Skip to main content
Annals of Medicine and Surgery logoLink to Annals of Medicine and Surgery
. 2025 Dec 3;88(1):311–320. doi: 10.1097/MS9.0000000000004463

Effect of heat stress on growth and IGF-1 expression in synthetic broiler and native cross chicken

Kadimetla Sneha a, Shakti Kant Dash a,*, BV Sunil Kumar b, PP Dubey a
PMCID: PMC12767973  PMID: 41496940

Abstract

Background:

IGF-1 is a major gene that affects growth and is essential for myogenic development in chickens. This study examined growth performance, mRNA expression, and serum concentration in fast-growing IBL-80 and slow-growing native cross (NC) broilers under heat stress conditions.

Methods:

Poultry birds from each genetic cohort were categorized into control (mean THI: 22.45 ± 0.37) and heat stress (mean THI: 32.87 ± 0.46) groups. Both genetic groups’ body weights and cloacal temperatures were recorded on days 21 and 42. Blood was drawn on days 21 and 42. Cloning, expression analysis were used to examine IGF-1’s growth role.

Results:

Heat stress markedly affected the growth performance and cloacal temperatures of both genetic groups. The downregulation of IGF-1 mRNA expression was apparent in birds subjected to heat stress on days 21 and 42 across both genotypes. Both rapidly growing synthetic broilers and slowly growing native cross chickens exhibited lower levels of IGF-1 in serum samples.

Conclusion:

This study found that heat stress affected bird growth, gene expression, and serum IGF-1 levels regardless of genotype. Slow-growing native cross chickens lost less weight and expressed less IGF-1 under heat stress than fast-growing synthetic IBL-80 broilers.

Keywords: gene expression, growth, IBL-80, native cross, serum IGF-1 levels

Introduction

Growth is a polygenic trait, and a number of genes, including insulin-like growth factor-I (IGF-1), calpain 3, growth hormone (GH), along with muscle regulatory factors (MRFs), are crucial for a bird’s development[1]. The IGF-I gene is regarded as a crucial component in numerous biological processes by enhancing metabolism and cell proliferation, while also performing its role through binding to certain receptors. The avian IGF-I influences metabolic processes by enhancing amino acid and glucose absorption, thereby impacting DNA and protein synthesis[2,3]. Similar in molecular structure to insulin, IGF-1 is a protein that is important for the growth, differentiation, in addition metabolism of myogenic cell lines in a variety of animals, including chickens[4]. IGF-1 stimulates skeletal muscle growth by increasing protein synthesis rates, leading to a positive correlation between IGF-1 concentration and body weight (BW) in broiler chickens[5].

HIGHLIGHTS

  • Heat stress significantly impacted growth, cloacal temperatures, IGF-1 mRNA expression and serum IGF-1 levels in both IBL-80 and native cross (NC) broilers.

  • Native cross chickens showed greater heat resilience, with less body weight and milder IGF-1 downregulation compared to IBL-80 broilers.

  • IGF-1 expression was consistently downregulated under heat stress on days 21 and 42 in both genotypes.

  • PPI network revealed 10 IGF-1 interacting proteins, emphasizing IGF-1’s role in growth and stress response.

Expression of genes, associated with early growth, is affected due to environmental stressors such as heat stress. Gasparino et al[6] indicated that air temperature influences the expression of IGF-I genes associated with growth in quail. Heat exposure can induce oxidative stress, leading to a reduction in the birds’ metabolic rate. This is consistent with findings of Antonio[7]. Willemsen et al[8] who observed, reduced circulating IGF-I levels in chickens subjected to elevated temperatures. Heat stress is known to elevate ROS production in metabolism, alongside a reduction in IGF-I expression[9].

Modern day broilers have resulted due to intense selection for faster growth in comparison to native chicken. These birds undergo intense physiological and metabolic changes in a short time during their early life. This makes them more vulnerable to heat stress as their body generates more metabolic heat. In comparison indigenous chicken or their crosses, are slow growing and have smaller body size making them more adaptable to heat stress[10]. As broilers exhibit growth rate four times faster and the breast muscle growth eight times higher than birds that are selected for egg production making, this makes them an excellent model for the investigation of myogenic properties of IGF-I[11].

Broilers are primarily raised for meat production, and the growth rate of the birds is crucial for timely marketing and economic benefit. Optimal environmental conditions are necessary for birds to achieve their maximum genetic potential for growth. Within the thermo-neutral zone, productivity is elevated, as birds can maintain their body temperature without modifying their typical behavior. When temperatures exceed the thermo-neutral zone, birds experience distress as they attempt to dissipate heat, which impacts various physiological, immunological, behavioral, reproductive, and productive performances[12]. Broilers experiencing chronic heat stress demonstrated a 32.6% reduction in body weight and a 16.4% decrease in feed intake[13].

While previous studies have examined IGF-1 expression in reaction to heat stress, there is a lack of direct comparisons between rapidly growing commercial broilers and slowly growing indigenous hybrids. This study specifically investigates the influence of genetic background on the IGF-1 response to thermal stress. The utilization of recombinant IGF-1 for ELISA calibration was investigated, thereby improving the accuracy and reliability of target protein quantification. The aforementioned factors render the current study distinctive and provide innovative insights into genotype-specific resilience to thermal stress.

This study aimed to examine the effects of heat stress on slow-growing native cross broilers and fast-growing IBL-80 broilers by analyzing growth and IGF-1 gene expression under heat stress and control conditions.

Materials and methods

Experimental material and design

The experiments on birds were carried out at the university’s poultry farm. The work has been reported in line with the ARRIVE criteria[14]. The study selected two genetic groups: the fast-growing IBL-80 broiler variety and the slow-growing native cross broilers (NC). The IBL-80 chicks were generated by crossing synthetic colored broiler parents (PB1 male × PB2 female), while the native cross was established by mating synthetic colored broiler PB1 males with Punjab Brown native line females.

Temperature humidity index (THI)

To study the effect of high and control temperature humidity index (THI), flocks of birds belonging to the two genetic groups were raised during April and May (summer months) and the control group was raised during February and March (spring months). Manson’s hygrometer was used to record the daily poultry shed temperature and humidity. Temperature and humidity were recorded during morning, afternoon, and evening. THI for broilers was calculated using the formula THI = 0.85 tdb + 0.15 twb. In this context, tdb represents the dry bulb temperature (in ºC), while twb denotes the wet bulb temperature (in ºC). The subjects from both genetic groups were selected randomly for the heat stress and control groups. Participants from both genetic groups were of identical age at the commencement of the experiment and were maintained under comparable housing and feeding conditions to prevent confounding variables.

Animal experimentation

Following hatching, 40-day-old chicks from each variety were relocated to the brooder house of the poultry farm. Standard managemental practices were followed and the birds were fed ad-libitum, with chick feed having 2850 Kcal/kg energy, protein (20%), Lysine (1.00%), Methionine (0.52%), Calcium (1%), Phosphorous (0.45%), Choline chloride (0.10%) and Sodium chloride (0.40%). The chicks were vaccinated against the Marek’s, New castle disease (B1 and Lasota strains) and Infectious Bursal disease as per the vaccination schedule. . The sample size for the real-time PCR analysis in this study was determined based on previous research on similar studies in chickens[6,1518]. This indicated that 7 to 10 birds per group would be sufficient to detect large effect sizes while ensuring ethical use of experimental birds. Data generated from all individual birds were utilized for analysis, and no inclusion or exclusion criteria were set forth for the study to avoid bias. Birds were randomly assigned to control or heat-stress groups to minimize allocation bias, and all individuals were included in the analysis without exclusion criteria. While laboratory personnel conducting measurements were aware of group assignments, farm workers responsible for routine husbandry were not informed of the experimental design, thereby reducing potential handling bias.

Blood sample collection, RNA isolation and synthesis of complimentary DNA (cDNA)

Blood samples were collected from 7 to 10 birds per group on days 21 and 42, using 2.7% EDTA for RNA isolation and without anticoagulant for serum harvesting. The body weight along with cloacal temperatures of the birds were recorded in tandem during collection.

The TRIzol method was employed[19], including modifications from Mewis et al[20] for the extraction of total RNA from poultry blood. For the digestion of genomic DNA 1 µl of DNase-1 was added. Nanodrop spectrophotometer (Thermo, USA) was used to determine the purity as well as concentration of the extracted RNA.

Isolated RNA from each sample, at a concentration of 1 µg, was used for cDNA synthesis using the iScript cDNA synthesis kit (Bio-Rad, USA) following the manufacturer’s guidelines. Four microlitres of 5 × iScript reaction mix were combined with 1 µl of iScript Reverse Transcriptase, 1 µg of RNA template, and 20 µl of nuclease-free water. The reaction mixture underwent incubation in a thermal cycler with a lid temperature of 103 °C. The protocol comprised a 5-minute priming step at 25 °C, followed by a 20-minute reverse transcription at 46 °C, and concluded with RT inactivation for 1 minute at 95 °C.

Quantitative polymerase chain reaction (qPCR)

Go Taq qPCR master mix (Promega, USA) was utilized to amplify Insulin-like Growth Factor-1 (IGF-1) and Mitochondrial Ribosomal Protein S27 (MRPS27) in poultry. MRPS27 served as an endogenous control. The primers utilized for gene amplification are listed in Table 1. A non-template control (NTC) was consistently included in the reaction panel to assess non-specific amplification, and samples were analyzed in duplicates. The reaction mixture was subjected to 40 cycles, commencing with the activation of hot start DNA polymerase at 95 °C for 2 minutes. Subsequently, denaturation occurred at 95 °C for 15 seconds, followed by annealing and extension at 60 °C for 1 minute, and melt curves were generated from 60 to 95 °C. The findings were reported as threshold cycle (Ct) values. Dissociation curves were assessed to ascertain the specificity of the amplified products, produced at temperatures between 60 and 95 °C. After 40 cycles, Ct values for both the internal control and the test gene were recorded. The disparity in Ct values between MRPS27 and IGF-1 yields δCt values, which were utilized to calculate the qPCR scores (2-δCt). The mRNA expression of a test gene was analyzed across various groups of birds using qPCR scores. The fold change (2^(-ΔΔCt)) was determined relative to the control group[21]. The percentage of PCR amplification efficiency (E) for the assays was evaluated[22]. cDNA samples underwent serial dilution and amplification using primers specific to IGF-1 and MRPS27. Semi-log regression plots of Ct values versus log cDNA dilutions were generated, and the slopes of the standard curves were calculated. The percent PCR amplification efficiencies (E) for each assay were determined using the formula E = (10−1/slope – 1) × 100[23].

Table 1.

Primer sequences used in qPCR experiment

Gene Primer sequence Reference
IGF- 1 Forward: 5′ GATGCACACTGTGTCCTAC 3′ [4]
Reverse: 5′ ACGAACTGAAGAGCATCAAC 3′
MRPS27 Forward: 5′ GCTCCCAGCTCTATGGTTATG 3′ [24,25]
Reverse: 5′ ATCACCTGCAAGGCTCTATTT 3′

Expression and purification of recombinant chicken IGF-1 (rIGF-1)

The chicken IGF-1 gene (418 bp, inclusive of restriction sites) was amplified using PCR employing primers containing NcoI and XhoI restriction sites, subsequently cloned into the pPROExHTa(+) expression vector, and transformed into competent E. coli BL21 (DE3) cells. Positive clones were validated through restriction digestion and sequencing. Recombinant protein expression was induced with IPTG, and the expressed rIGF-1 was purified using standard laboratory protocols, followed by dialysis and verification through SDS-PAGE and Western blotting. Detailed cloning and purification protocols are available in the supplementary materials.

Indirect ELISA

Hyperimmune sera raised in mice against the recombinant IGF-1 protein was used for iELISA. Chequerboard titration was performed to determine the optimal dilution of the primary antibody. ELISA plates (Nunc, India) were coated with 5 ng/well of recombinant IGF-1 or bovine serum albumin (BSA) in 0.5 M carbonate-bicarbonate buffer (pH 9.6) and incubated at 4 °C overnight. Plates were washed thrice with PBS-T and blocked with blocking buffer for 6 hours at 4 °C[26,27].

Two-fold serial dilutions of primary antibody were added and incubated at 37 °C for 2 hours. After washing, HRP-conjugated anti-mouse IgG (1:10 000 in blocking buffer; Sigma, USA) was added and incubated for 2 hours[28]. Plates were developed using OPD substrate and stopped with 3 M H2SO4. Absorbance was measured at 490 nm using an ELISA reader (BioTek, USA). Samples were considered positive if OD values were three times or more than the negative control (P/N ≥3)[29].

Estimation of serum IGF-I levels in different groups of broiler birds

Indirect ELISA was conducted using various dilutions of rIGF-1 protein on the ELISA plate. A fixed dilution of primary antibodies established through chequerboard titration. A second-order polynomial regression curve was plotted for the relationship between concentration and absorbance, allowing for the interpolation of absorbance values from unknown samples to determine the concentration of IGF-1 in various groups of grill birds. The dilution factor was considered in estimating the protein concentration, expressed in ng/ml. The plate was analyzed spectrophotometrically at 490 nm using an ELISA reader (Bio Tek, USA)[25].

Statistical analysis

Considering the continuous nature of the variables generated for the study, independent two sample t-tests were performed to assess significant differences in IGF-1 expression between heat stress and control groups of the two genetic groups (IBL-80 and NC) of birds. Statistically significance was determined at P ≤ 0.05.

Packages compatible with Python 3.11.12, including numpy (2.0.2), pandas (2.2.2), scipy (1.14.1), scikit-learn (1.6.1), and statsmodels (0.14.4), were used to analyze the data. Seaborn (0.13.2) and matplotlib (3.10.0) were utilized for the graphical display. Google Colaboratory was employed to run the Python scripts.

Results

Temperature humidity Index and cloacal temperature

The tdb for the spring season in the poultry house fluctuated between 19 and 24 °C, whereas during the summer season, it spanned from 28 to 40 °C. The control group’s mean in-house THI was 22.45 ± 0.37, while the heat stress group’s was 32.87 ± 0.46. Thus, the birds reared in the summer experienced heat stress, forming the experimental or heat stress groups, while those raised in the spring comprised the control groups.

Cloacal temperature was measured using a random sample of ten birds from each experimental group. THI significantly influenced (P < 0.01) the body temperature of poultry subjected to heat stress (Table 2). On day 42, independent t-tests revealed that birds subjected to heat stress in both varieties exhibited significantly elevated rectal temperatures (P < 0.01) relative to their corresponding control groups (Table 3).

Table 2.

Effect of THI on poultry cloacal temperature (°C)

THI N Day 21 Day 42
Control 16 41.63a ± 0.04 41.48a ± 0.05
Heat stress 14 42.36b ± 0.04 42.64b ± 0.05
P-Value <0.00 0.01

Means with different superscripts (a, b) across rows differ significantly at P < 0.05. N indicates number of observations.

Table 3.

Effect of heat stress on body temperature (°C) in native cross and IBL-80 Groups at different ages

Age Native cross IBL-80
Control Heat stress Control Heat stress
Day 21 41.66a ± 0.06 (7) 42.34b ± 0.06 (7) 41.60a ± 0.06 (9) 42.37b ± 0.06 (7)
P-Value 0.04 <0.00
Day 42 41.28a ± 0.07 (10) 42.61b ± 0.07 (10) 41.68a ± 0.07 (10) 42.66b ± 0.07 (8)
P-value 0.04 <0.00

Means with different superscripts (a, b) across rows differ significantly at P < 0.05. Figures in parenthesis indicate number of observations.

Analysis of IGF-1 gene expression in broiler varieties under control and heat stress conditions using qRT-PCR

The average concentration of total RNA was 489.46 ± 9.27 ng/μl, along with an A260/A280 ratio of 1.96. Agarose gel electrophoresis of total RNA demonstrated intact bands corresponding to 18s and 28s rRNAs (Fig. 1). A 237 bp amplicon was generated through PCR with β-actin primers, confirming cDNA synthesis (Fig. 2).

Figure 1.

Figure 1.

Isolated RNA from poultry blood samples.

Figure 2.

Figure 2.

Confirmation of cDNA using Beta actin primers (Lane 1: Beta actin amplicon; Lane L: 1 Kb plus DNA ladder).

The expression of IGF-1 mRNA in native cross and IBL-80 chickens was evaluated using qRT-PCR at 21 and 42 days of age. The optimum annealing temperatures for IGF-1 and the endogenous control, MRPS27 (mitochondrial ribosomal protein S27) gene, were determined to be 55 °C, with a primer concentration of 0.1 μM in every instances. Near-exponential efficiencies were observed for the MRPS27 and IGF-1 genes, with amplification efficiencies of 96.8% and 94.2%, respectively. The amplification and melt curves demonstrated the amplification and specificity of the IGF-1 and MRPS27 genes.

In both the NC and IBL-80 varieties, raised under varying environmental conditions and at different developmental stages (day 21 and day 42), the 2^(-ΔΔCt) (fold change score) was employed to assess the degree of upregulation or downregulation in the heat stress group and control groups. On day 21 and day 42, the IGF-1 gene expression was down-regulated in the native cross and IBL-80 varieties of birds subjected to heat stress (Table 4 and Figs 3 and 4).

Table 4.

Mean ± SD and 95% confidence intervals for fold change (2^(-ΔΔCt)) between Control and Heat stress groups in Native Cross and IBL-80 Chickens

Breed Control group Heat stress
Day 21
Mean ± SD 95% CI Mean ± SD 95% CI P-Value
Native Cross 1.93 ± 2.04 (7) 1.51 0.62 ± 0.41 (7) 0.30 0.14
IBL-80 2.07 ± 2.43 (9) 1.59 2.04 ± 1.55 (7) 1.15 0.97
Day 42
Native Cross 1.27 ± 0.90 (10) 0.56 0.61 ± 0.56 (10) 0.35 0.06
IBL-80 1.42a ± 1.37 (10) 0.85 0.22b ± 0.08 (8) 0.06 0.02

Figure 3.

Figure 3.

Mean body weight and Mean fold change indicating IGF-1 expression in different groups of birds at day 21 in NC and IBL-80.

Figure 4.

Figure 4.

Mean body weight and Mean fold change indicating IGF-1 expression in different groups of birds at day 42 in NC and IBL-80.

Means with different superscripts (a, b) between columns differ significantly at P < 0.05. SD indicates standard deviation and CI indicates class interval. Figures in parenthesis indicate number of observations.

Gene cloning for IGF-1

IGF-1 gene amplification by PCR with designed primers produced a single specific band at 417 bp on agarose gel electrophoresis (Supplemental Digital Content Figure 1, available at: http://links.lww.com/MS9/B45). The inclusion of restriction enzyme sites in the primers resulted in the increased size. The concentration achieved following the purification of the amplified product was 115 ng/µl. The purified product and the vector, pPROEX HTa, were subjected to double digestion with NcoI and XhoI restriction endonucleases. The insert and vector were ligated utilizing T4 DNA ligase. After transforming competent BL21 cells and plating them on LB agar with ampicillin, white recombinant colonies were observed. The plasmid obtained from the positive clone underwent double digestion with NcoI and XhoI restriction enzymes, resulting in the release of a specific insert size of 411 bp (Supplemental Digital Content Figure 2, available at: http://links.lww.com/MS9/B45). A positive clone from each genetic group (IBL-80 and native cross) was submitted for custom sequencing. The nucleotide sequence exhibited similarity across both genetic groups. NCBI accession number MN630161 was assigned to the sequence.

Expression and purification of recombinant insulin-like growth factor 1

Positive clones in the growth log phase, at a culture absorbance of 0.6, were induced with 1 mM IPTG. Kinetic analysis using SDS-PAGE confirmed the expression of rIGF-1, which has an approximate molecular weight of 14 kDa (Fig. 5a and b). The measured size of the expressed protein slightly exceeded the expected 13 kDa, due to the inclusion of a His tag at the N-terminal end.

Figure 5.

Figure 5.

(a) SDS PAGE of rIGF-1 under denaturing conditions (Lane 1: Monomeric Protein; Lane M: Prestained Protein Ladder) (b) Western blot analysis of rIGF-1 under denaturing method of purification (Lane M: Prestained Protein Marker; Lane 1: immuno-reactive rIGF-I) (c) SDS PAGE of purified rIGF-1 protein under native conditions (Lane M: prestained protein marker; Lanes 1-2: Purified rIGF-I) (d) Western blot analysis of rIGF-1 under Native purification conditions (Lane M: Prestained protein marker; Lane 1: immuno-reactive rIGF-I).

The protein underwent purification under native conditions utilizing an imidazole gradient. The purified recombinant protein, following affinity chromatography, exhibited a molecular weight of approximately 28 kDa as determined by SDS-PAGE (Fig. 5c and d). IGF-1 is present as a fusion protein[30], which may account for its increased molecular weight. Impurities were eliminated through the addition of 40 mM imidazole to the washing buffer. The recombinant protein concentration was measured at 0.38 mg/ml. Post-dialysis, the protein concentration reduced to 0.14 mg/ml. The protein concentration was elevated to 0.22 mg/ml through the application of polyethylene glycol. The overall yield of rIGF-1 protein was 2.8 mg per liter of the induced culture. The western blot analysis of recombinant protein 11 exhibited specific immunoreactivity at approximately 28 kDa utilising commercially available anti-His tag monoclonal antibodies.

Assessment of serum IGF-1 concentrations across different genetic groups of poultry under controlled and heat stress conditions utilizing indirect ELISA

The optimal dilution of the primary antibody was determined using chequerboard titration with a constant concentration of rIGF-1. The dilution ratio was established as 1:65 536. A second-order polynomial regression curve was generated by plotting different concentrations of the standard (known concentrations of rIGF-1) against their respective absorbance values. The serum concentrations of IGF-1 in various groups of birds under different conditions were determined by interpolating the unknown samples using the standard curve.

A regression equation, y = 26.83x2–29.24x + 8.502, was established to calculate serum IGF-1 levels, where “y” represents the protein concentration and “x” signifies the absorbance. The coefficient of determination (R2) of 0.992 for the polynomial equation demonstrates a high degree of accuracy in predicting the IGF-1 concentration of a sample based on its absorbance. A dilution factor of 10 was utilized in estimating the concentration of circulating IGF-1. Serum IGF-1 levels were observed to decrease in both varieties under heat stress at day 42. Though not statistically significant the heat stress resulted in a decrease in IGF-1 expression which reflected serum IGF-1 concentration in the studied birds (Table 5).

Table 5.

IGF-1 serum concentrations (ng/ml) in various native cross and IBL-80 bird groups at day 42

Genetic group Native cross IBL-80
Control 32.03 ± 2.37 33.88 ± 2.23
Heat stress 26.95 ± 2.24 30.20 ± 1.83

Values represent mean ± standard error (n = 10 birds per group).

Discussion

The present research revealed that birds subjected to heat stress exhibited elevated body temperatures compared to those reared in a controlled environment. An increased body temperature indicates heat stress. A study in Nigeria investigated body temperature fluctuations among avian species in elevated temperatures, indicating heightened temperatures resulting from hyperthermia. In extreme heat, birds employ evaporative cooling using panting, which requires energy and leads to water loss. To alleviate these effects, birds may increase their body temperature[31]. A similar pattern of increased body temperatures in response to heat stress was documented in poultry[3234]. Zeferino et al[35] reported spikes in cloacal and skin surface temperatures as indicators of heat stress, noting that elevated skin temperature facilitates heat loss through sensible mechanisms, while an inability to dissipate heat correlates with a rise in core body temperature. Aengwanich[36] observed that the body temperature of broilers was significantly elevated compared to that of Thai indigenous chickens and their crossbreeds, indicating that elevated temperatures exert a greater influence on broilers due to their increased metabolism and growth rate. The effect of seasonal variation on core body temperature was studied in Assel and Kadaknath breeds of chicken on India. The breed, sex and season interaction were highly significant (P < 0.01) indicating that high THI resulted in elevated temperatures in birds which is an indication of stressful conditions[37].

Insulin-like growth factor-I is essential for the development of various tissues, such as muscle, bone, and cartilage. This study observed a downregulation of the IGF-1 gene in IBL80 and native cross birds at both day 21 and day 42. The regulation of IGF-1 during heat stress has been investigated in the previous studies and has showed down regulation of the gene during heat stress. A reduced IGF-1 expression in the liver and breast muscle has been reported, while no such change was noticed in thigh muscle. This might be due to impaired protein synthesis in breast muscle and no significant changes in thigh muscle[38]. In meat-type quails maintained at controlled temperatures, an increase in IGF-1 mRNA expression has been documented. Conversely, under hot-humid conditions, no significant reduction in liver IGF-1 levels was observed, while a higher expression in muscle was noted. This may result from changes in feed intake, leading to energy-protein restriction and a subsequent decrease in plasma IGF-1 levels. The decreased plasma level promotes the extra-hepatic expression of IGF-1[23]. Xu et al[39] demonstrated a significant increase in corticosterone levels in broilers subjected to heat stress. Heat stress leads to a reduction in IGF-1 mRNA expression and serum IGF-1 levels, which impairs muscle hypertrophy[40]. Humam et al[41] observed a decrease in IGF-1 expression under heat stress, attributed to adverse effects on gut microbiota and antioxidant enzymes. Their qRT-PCR analysis results supported the phenotypic analysis, highlighting the significance of IGF-1 as a crucial candidate gene in regulating poultry growth performance. The suppression of IGF-1 induced by heat stress likely indicates a physiological adaptation that downregulates anabolic pathways to conserve energy, diminish metabolic heat, and sustain ionic and water equilibrium. This adaptive response is associated with modified thyroid hormone levels, enzyme kinetics, and immune function, all of which contribute to diminished growth performance[42,43]. Despite the modest sample size of the present study, the consistent trends observed establish a robust basis for future validation in larger cohorts.

In this study, the recombinant protein was expressed as inclusion bodies under non-denaturing conditions and as native protein. Under non-denaturing conditions, the protein was expressed as an oligomer that could not be dissociated during SDS-PAGE analysis. Previously, chicken IGF-1 expression was heterologous in E. coli utilizing the expression vector pRLC. The protein was expressed in inclusion bodies within the bacteria[44].

This research utilized indirect ELISA to assess serum IGF-1 levels in both control and heat stress groups of IBL-80 and native cross poultry birds. A decrease in serum concentration was noted in both genetic groups (IBL-80 and native cross), although this finding did not reach statistical significance[45]. The IBL-80 birds, which exhibit rapid growth, showed elevated serum IGF-1 levels in both control and heat stress conditions relative to the slower-growing native cross birds. Ma et al[40] observed a notable decrease in serum IGF-1 concentration in broilers was recorded during heat stress. The lower serum IGF-1 levels have been observed in native chicken breeds compared to broilers. Further, in broilers, plasma IGF-1 concentration increased with age, while Daweishan mini chickens exhibited stable plasma levels throughout the experimental period[46].

Heat stress is a major constraint in poultry production, reducing growth, reproduction, immunity and product quality[47,48]. The differential expression of heat shock proteins and other stress-responsive genes in our study highlights the genetic basis of thermotolerance, which can be targeted through selective breeding. Incorporating markers such as IGF-1 variants (or HSP gene family variants) into marker-assisted and genomic selection programs offers a practical route to improving resilience in poultry[49]. Advances in high-throughput genotyping and genomic prediction allow faster identification of heat-tolerant lines, reducing resilience on costly environmental modifications[50,51]. However, resilience breeding must balance thermotolerance with growth and reproductive performance while conserving indigenous breeds that carry valuable adaptive traits[52]. Thus, integrating molecular insights with modern genomic tools provides a suitable pathway to develop climate resilient poultry populations.

Conclusion

The findings of this study demonstrate that heat stress impacted growth and altered IGF-1 gene expression in both synthetic and native cross broiler chickens. Both fast-growing synthetic broilers and slow-growing native cross chickens exhibited a decrease in serum IGF-1 protein levels. The findings of this study demonstrate that heat stress influenced growth, gene expression, and serum IGF-1 levels. The native cross chicken, characterized by slow growth, demonstrated a reduced decline in body weight and IGF-1 gene expression relative to the fast-growing synthetic IBL-80 broilers. IGF-1 cloning, expression.

Acknowledgements

In accordance with TITAN 2025 guidelines[53], the authors acknowledge the utilization of artificial intelligence tools (ChatGPT and Microsoft Copilot) for code correction. The authors maintain complete responsibility for the accuracy, integrity, and interpretation of all analyses.

Footnotes

Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article.

Supplemental Digital Content is available for this article. Direct URL citations are provided in the HTML and PDF versions of this article on the journal's website, www.lww.com/annals-of-medicine-and-surgery.

Published online 3 December 2025

Contributor Information

Kadimetla Sneha, Email: sneha.kadimetla@gmail.com.

Shakti Kant Dash, Email: shaktikant07@gmail.com.

P.P. Dubey, Email: prakashagb@gmail.com.

Ethical approval

The institutional animal ethics committee of the university approved the experiments involving animal experimentation. (Registration no. 497/GO/Re/SL/02/CPCSEA) under 2019/IAEC/50/12 dated 17 August 2020.

Consent

Not applicable to animal trials.

Sources of funding

The AICRP Poultry Breeding project of the university, provided the funding for the study.

Author contributions

K.S.: methodology, experimentation; S.K.D.: manuscript writing, review and editing, methodology, supervision, data analysis; B.V.S.K.: review, editing, methodology, data analysis; P.P.D.: review, editing.

Conflicts of interest disclosure

The authors declare they have no conflict of interest.

Research registration unique identifying number (UIN)

Not applicable.

Guarantor

Shakti Kant Dash.

Peer and provenance statement

Not commissioned.

Data availability statement

The data are available from the corresponding author upon reasonable request.

Assistance with the study

The authors are thankful to the College of Veterinary Science, Ludhiana and College of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab 141004, India for all the facilities and support for this study.

References

  • [1].Chen F, Wu P, Shen M, et al. Transcriptome analysis of differentially expressed genes related to the growth and development of the Jinghai yellow chicken. Genes (Basel) 2019;10:539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Zhou M, Ma Z, Sly WS. Cloning and expression of the cDNA of chicken cation-independent mannose-6-phosphate receptor. Proc Natl Acad Sci U S A 1995;92:9762–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].McMurtry JP. Nutritional and developmental roles of insulin-like growth factors in poultry. J Nutr 1998;128:302S–5S. [DOI] [PubMed] [Google Scholar]
  • [4].Bhattacharya TK, Chatterjee RN, Dushyanth K, et al. Polymorphism and expression of insulin-like growth factor 1 (IGF-1) gene and its association with growth traits in chicken. Br Poult Sci 2015;56:398–407. [DOI] [PubMed] [Google Scholar]
  • [5].Xiao Y, Wu C, Li K, et al. Association of growth rate with hormone levels and myogenic gene expression profile in broilers. J Anim Sci Biotechnol 2017;8:1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Gasparino E, Voltolini DM, Del Vesco AP, et al. IGF-I, GHR and UCP mRNA expression in liver and muscle of high- and low-feed-efficiency laying Japanese quail at different environmental temperatures. Livest Sci 2013;157:339–44. [Google Scholar]
  • [7].Antonio J. Effect of temperature and feed restriction on performance, carcass composition, and expression patterns of somatotropic axis genes in broiler chickens. [Master’s thesis]. Jaboticabal, Brazil: UNESP; 2010. [Google Scholar]
  • [8].Willemsen H, Swennen Q, Everaert N, et al. Effects of dietary methionine and its hydroxy analog on growth performance and plasma hormone levels in heat-stressed broilers. Poult Sci 2011;90:2311–20. [DOI] [PubMed] [Google Scholar]
  • [9].Gomes-Marcondes MC, Tisdale MJ. Induction of protein catabolism and the ubiquitin-proteasome pathway by mild oxidative stress. Cancer Lett 2002;180:69–74. [DOI] [PubMed] [Google Scholar]
  • [10].Nawaz AH, Lin S, Wang F, et al. Investigating heat tolerance and production performance in local chicken breed of normal and dwarf size. Anim 2023;17:100707. [Google Scholar]
  • [11].McMurtry JP, Francis GL, Upton Z. Insulin-like growth factors in poultry. Domest Anim Endocrinol 1997;14:199–229. [DOI] [PubMed] [Google Scholar]
  • [12].Pawar SS, Basavaraj S, Dhansing LV, et al. Assessing and mitigating heat stress impact in poultry. Adv Anim Vet Sci 2016;4:332–41. [Google Scholar]
  • [13].Sohail MU, Hume ME, Byrd JA, et al. Effect of prebiotic and probiotic supplementation on broilers under chronic heat stress. Poult Sci 2012;91:2235–40. [DOI] [PubMed] [Google Scholar]
  • [14].Kilkenny C, Browne WJ, Cuthill IC, et al. Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. PLoS Biol 2010;8:e1000412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Siddiqui SH, Kang D, Park J, et al. Chronic heat stress regulates the relation between heat shock protein and immunity in broiler small intestine. Sci Rep 2020;10:18872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Gromboni JGG, de Oliveira HC, Marques DB, et al. Influence of heat stress on reference genes stability in heart and liver of two chicken genotypes. PLoS One 2020;15:e0228314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Del Vesco AP, Gasparino E, Grieser DO, et al. Effects of methionine supplementation on the expression of protein deposition-related genes in acute heat stress-exposed broilers. PLoS One 2015;10:e0115821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Mehaisen GM, Eshak MG, Elkaiaty AM, et al. Comprehensive growth performance, immune function, plasma biochemistry, gene expressions and cell death morphology responses to a daily corticosterone injection course in broiler chickens. PLoS One 2017;12:e0172684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Chomczynski P, Sacchi N. Single-step RNA isolation by guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156–59. [DOI] [PubMed] [Google Scholar]
  • [20].Mewis JL, Sun X, Zuidhof MJ, et al. Methodology for high-quality RNA extraction from poultry blood. Br Poult Sci 2014;55:194–96. [DOI] [PubMed] [Google Scholar]
  • [21].Livak KJ, Schmittgen TD. Analysis of relative gene expression using qPCR and the 2^(-ΔΔCt) method. Methods 2001;25:402–08. [DOI] [PubMed] [Google Scholar]
  • [22].McNeill RE, Miller N, Kerin MJ. Validation of endogenous control genes for qPCR in breast cancer. BMC Mol Biol 2007;8:107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Gasparino E, Voltolini DM, Del Vesco AP, et al. Thermal stress alters gene expression and blood parameters in quail. J Appl Genet 2015;56:253–60. [DOI] [PubMed] [Google Scholar]
  • [24].Cedraz H, Gromboni JGG, Garcia AAP, et al. Heat stress induces HSP gene expression in genetically divergent chickens. PLoS One 2017;12:e0186083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].Sharma A, Kumar BS, Dash S, et al. HSPB1 expression linked to sexual maturity in Rhode Island Red and Punjab Red layers under heat stress. Int J Biometeorol 2020;64:1–11. [DOI] [PubMed] [Google Scholar]
  • [26].Minhas P, Kumar BV, Verma R. Evaluation of immuno-modulating effect of recombinant heat shock protein 40 of Brucella abortus in mice. 3 Biotech 2019;9:366. [Google Scholar]
  • [27].Wong HK, Muftuoglu M, Beck G, et al. Cockayne syndrome B protein stimulates apurinic endonuclease 1 activity and protects against agents that introduce base excision repair intermediates. Nucleic Acids Res 2007;35:4103–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Ohnishi K, Ohkura S, Nakahata E, et al. Non-specific protein modifications by a phytochemical induce heat shock response for self-defense. PLoS One 2013;8:e58641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Espirito-Santo MCC, Sanchez MCA, Sanchez AR, et al. Evaluation of the sensitivity of IgG and IgM ELISA in detecting Schistosoma mansoni infections in a low endemicity setting. Eur J Clin Microbiol Infect Dis 2014;33:2305–10. [Google Scholar]
  • [30].Zhang JF, Hou JF, Zhang J, et al. Cloning, expression, and bioactivity of recombinant chicken IGF-I. Agric Sci China 2006;5:462–67. [Google Scholar]
  • [31].Nilsson JA, Molokwu MN, Olsson O. Body temperature regulation in hot environments. PLoS One 2016;11:e0161481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Attia YA, Hassan RA, Tag El-Din AE, et al. Effects of ascorbic acid and amino acids on slow-growing chicks under heat stress. J Anim Physiol Anim Nutr 2011;95:744–55. [Google Scholar]
  • [33].Purswell JL, Dozier WA, III, Olanrewaju HA, et al. Effect of temperature-humidity index on broiler performance aged 49 to 63 days. IX Int Livest Environ Symp 2012;3:Spain. [Google Scholar]
  • [34].Shakeri M, Cottrell JJ, Wilkinson S, et al. Betaine and antioxidants improve growth and thermoregulation under heat stress. Animals 2018;8:162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Zeferino CP, Komiyama CM, Pelícia VC, et al. Effects of Vitamins C and E on meat quality under heat stress. Anim 2016;10:163–71. [Google Scholar]
  • [36].Aengwanich W. Effects of high temperature on body temperature in Thai chickens. Asian J Poult Sci 2008;2:48–52. [Google Scholar]
  • [37].Shanmathy M, Tyagi JS, Gopi M, et al. Seasonal variation effects on respiration and core body temperature in Aseel and Kadaknath. Indian J Poult Sci 2017;52:189–92. [Google Scholar]
  • [38].Zuo J, Xu M, Abdullahi YA, et al. Heat stress reduces skeletal muscle protein deposition in broilers. J Sci Food Agric 2015;95:429–36. [DOI] [PubMed] [Google Scholar]
  • [39].Xu Y, Lai X, Li Z, et al. Effects of chronic heat stress on physiological and immunological traits in broilers. Poult Sci 2018;97:4073–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [40].Ma B, He X, Lu Z, et al. Chronic heat stress impairs muscle hypertrophy and amino acid uptake via IGF-mTOR pathway. Poult Sci 2018;97:4150–58. [DOI] [PubMed] [Google Scholar]
  • [41].Humam AM, Loh TC, Foo HL, et al. Effects of postbiotics on broiler performance under heat stress. Animals 2019;9:644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [42].Barbour EK, Tayeb I, Shaib H, et al. Physiological and carcass traits in heat-stressed broilers differing in heat acclimatization, chemical or feed restriction treatments. Agric Biol J N Am 2010;1:65–74. [Google Scholar]
  • [43].Gabillard JC, Weil C, Rescan PY, et al. Effects of environmental temperature on IGF1, IGF2, and IGF type I receptor expression in rainbow trout (Oncorhynchus mykiss). Gen Comp Endocrinol 2003;133:233–42. [DOI] [PubMed] [Google Scholar]
  • [44].Indian Virological Society. Abstracts of the papers presented at VIROCON 2023 on “Advancements in global virus research towards one health,” 1–3 December 2023, ICAR-national research centre for banana, Tiruchirappalli, India. Virus Dis 2024;35:69–229. [Google Scholar]
  • [45].Singh KP, Kumar BVS, Dubey PP, et al. Heat shock protein B1 and NADPH oxidase 4 expression is associated with vital signs and antioxidant parameters in two different varieties of turkey under thermal stress. Res Vet Sci 2025;193:105769. [DOI] [PubMed] [Google Scholar]
  • [46].Jia J, Ahmed I, Liu L, et al. Selection for growth traits alters somatotropic gene profiles in chickens. PLoS One 2018;13:e0195378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [47].Renaudeau D, Collin A, Yahav S, et al. Adaptation of livestock to hot climates. Animal 2012;6:707–28. [DOI] [PubMed] [Google Scholar]
  • [48].Sejian V, Bhatta R, Gaughan JB, et al. Review: adaptation of animals to heat stress. Animal 2018;173:57–70. [Google Scholar]
  • [49].Hayes BJ, Bowman PJ, Chamberlain AJ, et al. Genomic selection in dairy cattle: progress and challenges. J Dairy Sci 2008;92:433–43. [Google Scholar]
  • [50].Porto-Neto LR, Reverter A, Prayaga KC, et al. The genetic architecture of climatic adaptation of tropical cattle. PLoS ONE 2014;9:e113284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [51].Hoffmann I. Climate change and the characterization, breeding and conservation of animal genetic resources. Anim Genet 2010;41:32–46. [DOI] [PubMed] [Google Scholar]
  • [52].Hoffmann I. Adaptation to climate change – exploring the potential of locally adapted breeds. Animal 2013;7:346–62. [DOI] [PubMed] [Google Scholar]
  • [53].Agha RA, Mathew G, Rashid R, et al. TITAN Group. Transparency in the reporting of Artificial Intelligence – the TITAN guideline. Prem J Sci 2025;10:100082. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data are available from the corresponding author upon reasonable request.


Articles from Annals of Medicine and Surgery are provided here courtesy of Wolters Kluwer Health

RESOURCES