Skip to main content
BMC Complementary Medicine and Therapies logoLink to BMC Complementary Medicine and Therapies
. 2025 Nov 22;26:1. doi: 10.1186/s12906-025-05177-2

QuYuShengXin formula reshapes bile-acid-mediated macrophage polarization in the treatment of ulcerative colitis

Jiachun Ni 1,#, Yuchang Lu 1,#, Jiaying Tan 1, Jiaqi Jiang 1, Yunyun Wang 2, Dan Gan 1, Can Cui 1, Jiong Wu 1, Haojie Yang 1,, Zhenyi Wang 1,
PMCID: PMC12764075  PMID: 41275228

Abstract

Background

QuYuShengXin Formula (QYSX), a multi-herbal preparation, has previously demonstrated robust clinical efficacy against ulcerative colitis (UC), with preliminary evidence suggesting that QYSX could reconfigure the fecal bile acid BA landscape and restore the M2/M1 macrophage balance, but their interaction remains unknown. We therefore dissected the therapeutic footprint of QYSX in a dextran sulfate sodium (DSS)-induced mice model of UC, focusing on its specific mechanism of regulating BA metabolism and macrophage polarization.

Methods

DSS-induced mice received QYSX or mesalazine for comparative efficacy. Disease activity index (DAI), body-weight trajectory and stool consistency were monitored daily. Colonic histopathology was graded after H&E staining. Liquid chromatography-mass spectrometry, enzyme-linked immunosorbent assay, flow cytometry, western blot and real-time quantitative PCR were conducted to evaluate the possible mechanism of QYSX.

Results

QYSX markedly attenuated he symptoms and colonic pathology of UC. It simultaneously downregulated IL-1β, IL-6, TNF-α, LPS and NF-κB p65, while elevating TGR5 expression. DSS-elicited disruption of the fecal BAs structure and concentration were largely reversed by QYSX. Flow-cytometric profiling revealed a decreased expression of M1 macrophages without alteration of M2 macrophages, yielding a rise in the M2/M1 ratio.

Conclusion

By re-instating the physiologic fecal BA landscape, QYSX engages TGR5 to inhibit NF-κB signaling, thereby suppressing LPS- and TNF-α-driven M1 hyper-activation. This restoration of M2/M1 homeostasis curbs mucosal inflammation and maintains intestinal immune equilibrium, providing a mechanistic rationale for the clinical efficacy of QYSX in UC.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12906-025-05177-2.

Keywords: Ulcerative colitis, Traditional chinese medicine, Bile acid metabolism, Macrophage polarization, Inflammation

Introduction

Ulcerative colitis (UC), a chronic idiopathic inflammatory bowel disease, is histopathologically defined by crypt abscesses, goblet-cell depletion, and ulcerative denudation of the colonic mucosa, and clinically manifests as abdominal pain, bloody diarrhoea, and mucopurulent stool [1]. Epidemiological surveys indicate that its incidence exhibits pronounced geographical heterogeneity, mirroring disparate genetic backgrounds, dietary patterns, and socio-cultural customs: 53–400 per 10⁵ person-years in Europe and North America [24], 3.29 per 10⁵ in Africa [5], and an 1.96–98.96 per 10⁵ person across Asia, which has been on the rise on a year-by-year basis [68]. The relapsing–remitting trajectory of UC imposes formidable physical, psychological, and socioeconomic encumbrances. Between 2007 and 2016 the cumulative direct expenditure for 29,062 newly diagnosed US patients reached US$377 billion, with an annual per-capita cost approximating US$20,000 [9, 10].

Current main pharmacotherapies of UC includes aminosalicylic acid, glucocorticoids and cyclosporine, etc., which achieve symptomatic amelioration through suppression of aberrant immune responses and attenuation of colonic inflammation, yet neither durably halts nor reverses disease progression, and their long-term safety and tolerability profile remains suboptimal [11]. Although biological immunosuppressants exhibit superior efficacy, prohibitive acquisition costs markedly curtail real-world utilisation [11]. Consequently, interest has gravitated toward complementary therapeutic paradigms. Traditional Chinese medicine (TCM), rooted in ancient dialectical philosophy and now integrated into contemporary Chinese health care, employs multi-component herbal formulations that concurrently modulate diverse molecular targets [12]. Accumulating evidence indicates that TCM can effectively mitigate clinical activity and impede UC progression [1315]. QuYuShengXin Formula (QYSX), a multi-herbal preparation, has previously demonstrated favourable clinical outcomes [16]. Our antecedent work revealed that QYSX could normalise body-weight trajectory, attenuate Disease Activity Index (DAI) scores, elongate colon length, and curtail histopathological injury in dextran-sulfate-sodium (DSS)-induced UC mice [17]. Network-pharmacological interrogation pinpointed four key signalling pathways—T-cell receptor, FOXO, JAK-STAT, and mTOR—as putative therapeutic targets that orchestrate immune homeostasis and macrophage polarisation [18]. Pilot metabolomic surveys further disclosed that QYSX substantially reconfigures the fecal bile acid (BA) landscape in DSS-induced UC mice [19]. Additionally, flow-cytometric analyses revealed that QYSX efficiently restored the M2/M1 macrophage balance to a level comparable with that achieved by mesalazine and significantly superior to that observed in model group (see in Supplementary Material S4). However, the synergistic relationship between QYSX, bile acid metabolism and macrophage polarization remains elusive.

Macrorophages are central to the immunopathogenesis of ulcerative colitis (UC). Within the dynamic intestinal milieu, they can be classified into either a classically activated, pro-inflammatory M1 phenotype or an alternatively activated, anti-inflammatory M2 phenotype [2022]. A sustained shift toward M1 predominance disrupts the physiological equilibrium, amplifies mucosal inflammation, and constitutes a key driver of disease chronicity and relapse [2123]. Consequently, therapeutic restoration of the M1/M2 balance is considered a critical strategy for achieving durable control of intestinal inflammation in UC.

Emerging evidence implicates BA metabolism as a pivotal regulator of UC pathogenesis and is linked to the regulation of M2/M1 type macrophage polarization [24, 25]. Quantitative profiling of fecal BAs reveals marked depletions of lithocholic acid (LCA) and deoxycholic acid (DCA) in UC patients, while restoring their physiological concentrations exerts pronounced anti-inflammatory effects and correlates with improved clinical outcomes [2428]. In addition, LCA and DCA have demonstrated capability to inhibit pro-inflammatory cytokine production in human peripheral blood-derived macrophages in vitro through activation of the Takeda G-protein coupled receptor 5 (TGR5) receptor [29] and modulate macrophage polarization [27, 29, 30]. TGR5, a G protein-coupled receptors (GPCRs), is a major receptor involved in BA regulation of macrophage polarization [31]. Studies have proved that the activation of TGR5 increases cAMP levels and inhibits the phosphorylation of IκBα and nuclear translocation of nuclear factor kappa-B (NF-κB) p65 [29, 32, 33], thereby reducing the expression of lipopolysaccharide (LPS), tumor necrosis factor-α (TNF-α), interleukin−1β (IL−1β), and other BA receptors secretion [31, 34]. Among the aforementioned substances, LPS and TNF-α are key drivers for inducing polarization in M1-type macrophages [20, 21]. Meanwhile, the stimulation of the NF-κB signaling pathway could promote M1-type macrophage polarization while inhibiting M2-type macrophage polarization [35, 36]. Consequently, BAs may be capable of regulating NF-κB-mediated macrophage polarization via the activation of TGR5.

We therefore hypothesised that QYSX could alleviate UC by regulating BA metabolism, activating TGR5 to inhibit NF-κB signalling, thus restore M2/M1 homeostasis. This study confirmed the therapeutic effect of QYSX on DSS-induced mice model and elucidated its specific mechanism of regulating BA metabolism and macrophage polarization in DSS-induced mice model.

Materials and methods

Reagent

Dextran sulfate sodium (DSS; MW: 36–50 kDa) was purchased from MP Biochemical(Santa Ana, CA, USA). Mesalazine Enteric-coated Tablets (Salofalk, 5-ASA)were obtained from Losan Pharma GmbH(Neuenburg, Baden-Wurttemberg, Germany). Eosin stain(Cat# BA-4099), Hematoxylin stain(Cat# BA-4097) were purchased from Baco(Zhuhai, Guangdong, China). Xylene(Cat# 100023418) and neutral resinwere(Cat# 10004160) purchased from Sinopharm(Beijing, China). 4% polyoxymethylene(Cat# 131228), bicinchoninic acid(BCA) protein assay kit(Cat# G2026-1000T), alcian blue-periodic acid schiff(AB-PAS) staining kit(Cat# G1049) were purchased from Servicebio(Wuhan, China). CD16/32(Cat# 101320) antibody, fluorescein isothiocyanate(FITC) anti-mouse CD11b antibody(Cat# 101206), phycoerythrin(PE) anti-Mouse F4/80 antibody(Cat# 123110), allophycocyanin(APC) anti-Mouse CD86 antibody(Cat# 105011), peridinin chlorophyll protein complex(PerCP)/Cy5.5 anti-Mouse CD206 antibody(Cat# 141715), cell staining buffer(Cat# 420201) were purchased from Biolegend(Beijing, China). Radio-immunoprecipitation assay(RIPA) buffer(Cat# P0013B), phenylmethanesulfonyl fluoride(PMSF, Cat# ST506), enhanced chemiluminescence(ECL) kit(Cat# P0018S), sodium dodecyl sulfate-polyacrylamide gel electrophoresis(SDS-PAGE) sample buffer(Cat# P0015L) were purchased from Beyotime(Shanghai, China). Prestained protein marker(Cat# P6110L) was purchased from Bioscience(Shanghai, China). 30% (w/v) acrylamide/bis-acrylamide solution(Cat# B546017-0500) and 4×Tris×HCl/SDS, pH6.8/8.8(Cat# B546022-0250) were purchased from Sangon(Shanghai, China). Polyvinylidene fluoride(PVDF) membrane(Cat# IPVH00010) was purchased from Millipore(Burlington, MA, USA). IL-1β antibody(Cat# A16288), IL-6 antibody(Cat# A0286) were purchased from ABclonal(Wuhan, China). NF-κB p65 antibpdy(Cat# 80979-1-RR), TNF-α antibody(Cat# 60291-1-Ig), GAPDH antibody(Cat# 60004-1-Ig) were purchased from Proteintech(Rosemont, IL, USA). TGR5 antibody(Cat# ab72608) was purchased from Abcam(Cambridge, UK). HRP-labeled goat anti-rabbit/mouse IgG(H + L) secondary antibody(Cat# 111-035-003) was purchased from Jackson ImmunoResearch(West Grove, Pennsylvania, USA). Acetonitrile and power SYBR green PCR master mix(Cat# 4367659) were purchased from Themo(Waltham, MA, USA). RNAiso Plus(Cat# 9109) and PrimeScript™ RT master mix(Cat# RR036A) were purchased from TaKaRa(Shimogyo-ku, Kyoto, Japan). Mouse TNF-alpha ELISA kit(Cat# ELK1387-1) and mouse Lipopolysaccharides (LPS) ELISA kit were purchased from ELK Biotechnology(Wuhan, China). Formic acid was obtained from TCI(Chuo-ku, Tokyo, Japan).

Preparation of QYSX

The crude medicinal herbs were purchased from Yueyang Hospital of Integrated Traditional Chinese Medicine(Shanghai, China). Based on the difference in body weight between mice and humans, we calculated the daily drug by dose conversion method and determined the daily gavage volume and duration of drug administration. According to conversion factor W = 9.1, the crude medicinal herbs of Astragalus membranaeus (Fisch.)Bge.(45 g), Radix Pseudostellariae(30 g), Atractylodes macrocephala Koidz(15 g), Rehmannia glutinosa (Gaertn.) Li-bosch(15 g), Kummerowia striata (Thunb.) Schindl(20 g), Euphorbia humifusa Willd(20 g), Prunus persica(L.) Batsch(9 g), Ligusticum chuanxiong Hort.(9 g) were routinely water-decocted and concentrated to a concentration of 2.472 g/ml.

Component analysis of QYSX

The chemical profiles of QYSX were characterized by UHPLC-QE-MS. LC-MS/MS analysis was performed on an UHPLC system (Vanquish, Thermo Fisher Scientific, Waltham, MA, USA) with a Waters UPLC BEH C18 column (1.7 μm 2.1 *100 mm). The flow rate was set at 0.4 mL/min and the sample injection volume was set at 5 µL. The mobile phase consisted of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B). The multi-step linear elution gradient program was as follows: 0–3.5 min, 95 − 85% A; 3.5–6 min, 85 − 70% A; 6–6.5 min, 70–70% A; 6.5–12 min, 70 − 30% A; 12–12.5 min, 30–30% A; 12.5–18 min, 30 − 0% A; 18–25 min, 0–0% A; 25–26 min, 0–95% A; 26–30 min, 95–95% A.

An Orbitrap Exploris 120 mass spectrometer coupled with an Xcalibur software was employed to obtain the MS and MS/MS data based on the IDA acquisition mode. During each acquisition cycle, the mass range was from 100 to 1500, and the top four of every cycle were screened and the corresponding MS/MS data were further acquired. Sheath gas flow rate: 30 Arb, Aux gas flow rate: 10 Arb, Ion Transfer Tube Temp: 350 °C, Vaporizer Temp: 350°C, Full ms resolution: 60,000, MS/MS resolution: 15,000, Collision energy: 16/32/48 in NCE mode, Spray Voltage:5.5 kV (positive) or −4 kV (negative).

Animals and treatment

The SPF male C57BL/6 mice(6 weeks, 20 ± 2 g) were purchased from Slac Animal(Shanghai, China). After arrival, all mice were raised in the animal experimental Center(temperature:23 ~ 25°C, humidity 55%) with regular ventilation, and light exposure. The entire study was approved by the Laboratory Animal Ethics Committee of Yueyang Hospital of Integrated Traditional Chinese Medicine(No. YYLAC-2023-215).

After one week of acclimatization, the mice were randomized into 2 groups: (1) Control group (n = 6); (2) DSS-induced model group (n = 18). The colitis was induced as follows: the mice were given 3% DSS solution ad libitum for 5 consecutive days, then replaced with distilled water for 7 consecutive days, repeated for 3 cycles.

Then, the mice in DSS-induced model group were randomly divided into 3 groups: (1) Model group(n = 6); (2) QYSX group(n = 6); (3) Mesalazine group(n = 6). Mice in the Model group were given gavage with 0.15 ml of normal saline daily. Mice from the QYSX group were given gavage with 0.2 ml of QYSX daily. As for the mesalazine group, we determined the administered dose in mice to be 450 mg/kg by the dose conversion method, based on the criterion that the dose taken during the acute active phase of UC in adults is 3 g/d. Subsequently, mesalazine enteric-coated tablets (0.5 g/tablet) were pulverized, mixed with distilled water at a concentration of 45 mg/ml, and administered to mice daily by gavage. Each group were treated for a total of 14 days.

Daily body weight changes were recorded, with fecal patterns and color were observed for DAI scoring. Blood and feces were collected from mice on day 36 and stored stored at −80°C. After cervical execution on day 36, the abdominal cavity was opened, and the length of the colon was measured from the anus to the beginning of the cecum, then the peritoneal macrophages were taken to detect M1 and M2 macrophages by flow cytometry.

Histological study

After obtaining the colon tissue, it was rinsed with PBS and fixed in 4% PFA fixative for 24 h. After fixation, the tissue was processed to the appropriate size tissue sections and stained with HE and AB-PAS.

ELISA

The blood was taken into a sterile centrifuge tube, left at room temperature for 2 h, then centrifuged at 3000 rpm at 4°C for 15 min to take the supernatant. The levels of TNF-α and LPS were measured following the manufacturer’s instructions.

Flow cytometry

Peritoneal macrophages were extracted using the Ray and Dittel method [37]. Then the cell concentration was filtrated and adjusted to 1 × 107/ml. The specific procedures are as follows: (1) 100 µl of cell suspension was taken from the sample tube to the flow cytometry tube and add 2 µl Anti-Mouse CD11b-FITC, 2 µl Anti-Mouse F4/80-PE, 2 µl Anti-Mouse CD86-APC, 2 µl Anti-Mouse CD206-PerCP/Cy5.5. Shaken to be mixxed, then incubated at room temperature in the dark for 40 min; (2) Centrifuged at 1000 rpm for 5 min, disposing the supernatant; (3) 2 ml Cell Staining Buffer was added into each tube, centrifuged at 1000 rpm for 5 min, disposing the supernatant, and repeating one more time; (4) Each tube was resuspended with 500 µl Cell Staining Buffer and assayed by flow cytometry(BD, New Jersey, USA).

Western blot analysis

Colon tissue was lysed into proteins by RIPA buffer on ice, and protein concentration was determined using the BCA assay. The protein samples were then separated equally by SDS-PAGE and transferred to a PVDF membrane. The membranes were blocked with 5% skimmed milk and incubated with primary antibodies and secondary antibody. Finally, chemiluminescence development was performed, and the results were recorded for further results analysis.

Fluorescence quantitative PCR assay

Total RNA was extracted from colon tissues using RNAiso Plus and reverse transcribed into cDNA using PrimeScript™ RT Master Mix. Quantitative PCR was then performed on a Q2000B system (LongGene, Hangzhou, China) using Power SYBR Green PCR Master Mix. The primer sequences are listed in Table 1.

Table 1.

Primers sequences for qPCR

Gene Primer sequence (5’–3’)
TNF-α-mF CTGAACTTCGGGGTGATCGG
TNF-α-mR GGCTTGTCACTCGAATTTTGAGA
IL−6-mF TAGTCCTTCCTACCCCAATTTCC
IL−6-mR TTGGTCCTTAGCCACTCCTTC
IL−1β-mF TGCCACCTTTTGACAGTGATG
IL−1β-mR TGATGTGCTGCTGCGAGATT
TGR5-mF CTGTTATCGCTCATCTCATTGG
TGR5-mR AATTCAAGTCCAGGTGAATGCT
NF-κB p65-mF GGTATGGCTACTCGAACGACGG
NF-κB p65-mR TTTCCTTCTCAGGGAGAGTCAG
GAPDH-mF GGTGAAGGTCGGTGTGAACG
GAPDH-mR CTCGCTCCTGGAAGATGGTG

GAPDH Glyceraldehyde-3-phosphate dehydrogenase, IL Interleukin, NF Nuclear factor, TGR Takeda G protein-coupled receptor, TNF Tumor necrosis factor

Quantitative measurement of stool BAs

The LC analysis was performed on EXion LC Liquid chromatography (AB SCIEX, MA, USA). Mass spectrometric detection of metabolites was performed on AB6500 Plus (AB SCIEX, MA, USA) to quantify 39 BAs in feces including Deoxycholic acid, dehydrocholic acid, taurodeoxycholic acid sodium salt, taurochenodeoxycholic acid, tauroursodeoxycholic acid, lithocholic acid, chenodeoxycholic acid, ursodeoxycholic acid, cholic acid, glycochenodeoxycholic acid sodium salt, glycodeoxycholic acid sodium salt, sodium glycocholate hydrate, taurocholic acid sodium salt, taurohyodeoxycholic acid sodium salt, ursocholic acid, allocholic acid, glycohyodeoxycholic acid, chenodeoxycholic acid-3-β-D-glucuronide, chenodeoxycholic acid, 24-Acyl-β-D-glucuronide, allolithocholic acid, isolithocholic acid, 23-nordeoxycholic acid, 6-ketolithocholic acid acetate, 12-ketolithocholic acid, 7-ketolithocholic acid, 3β-ursodeoxycholic acid, hyodeoxycholic acid, norcholic acid, 7,12-diketolithocholic acid, 6,7-diketolithocholic acid, α-muricholic acid, β-muricholic acid, 3β-cholic acid, glycolithocholic acid sodium salt, glycoursodeoxycholic acid, lithocholic acid 3-sulfate sodium salt, taurolithocholic acid sodium salt, tauro-α-muricholic acid sodium salt, taurohyocholic acid sodium salt and tauro-β-muricholic acid sodium salt. The specific conditions and procedures for mass spectrometry and liquid chromatography are provided in the Supplementary material S1.

Statistical analysis

One-way ANOVA was used for variables comparison. The least significant difference method was applied to detect the homogeneity of variance. If the variance was found to be heterogeneous, the non-parametric test methods were used instead. Data was expressed as mean ± standard deviation. A significance level of P < 0.05 was used to determine whether the differences were statistically significant. SPSS 26.0 software was used for statistical analysis.

Results

Analysis the composition of QYSX

The identification of QHF constituents was determined by UHPLC-QE-MS. The total ion chromatographs of QYSX were shown in Fig. 1. A total of 686 chemical components were identified, of which 25 were derived from Astragalus membranaeus (Fisch.)Bge., including flavonoids such as Kaempferol and Adenine, and phenylpropionic acids such as trans-Ferulic acid and Chlorogenic Acid. Seven components were derived from Radix Pseudostellariae, including OXOPROLINE, Pyrrole-2-carboxylic acid, etc. Ten components were derived from Atractylodes macrocephala Koidz, including Valine, 3,4, 5-trihydroxystilbene, etc. Sixteen components were derived from Rehmannia glutinosa (Gaertn.) Li-bosch, including Cinnamyl alcohol, L-Phenylalanine, etc. Four components were derived from Kummerowia striata (Thunb.) Schindl, such as Kaempferol and other flavonoids. Ten components were derived from Euphorbia humifusa Willd, such as Quercetin and other flavonoids. Six components were derived from Prunus persica(L.) Batsch, such as Amygdalin, ADENOSINE 3’,5’-CYCLIC MONOPHOSPHATE, etc. Twenty components were derived from Ligusticum chuanxiong Hort., including phenylpropanoids such as trans-Ferulic acid and CAFFEATE, p-mentha-1,3,8-triene,3, 4, 5-trihydroxystilbene, etc. The identification results are shown in Supplementary material S2.

Fig. 1.

Fig. 1

Typical extracted ion chromatograms of the major constituents in QHF. (A) Total ion chromatogram of QYSX detected in the positive ion polarity mode; (B) Total ion chromatogram of QYSX detected in the negative ion polarity mode

QYSX significantly alleviated the symptoms of DSS-induced UC in mice

QYSX’s alleviating effect on colitis symptoms in mice was assessed using the DAI score, including weight loss percentage, stool consistency, and fecal occult blood. The results demonstrated that during the modeling and treatment period, mice in the control group exhibited generally good performance without any abnormal conditions such as diarrhea or bloody stools. In contrast, mice in the Model group experienced a decrease in body weight, lethargy, reduced appetite, poor hair luster, and symptoms including loose stools, bloody purulent stool, which were accompanied by an increase in the DAI score. The mice treated with either the QYSX or mesalazine showed increase in body weight, improved mental status, reduced bowel abnormalities, and a decreased DAI score compared to the Model group (Fig. 2).

Fig. 2.

Fig. 2

Changes of body weight and DAI scores in different groups. A Changes of body weight; B Changes of DAI scores

QYSX ameliorated colonic pathology of DSS-induced UC in mice

To evaluate QYSX’s impact on colon pathology in modeled mice, we conducted AB-PAS and HE staining on colon tissues and compared colon lengths between different group. Compared to the control group, the colon tissue in the Model group exhibited severe pathological alterations, including necrosis and exfoliation of the colonic mucosa in the Model group, with ulcers extending to the muscularis layer. Additionally, the submucosa demonstrated extensive infiltration of diffuse inflammatory cells, and goblet cells showed marked deformation and distortion in the Model group. The results of HE staining indicated that both the QYSX and mesalazine could effectively mitigate colon tissue injury, reduce inflammatory cell infiltration, and lower pathological scores. AB-PAS staining further demonstrated that DSS-induced colitis in mice resulted in a significant reduction in mucosal thickness and goblet cell count; however, treatment with the QYSX and mesalazine significantly alleviated these symptoms (Fig. 3).

Fig. 3.

Fig. 3

Pathological changes of colon tissue in each group (200×). A HE staining results; AB-PAS staining

The comparison of colon length revealed that, compared with the control group, the colon length in the model group was significantly shortened (P < 0.01). Additionally, compared with the model group, the colon length of mice treated with either the QYSX or mesalazine showed a significant increase (P < 0.01) (Fig. 4).

Fig. 4.

Fig. 4

Comparison of colon length. A Colon samples from mice in each group; B colon lengths of mice in each group. Compared with the control group, *P < 0.05, **P < 0.01. Compared with the model group, ##P < 0.01

QYSX balanced the level of inflammatory cytokines and TGR5 of DSS-induced UC in mice

TGR5 serves as a key receptor implicated in the BA-mediated regulation of macrophage polarization. To verify the effect of QYSX on proteins related to BA metabolism, we investigated the expression of relevant proteins and their mRNA.

ELISA results demonstrated that the serum levels of TNF-α and LPS in DSS-induced model mice were significantly increased (P < 0.01), and that QYSX and mesalazine significantly downregulated serum TNF-α and LPS expression levels in model mice (P < 0.01)(Fig. 5).

Fig. 5.

Fig. 5

ELISA analysis of mice serum samples. A The serum TNF-α expression level; B The serum LPS expression level. Compared with the control group, *P < 0.05, **P < 0.01. Compared with the model group, ##P < 0.01

The WB results demonstrated that the expression of IL-1β, IL-6, TNF-α, and NF-κB p65 in the colon of the Model group were significantly upregulated (P < 0.05 or P < 0.01), while the expression of TGR5 was markedly downregulated (P < 0.01). Both QYSX and mesalazine effectively reduced the expression of IL-1β, IL-6, TNF-α, and NF-κB p65 (P < 0.05 or P < 0.01) and concurrently upregulated the expression of TGR5 protein (P < 0.05) (Fig. 6). The uncropped blots were placed in Supplementary material S3.

Fig. 6.

Fig. 6

Alterations in the expression of proteins related to BA metabolism. A Expression bands of BA metabolism-related proteins in each group; B Relative expression of BA metabolism-related proteins in each group. Compared with the control group: *P < 0.05, **P < 0.01. Compared with the model group: #P < 0.05, ##P < 0.01

RT-PCR analysis revealed that the mRNA of IL-1β, IL-6, TNF-α, and NF-κB p65 of the Model group were significantly upregulated (P < 0.05 or P < 0.01), while the mRNA of TGR5 was significantly downregulated (P < 0.01). Treatment with QYSX and mesalazine effectively reduced the mRNA expression of IL-1β, IL-6, TNF-α, and NF-κB p65, and concurrently upregulated the expression of TGR5 (P < 0.05 or P < 0.01). Treatment with QYSX and mesalazine effectively reduced the mRNA expression of IL-1β, IL-6, TNF-α, and NF-κB p65, as well as upregulated the expression of TGR5 (P < 0.05 or P < 0.01) (Fig. 7).

Fig. 7.

Fig. 7

Results of qPCR. A relative expression of IL-1β mRNA in each group; B relative expression of IL-6 mRNA in each group; C relative expression of TNF-α mRNA in each group; D relative expression of TGR5 mRNA in each group; E relative expression of NF-κB p65 mRNA in each group. Compared with the control group, *P < 0.05, **P < 0.01. Compared with the model group, #P < 0.05, ##P < 0.01

QYSX reversed fecal BA structure and concentration of DSS-induced UC in mice

As QYSX significantly upregulated TGR5 levels in the colon of modeled mice. We further measured the structure and concentration of BAs in stool of each group of mice. In the Model group, the concentrations of NorDCA, alloLCA, HDCA, isoLCA, TDCA, DCA, 12-ketoLCA and LCA significantly decreased, while the concentrations of β-MCA, CA and T-β-MCA notably increased. QYSX could reverse the concentration changes of HDCA, isoLCA, TDCA, DCA, 12-ketoLCA, LCA, T-β-MCA, while mesalazine had no significant effect on the concentrations of these BAs (Fig. 8; Table 2).

Fig. 8.

Fig. 8

Modifications in BA. A hierarchical clustering heat map of differential metabolites between the control group and the model group; B hierarchical clustering heat map of differential metabolites between the model group and the QYSX group; C hierarchical clustering heat map of differential metabolites between model group and mesalazine group. The magnitude of the relative content in the figure is shown by the difference in color, with more red colors showing higher expression and more blue colors showing lower expression; D fecal LCA concentrations of each group; E fecal DCA concentrations of each group. Compared with the control group, **P < 0.01. Compared with the model group, ##P < 0.01. Compared with mesalazine group, ▲▲P < 0.01

Table 2.

Changes of fecal LCA and DCA concentrations in each group[ng/ml, (Inline graphic± s)]

Group LCA DCA
Control group 145.31 ± 63.12 242.45 ± 103.28
Model group 10.74 ± 5.31** 37.18 ± 12.63**
QYSX group 76.80 ± 33.25**##▲▲ 103.05 ± 47.35**##
Mesalazine group 32.57 ± 12.76** 85.74 ± 39.26**

DCA Deoxycholic acid, LCA Lithocholic acid, QYSX QuYuShengXin Formula

Comparison with control group, *P < 0.05, **P < 0.01

Comparison with model group, #P < 0.05, ##P < 0.01

Comparison with mesalazine group, P < 0.05, ▲▲P < 0.01

QYSX balanced macrophage polarization of DSS-induced UC in mice

Finally, we investigated the polarization of macrophages in different groups of mice using flow cytometry. The results exhibited that the expression of M1 macrophages (CD11b+F4/80+CD86+) in the peritoneal macrophages of mice in the Model group was significantly upregulated (P < 0.01). Both QYSX and mesalazine were able to significantly decrease the expression of M1 macrophages in the Model group (P < 0.05). No significant differences were observed in the expression of M2 macrophages (CD11b + F4/80 + CD206+) across all groups (P ≥ 0.05). Additionally, both DSS, QYSX, and mesalazine treatment could increase the M2/M1 macrophage ratio (Fig. 9).

Fig. 9.

Fig. 9

Flow cytometry results of mice peritoneal macrophages. A comparison of peripheral blood inflammatory polarization marker CD86 in each group; B comparison of peripheral blood inflammatory polarization marker CD206 in each group; C the percentage of M1 macrophages in each group; D the percentage of M2 macrophages in each group; E Ratio of M2/M1 macrophages. Compared with the control group, *P < 0.05, **P < 0.01. Compared with the model group, #P < 0.05, ##P < 0.01

Discussion

UC is a lifelong, relapsing–remitting disorder whose global incidence is accelerating in newly industrialized countries, imposing an escalating burden on health-care systems and patient quality of life [3841]. Conventional therapies — mesalazine, corticosteroids, thiopurines and biologics—are limited by gastrointestinal irritation, immunosuppression, drug intolerance, and high treatment costs. TCM offers a multi-component, multi-target al.ternative; among TCM prescriptions, QYSX has long been used to ameliorate diarrhoea, bloody–purulent stool, abdominal pain, and tenesmus in patients with mild-to-moderate UC [4244]. This study aims to investigate the underlying mechanism of QYSX in the treatment of UC.

DAI score is widely utilized to assess the symptoms of DSS-induced model mice. In our study, both QYSX and mesalazine were found to significantly increase body weight and reduce DAI scores in DSS-induced model mice. Given the characteristic inflammatory infiltration of the colonic mucosa associated with UC, we further evaluated the effects of QYSX on colonic pathology in DSS-induced model mice. Notably, QYSX markedly alleviated inflammatory cell infiltration, restored mucosal thickness, and increased the number of goblet cells. This further sparked our interest in investigating its underlying mechanism.

In UC, the damaged colon mucosa perpetuates inflammation by upregulating the production of TNF and IL−1β [1]. Relevant studies have demonstrated that the level of TNF-α is significantly elevated in UC patients and correlates with the severity of disease [45]. Anti-TNF-α inhibitors have been shown to effectively control inflammation in UC patients, improve quality of life, and promote mucosal healing, further validating the role of TNF-α in UC pathogenesis [46].

With the deepening of relevant studies, the therapeutic potential of cytokines in UC is gaining increasing attention. IL−1β, a canonical pro-inflammatory cytokine, is unequivocally implicated in UC [47]. During the development of UC, local tissues exhibit abundant IL−1β, which is also confirmed by the results of our study. Large quantities of IL−1β amplify immune function by activating T and B lymphocytes, as well as promoting the expression of other inflammatory cytokines and neutrophil infiltration [4850]. Relevant studies have also proved that blocking the production of IL−1β can effectively inhibit DSS induced UC [51], and diarrhea in UC patients is associated with IL−1β inducing H2O2 release and affecting Ca2 + concentration, resulting in colon smooth muscle dysfunction in UC patients [52].

IL−6, a multifunctional cytokine with a broad spectrum of inflammatory and immunomodulatory roles, is central to immune responses, including the growth and differentiation of B cells and T cells [5355]. In patients with IBD, activated monocytes and macrophages serve as the primary sources of IL−6 production [56]. During the inflammatory response, IL−6 is elevated earlier than other cytokines, playing a critical role in the regulation of UC inflammation [57]. Our study demonstrated that compared to the Control group, the levels of TNF-α, IL−1β, and IL−6 were significantly increased in the Model group, indicating an upregulation of pro-inflammatory cytokine secretion in UC model mice. QYSX and mesalazine comparably downregulated these cytokines, indicating that QYSX exerts therapeutic effects on UC by downregulating the secretion of pro-inflammatory cytokines.

BAs metabolism is intimately linked to UC. Quantitative reductions in LCA and DCA was found in UC patients while restoration of LCA and DCA exerts potent anti-inflammatory effects [24, 25, 58]. We observed parallel reductions in LCA and DCA in DSS-induced mice, both of which were reversed by QYSX. Previous studies have demonstrated that LCA and DCA can trigger the inhibition of proinflammatory cytokine production in macrophages derived from peritoneal lavage through the TGR5 receptor [31], thereby regulating macrophage polarization [27, 29, 30].

TGR5 is a major receptor implicated in BA regulation of macrophage polarization [31], whereas NF-κB serves as a critical transcription factor in inflammation modulation. These molecules represent the key link between BAs and macrophage polarization. Upon activation of TGR5, the phosphorylation of IκBα and nuclear translocation of NF-κB p65 are inhibited [29, 32, 33], leading to a significant reduction in the secretion of pro-inflammatory cytokines such as LPS, TNF-α, IL−1β, and IL−6 [31, 34]. Generally, when macrophages infiltrate inflamed tissues, they exhibit phenotypic plasticity depending on the stimuli encountered [59]. Studies have demonstrated that upon stimulation with LPS, TNF-α, and interferon gamma (IFN-γ), macrophages differentiate into M1 phenotypes, contributing to host defense against bacterial and viral infections [20, 21, 60]. In this study, compared with the normal group, the serum expression of TGR5 protein was downregulated, while the levels of NF-κB p65, LPS, and TNF-α were elevated, suggesting that the relevant signaling pathway were abnormally activated in model group. Following treatment with QYSX, the expression of TGR5 protein was increased, while the expression levels of NF-κB p65, LPS, and TNF-α decreased. Taken together with the aforementioned alterations in BAs and macrophage polarization, QYSX restrains NF-κB signalling by restoring BA homeostasis and activating TGR5, thereby re-programming macrophage polarisation and attenuating mucosal inflammation.

Macrophages constitute one of the most prevalent types of immune cells in intestinal and gastrointestinal mucosa [61]. In patients with UC, intestinal macrophages exhibit characteristics of both M1 and M2 phenotypes [62], serving as key effector cells within the innate immune system. M1 macrophages exert a pronounced pro-inflammatory effect by facilitating the secretion of cytokines such as TNF-α, IL−1β, and IL−12, whereas M2 macrophages play a pivotal role in wound healing. The equilibrium between these two phenotypes is critical for maintaining the self-stabilization of the intestinal mucosa [63, 64]. Certain relevant studies suggest that anti-TNF-α therapy may target intestinal macrophages, thereby promoting the conversion of M1-type macrophages into M2-type [65, 66]. Given that M1-type and M2-type macrophages represent two extremes of the macrophage phenotype with diametrically opposed roles in the inflammatory response, monitoring the ratio of M2/M1 macrophages is essential for assessing disease activity and therapeutic efficacy.

This study demonstrated that the M1 expression of peritoneal macrophages (CD11b+F4/80+CD86+) in mice from the Model group was significantly elevated, with a marked upregulation in the proportion. Both QYSX and mesalazine were able to substantially decrease the M1 expression ratio. Additionally, the proportion of M2/M1 macrophages in QYSX group was increased. In conjunction with elevated levels of TNF-α and IL-1β, the inflammatory polarization of macrophages can enhance the secretion of inflammatory cytokines, thereby promoting the inflammatory response and inducing intestinal damage. After QYSX treatment, the macrophages of DSS-induced UC mice were effectively regulated, leading to a significant reduction in pro-inflammatory cytokines and an improvement in intestinal inflammation.

Limitation

In addition to the aforementioned findings, several limitations merit consideration. Owing to the fixed clinical concentration of QYSX, the present study did not include high-, medium-, and low-dose cohorts. This study was primarily designed to delineate the putative mechanisms underlying the therapeutic effects of QYSX in UC. We intend to incorporate multiple-dose arms in future mechanistic studies to quantify dose-dependent efficacy and optimise therapeutic regimens.

Conclusion

In conclusion, this study draws the following conclusions: (1) DSS-induced model mice exhibited exacerbated inflammatory responses, characterized by elevated inflammatory markers, increased NF-κB signaling pathway proteins, and imbalanced macrophage polarization. These findings suggest that aberrant NF-κB activation contributes to M1/M2 imbalance in the intestine, promoting proinflammatory cytokine release and worsening intestinal inflammation; (2) QYSX enhances fecal LCA and DCA concentrations in DSS-induced model mice, activating TGR5 to inhibit the NF-κB signaling pathway, thereby reduces LPS and TNF-α levels, then suppressing excessive M1 macrophage activation to restore the balance of intestinal M2/M1 macrophage polarization, and ultimately maintains intestinal homeostasis and effectively controlling intestinal inflammation.

Supplementary Information

Supplementary Material 8. (126.6MB, tif)

Acknowledgements

We are sincerely grateful to Jiashi Sun at Johns Hopkins Medicine International and Xinyu Zhao at Yueyang Hospital of Integrated Traditional Chinese and Western Medicine for language polishing.

Abbreviations

UC

Ulcerative colitis

TCM

Traditional Chinese medicine

BA

Bile acid

LCA

Lithocholic acid

DCA

Deoxycholic acid

TGR5

Takeda G-protein coupled receptor 5

GPCRs

G protein-coupled receptors

LPS

Lipopolysaccharide

TNF-α

Tumor necrosis factor-α

IL-1β

Interleukin-1β

DSS

Dextran sulfate sodium

DAI

Disease Activity Index

HE

Hematoxylin and eosin

AB-PAS

Alcian blue-periodic acid schiff

RIPA

Radio immunoprecipitation assay

BCA

Bicinchoninic acid

SDS-PAGE

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis

PVDF

Polyvinylidene fluoride

TDCA

Taurodeoxycholic acid

CA

Cholic acid

alloLCA

Allolithocholic acid

isoLCA

Isolithocholic acid

NorDCA

23-nordeoxycholic acid

12-ketoLCA

12-ketolithocholic acid

HDCA

Hyodeoxycholic acid

β-MCA

β-muricholic acid

T-β-MCA

Tauro-β-muricholic acid

IFN-γ

Interferon gamma

Authors’ contributions

JN: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Data curation, Writing-original draft. YL: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Data curation. JT: Formal analysis. Jiaqi Jiang: Formal analysis. YW: Visualization. DG: Investigation. CC: Investigation. JW: Investigation. HY: Writing-review & editing. ZW: Methodology, Funding acquisition, Project administration, Supervision, Writing-review & editing.

Funding

This work is supported financially by National Natural Science Foundation of China (NO. 82274531), Yueyang Hospital’s “Revealing the Leader” Translational Medicine Research Fund in 2024(NO.2024YJJB09).

Data availability

Datasets are available on request: The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Declarations

Ethics approval and consent to participate

The entire study was approved by the Laboratory Animal Ethics Committee of Yueyang Hospital of Integrated Traditional Chinese Medicine(No. YYLAC-2023-215).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Jiachun Ni and Yuchang Lu contributed equally to this work and share first authorship.

Contributor Information

Haojie Yang, Email: yanghaojie@shyueyanghospital.com.

Zhenyi Wang, Email: drxinhuo@163.com.

References

  • 1.Le Berre C, Honap S, Peyrin-Biroulet L. Ulcerative colitis. Lancet. 2023;402:571–84. [DOI] [PubMed] [Google Scholar]
  • 2.Gros B, Kaplan GG. Ulcerative colitis in adults: A review. JAMA. 2023;330:951–65. [DOI] [PubMed] [Google Scholar]
  • 3.Selvaratnam S, Gullino S, Shim L, Lee E, Lee A, Paramsothy S, et al. Epidemiology of inflammatory bowel disease in South america: A systematic review. World J Gastroenterol. 2019;25:6866–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Barreiro-de Acosta M, Molero A, Artime E, Díaz-Cerezo S, Lizán L, de Paz HD, et al. Epidemiological, Clinical, Patient-Reported and economic burden of inflammatory bowel disease (Ulcerative colitis and crohn’s disease) in spain: A systematic review. Adv Ther. 2023;40:1975–2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hodges P, Kelly P. Inflammatory bowel disease in africa: what is the current state of knowledge? Int Health. 2020;12:222–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhao J, Ng SC, Lei Y, Yi F, Li J, Yu L, et al. First prospective, population-based inflammatory bowel disease incidence study in Mainland of china: the emergence of Western disease. Inflamm Bowel Dis. 2013;19:1839–45. [DOI] [PubMed] [Google Scholar]
  • 7.Yamazaki M, Chung H, Xu Y, Qiu H. Trends in the prevalence and incidence of ulcerative colitis in Japan and the US. Int J Colorectal Dis. 2023;38:135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kim S, Lee HJ, Lee SW, Park S, Koh SJ, Im JP, et al. Recent trends in the epidemiology and clinical outcomes of inflammatory bowel disease in South Korea, 2010–2018. World J Gastroenterol. 2024;30:1154–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Park KT, Ehrlich OG, Allen JI, Meadows P, Szigethy EM, Henrichsen K, et al. The cost of inflammatory bowel disease: an initiative from the crohn’s & colitis foundation. Inflamm Bowel Dis. 2020;26:1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Lichtenstein GR, Shahabi A, Seabury SA, et al. Lifetime economic burden of crohn’s disease and ulcerative colitis by age at diagnosis. Clin Gastroenterol Hepatol. 2020;18(4):889–e89710. [DOI] [PubMed] [Google Scholar]
  • 11.Stawowczyk E, Kawalec P. A systematic review of the Cost-Effectiveness of biologics for ulcerative colitis. PharmacoEconomics. 2018;36:419–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Tang JL, Liu BY, Ma KW. Traditional Chinese medicine. Lancet. 2008;372:1938–40. [DOI] [PubMed] [Google Scholar]
  • 13.Nirmal SA, Ingale JM, Pattan SR, Bhawar SB. Amaranthus Roxburghianus root extract in combination with Piperine as a potential treatment of ulcerative colitis in mice. J Integr Med. 2013;11:206–12. [DOI] [PubMed] [Google Scholar]
  • 14.Li JX, Chen J. Consensus opinion on the diagnosis and treatment of ulcerative colitis with integrated traditional Chinese and Western medicine. Chin J Integr Trad West Med Dig(Chin). 2018;26:105–11. https://www.cnki.com.cn/Article/CJFDTOTAL-ZXPW201802001.htm. [Google Scholar]
  • 15.Rashidian A, Mehrzadi S, Ghannadi AR, Mahzooni P, Sadr S, Minaiyan M. Protective effect of ginger volatile oil against acetic acid-induced colitis in rats: a light microscopic evaluation. J Integr Med. 2014;12:115–20. [DOI] [PubMed] [Google Scholar]
  • 16.Gan D, Han CP, Feng Z, Jin W, Yang HJ, Li Y, et al. Clinical research of Quyu Shengxin formula combined with mesalazine in treating mild to moderate ulcerative colitis. SH J TCM(Chin). 2017;51:54–7. https://www.cnki.com.cn/Article/CJFDTOTAL-SHZZ201708016.htm. [Google Scholar]
  • 17.Wu C, Yang H, Han C, Wang Q, Zhang H, Huang T, et al. Quyu Shengxin Decoction Alleviates DSS-Induced Ulcerative Colitis in Mice by Suppressing RIP1/RIP3/NLRP3 Signalling. Evid Based Complement Alternat Med. 2021;2021:6682233. [DOI] [PMC free article] [PubMed]
  • 18.Yang H, Li Y, Shen S, Gan D, Han C, Wu J, et al. Network pharmacology-based investigation into the mechanisms of quyushengxin formula for the treatment of ulcerative colitis. Evid Based Complement Alternat Med. 2019;2019:7870424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lu YC, Wang ZY, Yang HJ, Han CP, Zhou HL, Li Y, et al. Effect of Decoction for dispeling stasis and generating new tissue on fecal bile acid metabolism in mice with mild to moderate ulcerative colitis. Mod J Integr Traditional Chin Western Med. 2024;33(4). https://www.cnki.com.cn/Article/CJFDTOTAL-XDJH202404007.htm.
  • 20.Yang Z, Lin S, Feng W, Liu Y, Song Z, Pan G, et al. A potential therapeutic target in traditional Chinese medicine for ulcerative colitis: macrophage polarization. Front Pharmacol. 2022;13:999179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Isidro RA, Appleyard CB. Colonic macrophage polarization in homeostasis, inflammation, and cancer. Am J Physiol Gastrointest Liver Physiol. 2016;311:G59–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shapouri-Moghaddam A, Mohammadian S, Vazini H, Taghadosi M, Esmaeili SA, Mardani F, et al. Macrophage plasticity, polarization, and function in health and disease. J Cell Physiol. 2018;233:6425–40. [DOI] [PubMed] [Google Scholar]
  • 23.Gren ST, Grip O. Role of monocytes and intestinal macrophages in Crohn’s disease and ulcerative colitis. Inflamm Bowel Dis. 2016;22:1992–8. [DOI] [PubMed] [Google Scholar]
  • 24.Li N, Zhan S, Tian Z, Liu C, Xie Z, Zhang S, et al. Alterations in bile acid metabolism associated with inflammatory bowel disease. Inflamm Bowel Dis. 2021;27:1525–40. [DOI] [PubMed] [Google Scholar]
  • 25.Tiratterra E, Franco P, Porru E, Katsanos KH, Christodoulou DK, Roda G. Role of bile acids in inflammatory bowel disease. Ann Gastroenterol. 2018;31:266–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sinha SR, Haileselassie Y, Nguyen LP, Tropini C, Wang M, Becker LS, et al. Dysbiosis-Induced secondary bile acid deficiency promotes intestinal inflammation. Cell Host Microbe. 2020;27:659–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yang ZH, Liu F, Zhu XR, Suo FY, Jia ZJ, Yao SK. Altered profiles of fecal bile acids correlate with gut microbiota and inflammatory responses in patients with ulcerative colitis. World J Gastroenterol. 2021;27:3609–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Duboc H, Rajca S, Rainteau D, Benarous D, Maubert MA, Quervain E, Thomas G, et al. Connecting dysbiosis, bile-acid dysmetabolism and gut inflammation in inflammatory bowel diseases. Gut. 2013;62:531–9. [DOI] [PubMed] [Google Scholar]
  • 29.Yoneno K, Hisamatsu T, Shimamura K, Kamada N, Ichikawa R, Kitazume MT, et al. TGR5 signalling inhibits the production of pro-inflammatory cytokines by in vitro differentiated inflammatory and intestinal macrophages in Crohn’s disease. Immunology. 2013;139:19–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Pols TWH, Puchner T, Korkmaz HI, Vos M, Soeters MR, de Vries CJM. Lithocholic acid controls adaptive immune responses by inhibition of Th1 activation through the vitamin D receptor. PLoS One. 2017;12:e0176715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Keitel V, Reich M, Häussinger D. TGR5: pathogenetic role and/or therapeutic target in fibrosing cholangitis? Clin Rev Allergy Immunol. 2015;48:218–25. [DOI] [PubMed] [Google Scholar]
  • 32.Perino A, Schoonjans K. TGR5 and immunometabolism: insights from physiology and pharmacology. Trends Pharmacol Sci. 2015;36:847–57. [DOI] [PubMed] [Google Scholar]
  • 33.Guo C, Chen WD, Wang YD. TGR5, not only a metabolic regulator. Front Physiol. 2016;7:646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wang XX, Edelstein MH, Gafter U, Qiu L, Luo Y, Dobrinskikh E, et al. G protein-coupled bile acid receptor TGR5 activation inhibits kidney disease in obesity and diabetes. J Am Soc Nephrol. 2016;27:1362–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yunna C, Mengru H, Lei W, Weidong C. Macrophage M1/M2 polarization. Eur J Pharmacol. 2020;877:173090. [DOI] [PubMed] [Google Scholar]
  • 36.Hagemann T, Biswas SK, Lawrence T, Sica A, Lewis CE. Regulation of macrophage function in tumors: the multifaceted role of NF-kappaB. Blood. 2009;113:3139–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ray A, Dittel BN. Isolation of mouse peritoneal cavity cells. J Vis Exp. 2010;35:1488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Fumery M, Singh S, Dulai PS, Gower-Rousseau C, Peyrin-Biroulet L, Sandborn WJ. Natural history of adult ulcerative colitis in population-based cohorts: a systematic review. Clin Gastroenterol Hepatol. 2018;16:343–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Du L, Ha C. Epidemiology and pathogenesis of ulcerative colitis. Gastroenterol Clin North Am. 2020;49:643–54. [DOI] [PubMed] [Google Scholar]
  • 40.Yang H, Zhou R, Bai X, Guo M, Ruan G, Wang L, et al. Trend and geographic variation in incidence and prevalence of inflammatory bowel disease in regions across china: A nationwide employee study between 2013 and 2016. Front Med (Lausanne). 2022;25:900251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Alnafisah K, Alsaleem HN, Aldakheel FN, Alrashidi AB, Alayid RA, Almuhayzi HN, et al. Anxiety and depression in patients with inflammatory bowel disease at King Fahad specialist Hospital, Qassim region. Cureus. 2023;15:e44895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Shen H, Zhang S, Zhao W, Ren S, Ke X, Gu Q, et al. Randomised clinical trial: efficacy and safety of Qing-Chang-Hua-Shi granules in a multicenter, randomized, and double-blind clinical trial of patients with moderately active ulcerative colitis. Biomed Pharmacother. 2021;139:111580. [DOI] [PubMed] [Google Scholar]
  • 43.Gong Y, Zha Q, Li L, Liu Y, Yang B, Liu L, et al. Efficacy and safety of Fufangkushen colon-coated capsule in the treatment of ulcerative colitis compared with mesalazine: a double-blinded and randomized study. J Ethnopharmacol. 2012;141:592–8. [DOI] [PubMed] [Google Scholar]
  • 44.Gan D, Wang ZY. Research on clinical and intestinal flora effects of 2 Kuijie formula in treating mild-to-moderate ulcerative colitis. J Liaoning Univ TCM(Chin). 2019;21:99–103. https://www.cnki.com.cn/Article/CJFDTOTAL-LZXB201912030.htm. [Google Scholar]
  • 45.Olsen T, Goll R, Cui G, Husebekk A, Vonen B, Birketvedt GS, et al. Tissue levels of tumor necrosis factor-alpha correlates with grade of inflammation in untreated ulcerative colitis. Scand J Gastroenterol. 2007;42:1312–20. [DOI] [PubMed] [Google Scholar]
  • 46.Magro F, Portela F. Management of inflammatory bowel disease with Infliximab and other anti-tumor necrosis factor alpha therapies. BioDrugs. 2010;24(Suppl 1):3–14. [DOI] [PubMed] [Google Scholar]
  • 47.Dinarello CA. A clinical perspective of IL-1β as the gatekeeper of inflammation. Eur J Immunol. 2011;41:1203–17. [DOI] [PubMed] [Google Scholar]
  • 48.Sahoo M, Ceballos-Olvera I, del Barrio L, Re F. Role of the inflammasome, IL-1β, and IL-18 in bacterial infections. ScientificWorldJournal. 2011;11:2037–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kanneganti TD. Central roles of NLRs and inflammasomes in viral infection. Nat Rev Immunol. 2010;10(10):688–98. 10.1038/nri2851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Guarda G, So A. Regulation of inflammasome activity. Immunology. 2010;130:329–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yin Q, Pi X, Jiang Y, Ren G, Liu Z, Liu H. An immuno-blocking agent targeting IL-1β and IL-17A reduces the lesion of DSS-induced ulcerative colitis in mice. Inflammation. 2021;44:1724–36. [DOI] [PubMed] [Google Scholar]
  • 52.Cao W, Vrees MD, Potenti FM, Harnett KM, Fiocchi C, Pricolo VE. Interleukin 1beta-induced production of H2O2 contributes to reduced sigmoid colonic circular smooth muscle contractility in ulcerative colitis. J Pharmacol Exp Ther. 2004;311:60–70. [DOI] [PubMed] [Google Scholar]
  • 53.Takai Y, Wong GG, Clark SC, Burakoff SJ, Herrmann SH. B cell stimulatory factor-2 is involved in the differentiation of cytotoxic T lymphocytes. J Immunol. 1988;140:508–12. [PubMed] [Google Scholar]
  • 54.Muraguchi A, Hirano T, Tang B, Matsuda T, Horii Y, Nakajima K, et al. The essential role of B cell stimulatory factor 2 (BSF-2/IL-6) for the terminal differentiation of B cells. J Exp Med. 1988;167:332–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Uyttenhove C, Coulie PG, Van Snick J. T cell growth and differentiation induced by interleukin-HP1/IL-6, the murine hybridoma/plasmacytoma growth factor. J Exp Med. 1988;167:1417–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Mazlam MZ, Hodgson HJ. Interrelations between interleukin-6, interleukin-1 beta, plasma C-reactive protein values, and in vitro C-reactive protein generation in patients with inflammatory bowel disease. Gut. 1994;35:77–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Mudter J, Neurath MF. Il-6 signaling in inflammatory bowel disease: pathophysiological role and clinical relevance. Inflamm Bowel Dis. 2007;13:1016–23. [DOI] [PubMed] [Google Scholar]
  • 58.Sommersberger S, Gunawan S, Elger T, Fererberger T, Loibl J, Huss M, et al. Altered fecal bile acid composition in active ulcerative colitis. Lipids Health Dis. 2023;22(1):199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Liu L, Guo H, Song A, Huang J, Zhang Y, Jin S, et al. Progranulin inhibits LPS-induced macrophage M1 polarization via NF-κB and MAPK pathways. BMC Immunol. 2020;21:32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Sima C, Glogauer M. Macrophage subsets and osteoimmunology: tuning of the immunological recognition and effector systems that maintain alveolar bone. Periodontol 2000. 2013;63:80–101. [DOI] [PubMed] [Google Scholar]
  • 61.Bain CC, Mowat AM. The monocyte-macrophage axis in the intestine. Cell Immunol. 2014;291:41–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Dharmasiri S, Garrido-Martin EM, Harris RJ, Bateman AC, Collins JE, Cummings JRF, et al. Human intestinal macrophages are involved in the pathology of both ulcerative colitis and Crohn disease. Inflamm Bowel Dis. 2021;27:1641–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Shouval DS, Biswas A, Goettel JA, McCann K, Conaway E, Redhu NS, et al. Interleukin-10 receptor signaling in innate immune cells regulates mucosal immune tolerance and anti-inflammatory macrophage function. Immunity. 2014;40:706–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Smith AM, Rahman FZ, Hayee B, Graham SJ, Marks DJ, Sewell GW, et al. Disordered macrophage cytokine secretion underlies impaired acute inflammation and bacterial clearance in Crohn’s disease. J Exp Med. 2009;206:1883–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Bloemendaal FM, Koelink PJ, van Schie KA, Rispens T, Peters CP, Buskens CJ, et al. TNF-anti-TNF immune complexes inhibit IL-12/IL-23 secretion by inflammatory macrophages via an Fc-dependent mechanism. J Crohns Colitis. 2018;12:1122–30. [DOI] [PubMed] [Google Scholar]
  • 66.Nazareth N, Magro F, Silva J, Duro M, Gracio D, Coelho R, et al. Infliximab therapy increases the frequency of circulating CD16(+) monocytes and modifies macrophage cytokine response to bacterial infection. Clin Exp Immunol. 2014;177:703–11. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 8. (126.6MB, tif)

Data Availability Statement

Datasets are available on request: The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.


Articles from BMC Complementary Medicine and Therapies are provided here courtesy of BMC

RESOURCES