was accomplished through molecular docking and in vitro cell experiments.
Results
In the current study, network pharmacology analysis identified 73 active compounds and 973 potential target genes associated with TDX105, along with 1507 disease-related genes, revealing 289 common genes. The top ten active compounds included quercetin, kaempferol, luteolin, sitosterol, perlolyrine, phellochin, baicalein, cavidine, palmatine and fumarine. PPI network analysis identified core target genes including PIK3R1, SRC, and TP53, with molecular docking demonstrating favorable binding interactions between the active components and these hub targets. Enrichment analysis indicated that TDX105 may exert its effects by modulating inflammatory responses, with KEGG pathway analysis uncovering associations with EGFR, MAPK, PI3K-Akt, and NF-κB signaling pathways. In vitro experiments demonstrated that TDX105 significantly reduced levels of inflammation markers NO, IL-6, and TNF-α compared to the control group (P < 0.05), displayed dose-dependent inhibition of NF-κB activity, and markedly inhibited mRNA expression of iNOS, NLRP3, IL-6, TNF-α, and IL-1β (P < 0.05). Western blot analyses confirmed significant downregulation of NLRP3, COX-2, p-NF-κB, and p-ERK protein levels in the treatment group (P < 0.05).
Conclusions
Overall, our findings suggest that TDX105 may exert anti-inflammatory effects through the inhibition of NF-κB and MAPK signaling pathways, providing a potential therapeutic approach for radiation dermatitis.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12906-025-05194-1.
Keywords: Network pharmacology, Molecular docking, TDX105, Radiation dermatitis, Mechanism
Radiation therapy is one of the standard treatment methods for malignant tumors, and Radiation Dermatitis (RD) is the most common adverse reaction to radiotherapy [1]. Approximately 95% of patients undergoing radiotherapy experience varying degrees of skin damage, which manifests as symptoms such as skin redness, swelling, ulcers, and necrosis, significantly affecting patients’ quality of life and the successful implementation of anti-tumor radiotherapy plans [2]. Currently, clinical treatment methods are diverse, primarily focusing on cleansing, moisturizing, and skin protection. However, these preventive and therapeutic measures remain unsatisfactory, characterized by inadequate efficacy and complex applications [3]. There are no efficient specific therapeutic drugs available. Although some scholars in China have attempted to use traditional Chinese medicine(TCM) formulations for intervention and treatment [4], such approaches have not been widely promoted, and new treatment strategies need to be further explored [5].
Existing studies have found that the mechanism of RD is often related to oxidative stress damage induced by reactive oxygen species, inflammation triggered by cytokines, and immune responses caused by macrophages [6]. Radiation-induced DNA damage and cell death activate multiple inflammatory signaling pathways, such as NF-κB(nuclear factor kappa-light-chain-enhancer of activated B cells) and MAPK(mitogen-activated protein kinase). The activation of these pathways leads to the release of inflammatory factors (such as interleukin-1, interleukin-6, and tumor necrosis factor-α) and promotes increased expression of Cyclooxygenase-2(COX-2). As a key enzyme in the inflammatory response, COX-2 catalyzes the synthesis of prostaglandin E2 (PGE2) and other eicosanoid compounds, further amplifying local inflammatory effects and attracting immune cells (such as macrophages and lymphocytes) to the site of injury [7].
The TCM compound TDX105 consists of five Chinese medicinal herbs: Chuanxiong (Ligusticum chuanxiong), Honghua (Carthamus tinctorius), Lao Guan Cao (Geranium wilfordii), Huang Bo (Phellodendron amurense), and Dan Pi(Moutan cortex).it is used clinically for the treatment of radiation dermatitis for many years. We also completed a preliminary randomized controlled clinical study on the use of TDX105 for treating radiation dermatitis [8]. The study involved patients with grade III radiation skin lesions, and the results indicated that in the control group treated with epidermal growth factor, the median time for skin lesion repair was 26 days, while in the treatment group with the traditional Chinese medicine TDX105, the median time for skin lesion repair was only 11 days, demonstrating significant efficacy and clear advantages. This compound has been patented and was authorized by the Chinese Patent Office in 2015. It has now been successfully transformed and new drug research and development is in progress. However, the complex components of TDX105 and the specific molecular mechanisms for treating radiation dermatitis remain unclear and merit further research.
In the research of TCM compound formulas, network pharmacology can comprehensively unveil the action mechanisms and regulatory mechanisms of TCM compound drugs [9]. It achieves this by analyzing the interactions among the drug components within the compound, predicting the drug’s action targets, conducting pathway analysis, and facilitating drug repurposing [10]. This provides in-depth theoretical support and guidance for the research, development, and clinical application of TCM compound formulas. Molecular docking is a computer technology grounded in structural design [11]. It offers in-depth prediction of drug efficacy and mechanism analysis, including target prediction and verification, prediction of drug efficacy, drug design, and analysis of action mechanisms [12]. In this study, network pharmacology was employed to predict the action mechanism of the TCM compound TDX105 in treating radiation dermatitis. Molecular docking technology and in vitro cell experiments were then applied for verification. Subsequently, we explored its potential material basis for drug efficacy and molecular mechanisms, aiming to provide a foundation for the in-depth research and clinical application of TDX105 in the treatment of radiation dermatitis. The experimental procedure is described as follows(Fig. 1):
Fig. 1.
The network pharmacology research process of TCM TDX105
Materials and methods
Traditional Chinese Medicine(TCM) TDX105
TCM TDX105 is a formula granule made from five kinds of traditional Chinese medicine decoction pieces, namely Chuanxiong (Ligusticum chuanxiong), Honghua (Carthamus tinctorius), Lao Guan Cao (Geranium wilfordii), Huang Bo (Phellodendron amurense), and Dan Pi (Moutan cortex), through production and processing. The production of the product is entrusted to China Resources Sanjiu Medical & Pharmaceutical Co., Ltd.
Cell culture
The RAW264.7 macrophage cell line and HEK293T cell line were purchased from the American Type Culture Collection (ATCC). They were cultured in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM) (MeilunBio, Dalian, China) containing 10% fetal bovine serum(MeilunBio, Dalian, China) and 1% penicillin-streptomycin(Solarbio Science & Technology Co.,Ltd.,Beijing, China) at 37 °C, in an atmosphere of 5% CO₂ and saturated humidity.
Network pharmacology research
Screening of active ingredients and target prediction of TCM compound TDX105
In the Traditional Chinese Medicine Systems Phar-macology (TCMSP) platform(https://old.tcmsp-e.com/tcmsp.php)the active compounds of the five traditional Chinese medicines in the TDX105 were identified, and active components meeting the criteria of oral bioavailability (OB) ≥ 30% and drug-likeness (DL) ≥ 0.18 were selected along with their corresponding target genes [13].The SMILES format of the active components was obtained from the PubChem [14] database (https://pubchem.ncbi.nlm.nih.gov/). These were then imported into the SwissTargetPrediction database (http://swisstargetprediction.ch/) to obtain the potential targets of the active components. Targets with a Probability greater than 0.1 were screened. Subsequently, the PharmMapper [15] database (https://lilab-ecust.cn/pharmmapper/index.html) was used for supplementation. The UniProt [16] database (https://www.uniprot.org/) and the NCBI database (https://www.ncbi.nlm.nih.gov/) were employed to query the gene names of the targets and convert the corresponding target genes for each component into standard gene names.
Screening of targets related to radiation dermatitis
In the GeneCards (https://www.genecards.org/) and DisGeNET (https://www.disgenet.org/) databases, we searched for disease-related target genes using the keywords “radiodermatitis,” “Radiation-Induced Dermatitis,” “Radiation Recall Reactions,” and “Radiation Recall Dermatitis.” The target information obtained from the two databases was intersected, and the common targets were identified as potential targets for radiation dermatitis [17, 18]. Subsequently, the potential targets for RD and the target genes of the TCM compound TDX105 were imported into a Venn diagram creation website (https://www.bioinformatics.com.cn/static/others/jvenn/example.html) to generate a Venn diagram, revealing the common target genes between the disease and the drug.Common genes were considered potential targets of TDX105 for the treatment of radiation dermatitis.
Construction of drug active ingredients and disease target network
Next, the results for the active components of TDX105 and common targets of TDX105 and radiation dermatitis were imported into Cytoscape [19] (v3.10.0) to construct a “component-target-disease ” network, for topology analysis and visualization, using the degree value as the topological indicator. The NetworkAnalyzer function within the software was used for network analysis.
Protein - Protein Interaction (PPI) network construction and analysis
The common target genes of TDX105 and RD were imported into the STRING [20] website (https://string-db.org/) for protein-protein interaction analysis to obtain the association information between proteins. Subsequently, the analysis results of the STRING database were exported as a TSV file and imported into Cytoscape 3.10.0 for visualization and network construction. The target genes were arranged clockwise according to the degree value from highest to lowest. The degree value refers to the number of edges directly connected to the node, reflecting the connectivity and importance of the node within the network, which helps to identify central nodes, key nodes, and network structure characteristics.
Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes(KEGG) enrichment analysis of hub genes
To elucidate the functions of the common target genes in biological processes, we imported the hub target genes into the Metascape [21] database (https://metascape.org/), selecting H. sapiens as the species, to perform GO analysis and KEGG enrichment analysis. The analysis report was downloaded and visualized using the Microbioinformatics website (http://www.bioinformatics.com.cn/).
Molecular docking
The core ligand structure file (SDF format) was retrieved from PubChem [14] database (https://pubchem.ncbi.nlm.nih.gov), and then converted into a PDB file using PyMol version 2.5.5 (https://pymol.org/2/). The 3D crystal structure of the target gene was obtained from the PDB database (https://www.rcsb.org), then imported into PyMOL software and subjected to ligand separation. The ligand and the receptor were both imported into AutoDock4 software for dehydration, hydrogenation, and charge calculation processes, and then saved as a pdbqt format in preparation for molecular docking. Finally, molecular docking analysis was performed with AutoDock4,and the visualization of the molecular docking and its interactions was displayed in PyMOL.
Cellular experimental validation
Cell viability assay
The Cell Counting Kit 8 (CCK-8,Beyotime, Shanghai, China) was used to examine the proliferation of RAW264.7 cells, RAW264.7 cells in the logarithmic growth phase were seeded at a density of 5 × 104 cells/mL in a 96-well plate and incubated for 24 h, Then, the supernatant was discarded. Subsequently, 100µL of culture medium containing TDX105 (0, 25, 50, 100, 200, 400, or 800 µg/mL) and Lipopolysaccharide(LPS, Sigma-Aldrich, Shanghai, China)(0.312, 0.625, 1.25, 2.5, 5, or 10 µg/mL) was added. After incubating for 24 h, 10 µL of CCK-8 solution was added to each well, and the cells were incubated for an additional 4 hours. The absorbance at a wavelength of 450 nm was measured using a microplate reader, and the cell viability was calculated.
Determination of the levels of NO, IL-6, and TNF-α in cell supernatants by the Griess method and ELISA
To elucidate the effect of TDX105 on inflammatory factors, RAW264.7 cells in the logarithmic growth phase were seeded at a density of 2 × 106 cells/mL in a 24-well plate. The cells were divided into a normal group, a control group (LPS), and TDX105 treatment groups (low, medium, and high doses). After incubating for 24 h, the supernatant was discarded. The cells were then treated with TDX105 at low, medium, and high doses (25, 50, and 100 µg/mL, respectively) for an additional 24 h. Following this, the cells were induced with a medium containing 100 ng/mL LPS for 4 h. After the experiment, the supernatants from each group were collected and monitored for Nitric oxide (NO), IL-6 and TNF-α cytokine production, and adherent cells were detected for relative RNA and protein expression.The concentration of NO was measured using the Griess reaction(Applygen, Beijing, China), while the concentrations of IL-6 and TNF-α were determined using the enzyme-linked immunosorbent assay (ELISA)(Elabscience Biotechnology Co.,Ltd.,Hubei, China).
Detection of NF-κB transcriptional activity using a luciferase reporter gene assay
HEK293T cells in the logarithmic growth phase were seeded at a density of 3 × 105 cells per well in a 6-well plate. After 24 h of incubation, Lipofectamine 2000(Thermo Fisher Scientific, Massachusetts, USA) was used to transfect the cells with a luciferase reporter plasmid containing NF-κB response elements. The cells were then incubated at 37 °C with 5% CO₂ for 24 h, followed by trypsinization and centrifugation. The cells were resuspended in medium and transferred to a 96-well plate according to the desired experimental groups. Subsequently, cells were stimulated with 50 ng/ml TNFα and co-treated with varying concentrations of TDX105 (25, 50, 100, 200, 400, and 600 µg/ml).Experimental groups included: the Vector group (transfected with empty vector), the OE-NF-κB group (transfected with NF-κB overexpression plasmid), and the OE-NF-κB + TDX105 group (transfected with NF-κB overexpression plasmid and treated with TDX105). After continuing incubation for another 24 h, the cells were collected and lysed. A 50 µL aliquot of the lysate was mixed with an equal volume of luciferase substrate(TransDetect Single-Luciferase Reporter Assay Kit, TransGen Biotech, Beijing, China), and the luminescence was immediately measured using a microplate reader. Based on the measured data, the inhibition rate and half - maximal inhibitory concentration (IC50) were calculated.
Quantitative RT-qPCR analysis
After cultivating and treating the cells according to the method described in section “1.3.2,” the cells were washed three times with PBS and then collected. Total RNA was extracted using TRIzol® reagen(Thermo Fisher Scientific, Massachusetts, USA), and subsequently reverse transcribed into cDNA according to the manufacturer’s protocol(TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix, TransGen Biotech, Beijing, China). The resulting cDNA was analyzed by qRT-PCR using Taq Pro Universal SYBR® qPCR Master Mix(Vazyme Biotech Co.,Ltd, Nanjing, China)with the following cycling parameters: 95 °C for 30 s for initial denaturation, followed by 40 cycles of 95 °C for 3–10 s and 60 °C for 10–30 s; then a melt curve analysis was performed at 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s for a total of 45 cycles. The primers were provided by Sangon Biotech (Shanghai, China). β-Actin was used as the reference gene to calculate relative expression of target genes as 2−△△CT values. The primer sequences for the target genes are listed in Table 1.
Table 1.
Sequences of primers for Real-time PCR
| Primer | Forward primer 5’−3’ | Reverse primer 5’−3’ |
|---|---|---|
| β-actin | ACTCTTCCAGCCTTCCTTC | ATCTCCTTCTGCATCCTGTC |
| TNFα | CCAGACCCTCACACTCACAAA | TAGACAAGGTACAACCCATCG |
| IL1β | GCAGGCAGTATCACTCATTGT | GGCTTTTTTGTTGTTCATCTC |
| IL6 | AGACTTCCATCCAGTTGCCTT | TTCTCATTTCCACGATTTCCC |
| NLRP3 | TCGTCACCATGGGTTCTGGTC | TCCTGAGCCATGGAAGAAAAGT |
Western blot
RAW264.7 cells were seeded in 12-well plates at a density of 2 × 105 cells/well. After culturing and treatment as described in section “1.3.2”, 100µL of RIPA lysis buffer(Applygen, Beijing, China) supplemented with protease and phosphatase inhibitors(MeilunBio, Dalian, China) was added to each well. Protein concentration was measured using the BCA assay(Applygen, Beijing, China). Samples were diluted with lysis buffer, mixed with 5× loading buffer, and denatured at 95 °C for 10 min.Denatured proteins were separated by 10% SDS-PAGE and transferred to polyvinylidene diflu-oride membrane(merck millipore, Germany). The membrane was blocked with 5% non-fat milk(Applygen, Beijing, China) for 1 h at room temperature and subsequently incubated overnight at 4 °C with specific primary antibodies (1:1,000 dilution, HSP90,COX-2,NF-κB p65,p-NF-κB p65,ERK, p-ERK: Cell Signaling Technology, Boston, USA.NLRP3:Novus Biologicals, Centennial, Colorado, USA). The next day, primary antibodies were recovered, after incubation with HRP-conjugated secondary antibodies(Applygen, Beijing, China) at room temperature for 1 h, chemiluminescent detection was performed by applying an equal-volume mixture of ECL Solution A and B, uniformly covering the membrane surface. heat shock protein 90(HSP90) served as the internal reference. Band intensities were quantified using ImageJ software to calculate the grayscale values of target proteins.
Statistical analysis
Statistical analyses were performed using GraphPad Prism 9.5 software (GraphPad Software, La Jolla, CA). The results are shown as mean ± standard deviation. A t-test was adopted for comparisons between two groups, while one-way analysis of variance (ANOVA) was used to compare the means of mul-tiple groups. P < 0.05 was considered statistically significant.
Results
Network pharmacology results
Screening for potential active components of TCM compound TDX105
Overall, following the screening criteria, 73 potential active ingredients were identified from the five Chinese medicinal herbs in the compound using the TCMSP database (Table 2 and Table S2). These were ranked according to their OB, from highest to lowest: 7 components from Chuanxiong (Ligusticum chuanxiong), 22 from Honghua(Carthamus tinctorius), 7 from Lao Guan Cao (Geranium wilfordii), 11 from Mudanpi(Moutan cortex), and 36 from Huang Bo (Phellodendron amurense). Target predictions were conducted for each active ingredient and summarized, resulting in a total of 973 potential targets for the active components in the compound.
Table 2.
The top ten active components of TDX105
| Mol ID | ingredient | medicine | OB (%) | DL |
|---|---|---|---|---|
| MOL000433 | FA | chuanxiong | 68.96 | 0.71 |
| MOL001925 | paeoniflorin_qt | mudanpi | 68.18 | 0.4 |
| MOL007369 | 4-O-methylpaeoniflorin_qt | mudanpi | 67.24 | 0.43 |
| MOL002140 | Perlolyrine | chuanxiong | 65.95 | 0.27 |
| MOL007384 | paeonidanin_qt | mudanpi | 65.31 | 0.35 |
| MOL000785 | palmatine | huangbo | 64.6 | 0.65 |
| MOL000622 | Magnograndiolide | huangbo | 63.71 | 0.19 |
| MOL002712 | 6-Hydroxykaempferol | honghua | 62.13 | 0.27 |
| MOL002680 | Flavoxanthin | honghua | 60.41 | 0.56 |
| MOL000787 | Fumarine | huangbo | 59.26 | 0.83 |
Construction of target network for TCM compound TDX105 and RD
A total of 1,507 target genes related to disease were obtained from disease databases such as Genecards and DisGeNET. These genes were intersected with the TCM compound’s target genes using Venn diagram tools, yielding 289 common target genes between the disease and the compound (Fig. 2A). A component-target-disease network was then constructed (Fig. 2B) and analyzed using Cytoscape 3.10.0 software. The top ten active components with the highest degree values were selected as the major active ingredients of Compound TDX105: quercetin, kaempferol, luteolin, β-sitosterol, perlolyrine, phellochin, baicalein, cavidine, palmatine, and fumarine (Table 3).
Fig. 2.
(A).Venn diagram of common target genes between disease and drug; (B).Network diagram of component-target-disease
Table 3.
Major active components in the TDX105 for the treatment of RD
| Compound code | MOLID | Active component | Degree value |
|---|---|---|---|
| A1 | MOL000098 | quercetin | 164 |
| C1 | MOL000422 | kaempferol | 123 |
| E1 | MOL000006 | luteolin | 84 |
| D1 | MOL000359 | sitosterol | 54 |
| CX3 | MOL002140 | perlolyrine | 53 |
| HB34 | MOL006413 | phellochin | 53 |
| HH8 | MOL002714 | baicalein | 50 |
| HB16 | MOL002670 | cavidine | 49 |
| HB23 | MOL000785 | palmatine | 48 |
| HB24 | MOL000787 | fumarine | 48 |
Establishment and analysis of the PPI network for target genes
The 289 common target genes were imported into Cytoscape 3.10.0 for analysis, arranged in a clockwise manner based on their degree values from highest to lowest, to construct a protein-protein interaction (PPI) network diagram (Fig. 3A). Subsequently, the top 20 targets with the highest degree values were selected to build the PPI interaction network diagram (Fig. 3B). The top ten ranked target genes were PIK3R1, PIK3CA, SRC, PIK3CB, PIK3CD, PIK3R2, PIK3R3, GRB2, AKT1, and TP53 (Table 4). The results indicated that these genes play pivotal roles in the common targets interaction network and may serve as core targets for the TCM TDX105 in treating RD.
Fig. 3.
(A).PPI network diagram of 289 common genes; (B)PPI interaction network diagram of top 20 target genes
Table 4.
The top 10 target genes with the highest degree values
| Target gene | Degree value |
|---|---|
| PIK3R1 | 182.0 |
| PIK3CA | 180.0 |
| SRC | 176.0 |
| PIK3CB | 164.0 |
| PIK3CD | 162.0 |
| PIK3R2 | 162.0 |
| PIK3R3 | 160.0 |
| GRB2 | 140.0 |
| AKT1 | 128.0 |
| TP53 | 120.0 |
GO terms and KEGG pathway analysis of common target genes
GO analysis and KEGG pathway enrichment analysis were performed using the Metascape database for deep understanding of the common target genes.After the GO functional enrichment analysis, the top 10 entries with the highest comprehensive evaluations in three categories - biological process (BP), cellular component (CC), and molecular function (MF) - were selected. A total of 30 entries were obtained for analysis. The results indicated that these common targets were mainly involved in biological processes such as positive regulation of phosphorus metabolic processes, phosphorylation and inflammatory response, and regulation of the inflammatory response. The cellular components included the cell membrane and nuclear region, etc. The molecular functions included protein kinase activity and phosphotransferase activity, etc. The results are shown in Fig. 4A. The KEGG pathway analysis yielded a total of 219 signaling pathways, most of which are closely related to inflammatory processes. The results suggested that the anti - inflammatory effect of the TCM compound TDX105 was mainly associated with signaling pathways such as EGFR tyrosine kinase inhibitor resistance, MAPK signaling pathway, PI3K - AKT(phosphatidylinositol 3-kinase-AKT) signaling pathway, and NF - κB signaling pathway (Fig. 4B).
Fig. 4.
(A).GO enrichment analysis of common targets. The top ten significantly enriched terms in BP, CC, and MF categories; (B). The top 20 KEGG pathways identified by enrichment analysis of potential target genes
Verification and visualization of the molecular docking results
To confirm the findings of the network pharmacology analysis, we used the molecular docking software AutoDock4 to investigate how the screened molecular compound ligands interact with the core target proteins. We conducted molecular docking for the top 5 active components with the highest degree values in Table 3, the top 5 target genes in Table 4, as well as inflammation-related molecules (TNFα, IL-6, IL-1β, COX-2, NLRP3, Phosphorylated Extracellular Signal-Regulated Kinase: p-ERK) respectively. Generally, it is considered that the smaller the binding energy, the better the binding activity (Table 5). Finally, the molecular docking process between the compounds and the target proteins was visualized using PyMOL software. The active components could bind to the core target proteins through hydrogen bond forces, forming a stable conformation (Fig. 5).
Table 5.
Molecular docking binding energies
| Binding energy/(kcal/mol) | quercetin | kaempferol | luteolin | sitosterol | perlolyrine |
|---|---|---|---|---|---|
| PIK3R1 | −4.63 | −5.62 | −5.49 | −7.11 | −6.39 |
| PIK3CA | −0.65 | −3.33 | −4.16 | −3.99 | −3.79 |
| SRC | −4.23 | −3.88 | −3.46 | −4.11 | −4.79 |
| PIK3CB | −2.28 | −2.44 | −3.89 | −5.27 | −4.57 |
| PIK3CD | −2.99 | −2.26 | −3.38 | −3.35 | −2.57 |
| TNFa | −1.78 | −2.16 | −3.05 | −2.66 | −3.84 |
| IL6 | −1.85 | −2.57 | −2.86 | −3.81 | −4.13 |
| IL1β | −3.02 | −2.26 | −2.64 | −2.02 | −3.61 |
| COX2 | −2.23 | −2.42 | −3.52 | −4.14 | −4.83 |
| NLRP3 | −3.18 | −3.47 | −4.27 | −4.64 | −5.21 |
| p-ERK | −2.81 | −3.69 | −3.43 | −4.92 | −3.68 |
Fig. 5.
Visualization diagram of molecular docking between active components and target proteins(The yellow dashed lines represent hydrogen bonds)
Results of the cell experiment
The effects of TCM TDX105 and LPS on the viability of RAW264.7 cells
As shown in Fig. 6, TDX105 at concentrations below 800 µg/mL does not adversely affect the viability of RAW264.7 cells and may even promote their proliferation(Fig. 6 A). Therefore, the concentrations chosen for subsequent experiments (25, 50, and 100 µg/mL) are within a safe range. Similarly, LPS at various concentrations did not inhibit RAW264.7 cell viability(Fig. 6B). The dose selected for further experiments was 100 ng/mL, which is also within a safe range.
Fig. 6.
(A)Effects of TDX105 on the viability of RAW264.7 cells;(B)Effects of LPS on the viability of RAW264.7 cells. Compared with the normal group, *P < 0.05; **P < 0.01;***P < 0.001
The effects of TDX105 on the levels of NO, IL-6, and TNF-α in the supernatants of LPS-induced RAW264.7 cells
As shown in Fig. 7, compared with the normal group, the levels of NO, IL-6, and TNF-α in the cell supernatant of the model group were significantly elevated (P < 0.001). In contrast, after intervention with different concentrations of TDX105 (25, 50, and 100 µg/ml), the levels of NO(Fig. 7 A), IL-6(Fig. 7B), and TNF-α (Fig. 7 C)were significantly reduced compared with the model group (P < 0.05), indicating that TDX105 can markedly inhibit the levels of inflammatory factors in LPS-induced RAW264.7 cells.
Fig. 7.
(A).Expression levels of NO in the supernatant of cells in Each Group; (B).Expression levels of IL-6 in the supernatant of cells in Each Group; (C).Expression levels of TNF-α in the supernatant of cells in Each Group. Compared with the normal group, ###P < 0.001; compared with the model group, *P < 0.05; **P < 0.01;***P < 0.001
The effects of TCM TDX105 on TNF-α-induced NF-κB transcriptional activity
The results of the luciferase reporter gene assay, as shown in Fig. 8, indicated that the TCM TDX105 exhibits a dose-dependent inhibitory effect on NF-κB. Using a nonlinear regression model to fit the dose-response curve, the half maximal inhibitory concentration (IC50) of TDX105 for NF-κB was calculated to be 129.8 µg/ml. This suggested that the compound effectively antagonizes the NF-κB signaling pathway.
Fig. 8.

IC50 Curve Diagram of the Inhibitory Rate of TCM TDX105 on NF-κB Transcriptional Activity
The effects of TCM TDX105 on mRNA expression of iNOS, NLRP3, IL-6, TNF-α, and IL-1β in LPS-induced RAW264.7 cells
As shown in Fig. 9, compared with the normal group, the mRNA expression levels of TNF-α(Fig. 9 A), IL-6(Fig. 9B), IL-1β(Fig. 9 C)and NLRP3(Fig. 9D) in the model group were significantly upregulated. In contrast, after intervention with different doses of TDX105, the levels of TNF-α,IL-6,IL-1βand NLRP3 were significantly downregulated compared with the model group (P < 0.05), indicating that TDX105 can significantly inhibit the mRNA expression of inflammation-related factors in LPS-induced RAW264.7 cells.
Fig. 9.
(A). Relative expression levels of TNF-α mRNA in each group; (B). Relative expression levels of IL-6 mRNA in each group; (C). Relative expression levels of IL-1β mRNA in each group; (D). Relative expression levels of NLRP3 mRNA in each group. Compared with the normal group, #P < 0.05;##P < 0.01;###P < 0.001; compared with the model group, *P < 0.05;**P < 0.01;***P < 0.001
The effects of TCM TDX105 on expression of proteins related to NF-κB and MAPK signaling pathways in LPS-induced RAW264.7 cells
As shown in Fig. 10, after LPS induction, compared with the normal group, the protein expression levels of NLRP3 and COX-2 in the model group were significantly upregulated (P < 0.001), and the ratios of phosphorylated NF-κB (p-NF-κB) to total NF-κB (NF-κB) and phosphorylated ERK (p-ERK) to total ERK (ERK) were also markedly elevated (P < 0.01). In contrast, after intervention with TCM TDX105, the expression levels of these proteins were significantly downregulated compared with the model group (P < 0.05). These results indicated that TDX105 can exert anti-inflammatory effects by inhibiting proteins related to the NF-κB and MAPK signaling pathways.
Fig. 10.
Effects of TCM TDX105(0, 25 and 50μg·mL−1) on expression of key proteins in LPS-induced RAW264.7 cells.HSP90 was used as an internal control.(A,D).Representative images of protein bands;(B-F). The relative expression of p-ERK,p-NF-κB,NLRP3 and COX-2 protein were visualized by statistical diagrams. Compared with the normal group, #P < 0.05;##P < 0.01;###P < 0.001; compared with the model group, *P < 0.05;**P < 0.01;***P < 0.001
Discussion
Radiation Dermatitis is a common side effect in cancer patients following radiotherapy. Despite significant advancements in the application of ionizing radiation, radiation-induced skin damage during radiotherapy for certain solid tumors continues to pose a substantial clinical challenge [1]. The TCM TDX105 has demonstrated remarkable clinical efficacy in treating RD [8]; however, the specific pharmacological mechanisms underlying its effects remain unclear. Therefore, this study aims to conduct a preliminary exploration and validation of the therapeutic mechanisms of TDX105 through network pharmacology and in vitro cell experiments.
In this study, network pharmacology analysis was first employed to screen 73 potential active components from the compound. Subsequently, potential targets of these active components were predicted, and 289 common genes were obtained by intersecting with disease-related targets. Through PPI analysis and enrichment analysis, core targets were screened and prioritized. Results from GO and KEGG analyses further suggested that the pharmacological effects of the TDX105 are closely associated with inflammatory processes and may involve signaling pathways such as MAPK, PI3K-AKT, and NF-κB. Finally, molecular docking of key active components with potential targets revealed favorable binding abilities, indicating strong interactions between them.
Current studies have indicated that ionizing radiation induces the generation of reactive oxygen species (ROS), which activates the IKK kinase complex through oxidative stress. This process promotes the phosphorylation and degradation of IκBα, leading to nuclear translocation of the NF-κB heterodimer (p65/p50) to amplify inflammatory responses. Alternatively, NF-κB can be activated via Toll-like receptors (TLRs) or cytokine receptors (such as IL-1R, TNF-R), thereby inducing skin damage [22]. Ionizing radiation also causes mitochondrial damage and ROS production, thereby triggering the activation of the NLRP3 inflammasome and releasing multiple inflammatory mediators [23]. These events not only exacerbate inflammation but also activate apoptotic pathways, accelerating tissue damage [24].The MAPK family—including p38 MAPK, c-Jun N-terminal kinase (JNK), and extracellular signal-regulated kinase (ERK)—modulates inflammation and cellular stress response through phosphorylation cascades. Additionally, MAPK can enhance NF-κB transcriptional activity by phosphorylating IκBα or directly facilitating the nuclear translocation of NF-κB subunits [25]. Specifically, phosphorylated ERK (p-ERK) activates downstream transcription factors (e.g., NF-κB, Activator Protein 1) to upregulate pro-inflammatory cytokine expression. Moreover, NF-κB-induced proinflammatory factors (such as TNF-α and IL-6) can further activate the MAPK pathway, forming a positive feedback loop that amplifies inflammatory responses [26].
NF-κB/MAPK-driven chemokines (e.g., CCL27) recruit neutrophils and macrophages to irradiated tissues, which release proteases and ROS, exacerbating extracellular matrix degradation and tissue damage [1]. Meanwhile, dysregulation of the MAPK pathway suppresses the proliferation of epidermal stem cells and impairs re-epithelialization, thereby delaying skin barrier recovery [27]. Additionally, studies have found that inflammatory mediators generated during these processes may collectively participate in the activation of the NLRP3 inflammasome, amplifying the inflammatory cascade and leading to pyroptosis and disruption of the epidermal barrier [28].
In this study, employing a classical inflammatory model of LPS-induced RAW264.7 cells [29], Our findings revealed that the TCM TDX105 significantly suppressed the production of inflammatory factors NO, IL-6, and TNF-α.At the transcriptional level, TDX105 downregulated mRNA expression of TNF-α, IL-6, IL-1β, and NLRP3,preliminarily verifying its anti-inflammatory effects.Furthermore, luciferase reporter gene assays demonstrated that TDX105 inhibited NF-κB transcriptional activity. Western blot analysis corroborated that TDX105 reversed the significant upregulation of p-NF-κB, p-ERK, NLRP3, and COX-2 proteins induced by LPS. Combined with results from network pharmacology enrichment analysis, these findings suggest that TDX105 exerts its therapeutic effects by modulating inflammatory factors associated with the NF-κB and MAPK signaling pathways, thereby controlling and alleviating inflammation to treat skin damage.
Conclusion
Taken together, this study integrated network pharmacology and in vitro cell experiments to explore the anti-inflammatory mechanism of TDX105 in treating RD. The findings indicated that TDX105 may exert its anti-inflammatory effects by suppressing the activation of MAPK and NF-κB signaling pathways, downregulating mRNA expression of NLRP3, COX-2, IL-6, TNF-α, and IL-1β, and decreasing the production of NO, IL-6, and TNF-α. These results provided a theoretical and experimental basis for further investigating the application of TDX105 in treating inflammation-related skin diseases and for in-depth studies of its underlying pharmacological mechanisms.
Supplementary Information
Acknowledgements
We are very thankful to the manufacturer (China Resources Sanjiu Medical & Pharmaceutical Co., Ltd.) of TCM TDX105 and thank all laboratory members for their constructive discussions.
Abbreviations
- RD
Radiation Dermatitis
- TCM
Traditional Chinese Medicine
- NF-κB
nuclear factor kappa-light-chain-enhancer of activated B cells
- MAPK
Mitogen-activated Protein Kinase
- IL-1
interleukin-1
- IL-6
interleukin-6
- TNF-α
tumor necrosis factor-α
- COX-2
Cyclooxygenase-2
- PGE2
prostaglandin E2
- TCMSP
Traditional Chinese Medicine Systems Phar-macology
- PPI
Protein - Protein Interaction
- NO
Nitric Oxide
- NLRP3
NLR Family Pyrin Domain-containing 3
- HSP90
Heat Shock Protein 90
- OB
Oralbioavailability
- DL
Drug Likeness
- PI3K - AKT
phosphatidylinositol 3-kinase-AKT
- LPS
Lipopolysaccharide
- ROS
Reactive Oxygen Species
- JNK
c-Jun N-terminal kinase
- CCL27
C-C Chemokine Ligand 27
- AP-1
Activator Protein 1
- GO
Gene Ontology
- KEGG
Kyoto Encyclopedia of Genes and Genomes
- BP
Biological Process
- MF
Molecular Function
- CC
Cellularcomponent
- ERK
Extracellular Signal-Regulated Kinase
Authors’ contributions
Hui Cao and Shuainan Liu designed the study; Shuang Yu and Kejia Xu performed the acquisition and analysis of data; Xinrui Hu and Yi Huan performed the interpretation of data; Min Wu and Yuting Ma provided experimental technical guidance; Cunyu Feng and Ning Du helped manage and organize the data; Xinqi Liu assisted in developing detailed experimental protocols; Shuang Yu and Kejia Xu drafted the work and Aiping Tian substantively revised it; all authors reviewed the manuscript.
Funding
This work was supported by the Chinese Academy of Medical Sciences (CAMS) Innovation Fund for Medical Sciences (CIFMS) Project(No.2021-I2M-C&T-B-071) and Non-profit Central Research Institute Fund of Chinese Academy of Medical Sciences Project(No.2021-JKCS-011).
Data availability
Data sharing is not applicable to this article as no datasets were generated or analysed during the current study.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Shuang Yu and Kejia Xu are co-first authors and contributed equally to this work.
References
- 1.Rübe CE, Freyter BM, Tewary G, Roemer K, Hecht M, Rübe C. Radiation Dermatitis: Radiation-Induced Effects on the Structural and Immunological Barrier Function of the Epidermis. Int J Mol Sci. 2024;25(6):3320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Cui J, Wang TJ, Zhang YX, She LZ, Zhao YC. Molecular biological mechanisms of radiotherapy-induced skin injury occurrence and treatment. Biomed Pharmacother. 2024;180:117470. [DOI] [PubMed] [Google Scholar]
- 3.Behroozian T, Bonomo P, Patel P, et al. Multinational association of supportive care in cancer (MASCC) clinical practice guidelines for the prevention and management of acute radiation dermatitis: international Delphi consensus-based recommendations. Lancet Oncol. 2023;24(4):e172-e185. [DOI] [PubMed] [Google Scholar]
- 4.Kalekhan F, Kudva AK, Raghu SV, et al. Traditionally used natural products in preventing ionizing Radiation-Induced[J]. Anticancer Agents Med Chem. 2022;22(1):64–82. [DOI] [PubMed] [Google Scholar]
- 5.Borrelli MR, Shen AH, Lee GK, Momeni A, Longaker MT, Wan DC. Radiation-induced skin fibrosis: pathogenesis, current treatment options, and emerging therapeutics. Ann Plast Surg. 2019;83(4S Suppl 1):S59–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Geng F, Chen J, Song B, et al. Chaperone- and PTM-mediated activation of IRF1 tames radiation-induced cell death and the inflammatory response. Cell Mol Immunol. 2024;21(8):856–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Kim JH, Kolozsvary AJJ, Jenrow KA, Brown SL. Mechanisms of radiation-induced skin injury and implications for future clinical trials. Int J Radiat Biol. 2013;89(5):311–8. [DOI] [PubMed] [Google Scholar]
- 8.Zhang Y, Zhao Y, Yi J, Tian PA. Clinical efficacy on severe acute radiation dermatitis treated by topical compound Danxiong granules in patients receiving radiation: a prospective randomized trial. Int J Radiat Oncol Biol Phys. 2022;114(3, Supplement):S17–8. [Google Scholar]
- 9.Zhang P, Zhang D, Zhou W, et al. Network pharmacology: towards the artificial intelligence-based precision traditional Chinese medicine[J]. Brief Bioinform. 2023;25(1):bbad518. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Wang X, Wang ZY, Zheng JH, Li S. TCM network pharmacology: A new trend towards combining computational, experimental and clinical approaches[J]. Chin J Nat Med. 2021;19(1):1–11. [DOI] [PubMed] [Google Scholar]
- 11.Paggi JM, Pandit A, Dror RO. The Art and science of molecular Docking[J]. Annu Rev Biochem. 2024;93(1):389–410. [DOI] [PubMed] [Google Scholar]
- 12.Xinyi J, Xin J, Yuanyuan M, A comprehensive application: molecular Docking and network Pharmacology for the prediction of bioactive constituents and Elucidation of mechanisms of action in component-based Chinese medicine[J]. Comput Biol Chem. 2021;90:107402. 10.1016/j.compbiolchem.2020.107402 [DOI] [PubMed]
- 13.Ru J, Li P, Wang J, et al. TCMSP: a database of systems Pharmacology for drug discovery from herbal medicines[J]. J Cheminform. 2014;6:13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kim S, Chen J, Cheng T, et al. PubChem 2023 update[J]. Nucleic Acids Res. 2023;51(D1):D1373–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Wang X, Shen Y, Wang S, et al. PharmMapper 2017 update: a web server for potential drug target identification with a comprehensive target pharmacophore database[J]. Nucleic Acids Res. 2017;45(W1):W356–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.UniProt Consortium. UniProt: the universal protein knowledgebase in 2023[J]. Nucleic Acids Res. 2023;51(D1):D523–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Piñero J, Queralt-Rosinach N, Bravo À, et al. DisGeNET: a discovery platform for the dynamical exploration of human diseases and their genes[J]. Database (Oxford). 2015;2015:bav028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Stelzer G, Rosen N, Plaschkes I, et al. The genecards suite: from gene data mining to disease genome sequence Analyses[J]. Curr Protocols Bioinf. 2016;54:1.30.1–1.30.33. 10.1002/cpbi.5 [DOI] [PubMed]
- 19.Otasek D, Morris JH, Bouças J, Pico AR, Demchak B. Cytoscape automation: empowering workflow-based network analysis. Genome Biol. 2019;20(1):185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Szklarczyk D, Kirsch R, Koutrouli M, et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023;51(D1):D638–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zhou Y, Zhou B, Pache L, et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun. 2019;10(1):1523. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Salminen A, Kaarniranta K, Kauppinen A. Photoaging: UV radiation-induced inflammation and immunosuppression accelerate the aging process in the skin. Inflamm Res. 2022;71(7–8):817–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Jembrek MJ. Inhibition of oxidative stress and related signaling pathways in neuroprotection. Antioxidants. 2024;13(9):1033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zhao S, Chen F, Yin Q, Wang D, Han W, Zhang Y. Reactive oxygen species interact with NLRP3 inflammasomes and are involved in the inflammation of sepsis: from mechanism to treatment of progression. Front Physiol. 2020;11:571810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Xue R, Xie M, Wu Z, et al. Mesenchymal stem cell-derived exosomes promote recovery of the facial nerve injury through regulating macrophage M1 and M2 polarization by targeting the P38 MAPK/NF-Κb pathway. Aging Dis. 2024;15(2):851–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yan Z, Dai J, Wang J, et al. RNF167-mediated ubiquitination of Tollip inhibits TNF-α-triggered NF-κB and MAPK activation. FASEB J. 2023;37(8):e23089. [DOI] [PubMed] [Google Scholar]
- 27.Jia H, Mo W, Hong M, et al. Interferon-α inducible protein 6 (IFI6) confers protection against ionizing radiation in skin cells. J Dermatol Sci. 2020;100(2):139–47. [DOI] [PubMed] [Google Scholar]
- 28.Li Z, Chi H, Zhu W, et al. Cadmium induces renal inflammation by activating the NLRP3 inflammasome through ROS/MAPK/NF-κB pathway in vitro and in vivo. Arch Toxicol. 2021;95(11):3497–513. [DOI] [PubMed] [Google Scholar]
- 29.Hong H, Lou S, Zheng F, et al. Hydnocarpin D attenuates lipopolysaccharide-induced acute lung injury via MAPK/NF-κB and Keap1/Nrf2/HO-1 pathway. Phytomedicine. 2022;101:154143. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data sharing is not applicable to this article as no datasets were generated or analysed during the current study.









