Poecilobdella manillensis ameliorates atherosclerosis by inhibiting endothelial cell pyroptosis

Abstract

Objective

Leeches and other herbs may improve atherosclerosis symptoms. This study explores Poecilobdella manillensis'effect on AS.

Methods

In vivo used high-fat diet + rabbit carotid balloon injury model, with Poecilobdella manillensis at 0.1, 0.4, 0.8 g/day. In vitro, aortic endothelial cells were treated with ox-LDL to establish AS model, then with animal group sera to assess P.manillensis effects on AS and explore mechanisms.

Results

The in vivo findings indicated that P.manillensis is capable of lowering blood lipid levels and exhibiting anti-thrombotic properties. Additionally, P.manillensis significantly alleviated pathological damage and lipid deposition in the common carotid artery, and reduced apoptosis of the common carotid artery smooth muscle cells. Further assays revealed that P.manillensis markedly decreased the levels of PI3K, p-AKT, NF-κB p65, NLRP3, Caspase-1, eNOS, GSDMD, IL-1β, and IL-18. In vitro results demonstrated that serum containing P.manillensis significantly enhanced cell activity and ATP production while decreasing the apoptosis rate, IL-1β, IL-18, LDH, and ROS, PI3K, p-AKT, NF-κB p65, NLRP3, Caspase-1, GSDMD, and ASC levels.

Conclusion

Both in vivo and in vitro studies have confirmed that P.manillensis ameliorates endothelial damage and inflammatory responses in AS, with involvement of the PI3K/AKT and NF-κB signaling pathways.

Graphical abstract

Highlights

• •P.manillensis improves atherosclerotic common carotid artery balloon endothelial damage.
• •P.manillensis inhibits inflammatory damage in rabbits with atherosclerosis.
• •P.manillensis significantly improves atherosclerotic endothelial cell damage.
• •P.manillensis improves the inflammatory response of atherosclerotic endothelial cells.

1. Introduction

Atherosclerosis (AS) serves as a significant pathological basis for numerous cardiovascular and cerebrovascular diseases [1,2], and it constitutes one of the primary risk factors for cardiovascular disease-related deaths globally. Conditions such as coronary heart disease, myocardial infarction, and stroke induced by AS rank among the leading causes of mortality in China, posing a serious threat to the health and safety of the general public [3]. Currently, commonly used clinical treatments for AS include statins, aspirin, clopidogrel, and proprotein convertase subtilisin/kexin type 9 inhibitors [4]. Surgical interventions encompass balloon dilatation, stenting, and bypass grafting. Although the diverse therapeutic approaches can slow the progression of AS to some extent, cardiovascular and cerebrovascular diseases resulting from AS remain leading causes of death and disability globally. Chinese medicines, characterized by their multi-target, multi-pathway, and multi-link approaches, offer unique advantages in the prevention and treatment of atherosclerosis, presenting relatively few adverse effects. They have been increasingly utilized in the prevention and management of AS in recent years [5].

Leeches have long been used in traditional medicine to promote blood circulation and reduce stasis, dating back to their mention in Shennong Ben Cao Jing [6]. According to the Chinese Pharmacopoeia (2020 edition), medicinal leeches are sourced from Hirudo nipponica, Whitmania pigra, and W. acranulata [7]. In contemporary medical treatments, leeches are frequently utilized alongside various herbal remedies, including Cerebro-Cardiac Capsules and Tongxinluo Capsules [8,9]. Furthermore, medical leech extract has been shown to enhance endothelial cell function in vitro and mitigate atherosclerosis in ApoE-deficient mice by decreasing macrophage presence in lesions [10]. Leeches may suppress vascular smooth muscle cell proliferation and induce apoptosis by lowering lipid levels and inhibiting TGF-β1, thereby modulating p38MAPK pathway protein expression. This mechanism likely inhibits intimal thickening and plaque formation, slowing early AS progression [11]. These findings suggest that leech extracts possess anti- AS properties. The Poecilobdella manillensis, a member of the Hirudinidae family originating from Southeast Asia and southern China, has demonstrated the most potent antithrombotic effects, followed by the Japanese medical leech, the European medical leech, and the broad-bodied golden leech, which exhibit the weakest antithrombotic effects. However, there is a notable lack of research on the P.manillensis in relation to AS, and its precise mechanism of action remains unclear.

AS is influenced by multiple factors, and the AS resulting from a single factor may differ significantly from that observed in humans. Consequently, researchers have increasingly emphasized the use of composite methods to construct AS models [12]. Prolonged high-fat feeding primarily induces AS plaques in the abdominal aorta but is less effective in the common carotid artery. In contrast, combining high-fat feeding with intima-media balloon injury effectively establishes an AS model. This approach not only targets specific sites for AS plaque formation but also accelerates the development of AS plaques [13]. Research indicates that hyperlipidemia triggers an inflammatory immune response, resulting in endothelial injury, a critical initiating event in AS development [14,15]. Balloon injury to the arterial endothelium is an interventional procedure in which a balloon is inserted into the target vessel, resulting in the mechanical destruction of arterial endothelial cells through expansion and dragging of the balloon [16]. This process exposes exogenous coagulation substances located beneath the endothelial cells, leading to platelet aggregation on the damaged vessel wall. This technique can shorten the construction period of the AS plaque model and precisely localize the lesion, making it a widely utilized method for AS plaque model construction at present [13,17].

This study explored the anti-AS effects of P. manillensis In vivo, a rabbit model of AS was established through high-fat feeding and carotid artery balloon injury, followed by treatment with varying doses of Poecilobdella manillensis In vitro, aortic endothelial cells were exposed to ox-LDL to simulate AS conditions, and cell cultures were further treated with serum from the in vivo experimental groups. These combined approaches were designed to investigate the therapeutic potential and mechanisms of Poecilobdella manillensis against AS.

2. Materials and methods

2.1. Materials

2.1.1. Main reagents

The main reagents used in this study are categorized below based on their applications:

(1) Animal Modeling and Drug Intervention:Poecilobdella manillensis Lyophilized Powder (Yunnan Hairidi Biopharmaceutical Co.)、Aspirin Enteric-Coated Tablets (Bayer HealthCare Company Ltd.)、Clopidogrel (Sanofi Pharmaceuticals Co., Ltd.)、Atorvastatin Calcium Tablets (Pfizer Pharmaceuticals Co., Ltd.); (2) Histological and Cellular Staining Reagents:Hematoxylin-Eosin (HE) Staining Kit (Solarbio, G1120)、Oil Red O (ORO) Staining Kit (Solarbio, G1261); (3) Biochemical Index Detection Kits:Total Cholesterol (T-CHO) Test Kit (Nanjing Jiancheng Bioengineering Institute, A111-1-1)、Triglyceride (TG) Assay Kit (Nanjing Jiancheng, A110-1-1)、High-Density Lipoprotein Cholesterol (HDL-C) Test Kit (Nanjing Jiancheng, A112-1-1)、Low-Density Lipoprotein Cholesteroloprotein Cholesterol (LDL-C) Test Kit (Nanjing Jiancheng, A113-1-1)、Nitric Oxide (NO) Content Detection Kit (Solarbio, BC1475)、Adenosine Triphosphate (ATP) Assay Kit (Solarbio, BC0300); (4) ELISA Kits:Lactate Dehydrogenase (LDH) ELISA Kit (Shanghai Enzyme Link, ml090203)、Interleukin-1β(IL-1β) ELISA Kit (ml027836)、Interleukin-18 (IL-18) ELISA Kit (ml027833)、Endotheline-1 (ET-1) ELISA Kit (ml027981)、C-Reactive Protein (CRP) ELISA Kit (ml080728); (5) Western Blot Antibodies:Primary Antibodies: β-actine (Zhongshan Goldbridge, TA-09); Caspase-1 (Affinite, DF6148); NF-κB p65 (Biossynthese, bs-0465R); NLRP3 (Biossynthese, bs-23723R); GSDMD (Biossynthese, bs-14287R); PI3K (Biossynthese, bs-10657R); Akt (Biossynthese, bs-6951R); Phosphorylate-Akt (p-Akt) (Biossynthese, bs-5182R); ASC (Biossynthese, bs-6741R); VEGFE (Biossynthese, bs-1665R); eNOS1 (Biossynthese, bs-3978R)、Secondary Antibodies: Horse Radish Peroxide (HRPE)-Conjugate Anti-Rabit IgGE (Cell Signaling Technologie (CSTE), #7074, #7076); Daylite 488 Labelle Goate Anti-Rabit IGG (KPL), 5230-0385); (6) Cell Culture and Functional Analysis Functional Analysis Reagents:Cell Countinge Kit-8 (CCKE-8) (Solarbio, CA1210)、One-Stepe Apoptosise Detectione Kit (Reade Lite) (Beiyoutime, C1089)、Flourometric Intra-cellular Reactive Oxygen Species (ROSE) Activitie Assaye Kit (ATE Bioquest, 22904); (7) Molecular Biology-Related Reagents:Totale Ribonucleice Acid (RNA) Extractionne Kit (Inviterogen,10176864)、Superscripte III Reverese Transcripitione Kit (Inviterogen,18080093)、SYBR Green/ROX qPCR.) Master Mixe (Life Technologies,11883913)、Primeres for RELA, CASP1, NLRP3, PIK3CA., AKT1, GSDMD., and GAPDH. (Sangone Bioteche (Shangehaie) Co., Ltd.)

2.1.2. Instruments

The following instruments were utilized in this study: CA-500 automatic blood coagulation analyzer (Sysmex, Japan), enzyme labeling instrument (SPECTCA MAX190, USA), UV Visible Spectrophotometer (HITACHI, Japan), Fluorescence Microscope (Olympus BX53, Japan), and Flow Cytometer FACSCanto II (BD, USA).

2.1.3. Animal and cell sources

Thirty-six healthy adult rabbits from New Zealand, males, weighing 1.2–1.8 Kg, were purchased from Beijing Specific, Animal License No. SCXK (Beijing) 2019-0010. This experiment was approved by the Animal Ethics Committee of Kunming Medical University. Rabbit aortic endothelial cells were purchased from Procell (Wuhan, China). This project was approved by the Ethics Committee of Kunming Medical University (kmmu2021069).

2.1.4. Preparation of the freeze-dried powder of Poecilobdella manillensis

Healthy 3-year-old artificially farmed Poecilobdella manillensis were selected as raw materials. The leeches were first rinsed with sterile normal saline to remove surface impurities, then fixed by ultra-low temperature freezing at −80 °C for 24 h. Subsequently, they were subjected to vacuum freeze-drying (at a temperature of −50 °C and a vacuum degree of 10 Pa) for 48 h until the water content was reduced to less than 5 %. The dried leeches were then ultrafinely pulverized and passed through a 100-mesh sieve to obtain a uniform powder. The resulting powder was packaged into sealed aluminum foil bags (10 g per bag) and stored at 4 °C in the dark. For the experiment, the powder was directly dissolved in normal saline and administered to animals via gavage.

2.2. Animal experimental methods

2.2.1. Construction and grouping of animal models

Following a one-week acclimatization, rabbits were randomly divided into six groups (n = 6 per group): (1) Sham (normal diet + sham surgery), (2) Model (high-fat diet), (3) LD (high-fat diet + low-dose Poecilobdella manillensis), (4) MD (high-fat diet + medium-dose Poecilobdella manillensis), (5) HD (high-fat diet + high-dose Poecilobdella manillensis), and (6) ACA (high-fat diet + aspirin, clopidogrel, and atorvastatin).

In the sham operation group, only the right common carotid artery, external carotid artery, and internal carotid artery were isolated without the delivery of a balloon, followed by a standard normal diet. The remaining five groups underwent balloon injury surgery and were fed a high-fat diet. Two weeks later, the low-dose (LD), medium-dose (MD), and high-dose (HD) groups were administered Poecilobdella manillensis lyophilized powder via oral gavage at doses of 0.1, 0.4, and 0.8 g/day, respectively. The powder was dissolved in normal saline, with a gavage volume of 1 mL per kg of body weight. For the positive control (ACA) group, a mixed solution containing enteric-coated aspirin tablets (125 mg/day), clopidogrel (62.5 mg/day), and atorvastatin calcium tablets (5 mg/day) was administered via oral gavage. After ten days of treatment, the rabbits were anesthetized and euthanized, followed by the collection of common carotid artery tissues and whole blood from the carotid artery.

2.2.2. Preparation of drug-containing serum of Poecilobdella manillensis

In the final administration of the drug, two animals from each group were selected and subjected to a 12 h fasting period. Subsequently, they were administered either P.manillensis or an equal volume of saline via gavage. One hour after gavage, carotid artery blood samples were collected and centrifuged at 2500 r/min for 25 min at 4 °C to isolate serum. The serum was sterilized by filtration through a 0.22 μm membrane, aliquoted, and stored at −20 °C for subsequent analysis.

2.2.3. Coagulation function measurement

The prepared plasma was utilized to assess in vitro PT, TT, APTT, and FIB using a CA-500 automatic blood coagulation analyzer.

2.2.4. Blood biochemistry tests

TC, TG, LDL-C, HDL-C, and NO were measured according to the manufacturer's instructions.

2.2.5. ELISA Kit assays

The levels of lactate dehydrogenase (LDH), C-reactive protein (CRP), interleukin-1β (IL-1β), and interleukin-18 (IL-18) in rabbit serum were determined using the corresponding enzyme-linked immunosorbent assay (ELISA) kits, strictly following the manufacturers' protocols.

2.2.6. HE staining

Paraffin-embedded carotid artery sections were deparaffinized, rehydrated, and stained with hematoxylin for 5 min. After differentiation (2 s) and tap water rinsing (15 min), tissues were counterstained with eosin (3 s), dehydrated through an ethanol gradient, and cleared in xylene for 30 min. Sections were mounted with neutral gum for microscopic examination of pathological changes.

2.2.7. Oil Red O staining

Carotid artery frozen sections were rewarmed, dried, and fixed in 4 % paraformaldehyde for 15 min. After rinsing with tap water and drying, sections were stained with ORO for 8–10 min. Afterward, the section was removed and immersed in two tanks of 60 % isopropanol for differentiation, with durations of 3 and 5 s. The tissue was then immersed in two tanks of purified water for 10 s to wash. Following this, the section was stained with hematoxylin, sealed, and analyzed. ORO-positive staining area (%) = ORO-positive area/total area × 100 %. ORO-positive areas were quantified using ImageJ software following image acquisition.

2.2.8. Tunel staining

Paraffin sections of common carotid artery tissue were prepared, dehydrated, and cleared. Cell crawls were fixed with 4 % paraformaldehyde at room temperature for 30 min. A solution of 20 μg/ml Proteinase K was applied at 37 °C for 30 min, followed by incubation at room temperature for 20 min. The sections were rinsed with PBS, and 50 μl of Tunel was added dropwise, after which they were incubated at room temperature for 1 h. After incubation with a peroxidase-converting agent for 30 min via dropwise addition, the tissue sections underwent three sequential PBS rinses (5 min each) to remove unbound reagents. Chromogenic detection was performed using 3,3′-diaminobenzidine (DAB) under controlled light conditions, followed by counterstaining with hematoxylin for nuclear visualization. Subsequently, the samples were dehydrated through an ethanol gradient (70 %, 85 %, 95 %, and 100 %), cleared in xylene, and mounted with neutral gum for slide preservation. Microscopic images were acquired using a Nikon Eclipse Ci-L system (20× objective lens). Quantification of apoptosis was conducted by enumerating TUNEL-positive cells (brown-stained nuclei) across five randomly selected fields per section. The apoptotic index was calculated as follows: Apoptotic index (%) = (Number of TUNEL-positive cells/Total nucleated cells) × 100 %.

2.2.9. Immunofluorescence

For tissue specimens, the common carotid artery tissues were fixed in 4 % paraformaldehyde solution. Afterward, these tissues were processed for paraffin embedding and sectioning. The obtained tissue sections were subjected to xylene dewaxing, followed by gradient alcohol dehydration to remove water. Subsequently, antigen retrieval was carried out. After that, the sections were rinsed three times with PBS, with each rinse lasting for 5 min. Following this, the slides were permeabilized with 0.2 % Triton X-100 for 20 min at room temperature, after which they were rinsed in PBS for 5 min, repeated three times. Histochemical staining was performed on the tissue sections and the slides, and serum was applied for 30 min to block nonspecific binding. The first primary antibodies (VEGF, Caspase-1, GSDMD at a dilution of 1:200, Caspase-1 and GSDMD at a dilution of 1:80) were added dropwise and incubated overnight in a wet box at 4 °C. Subsequently, the fluorescein - tagged secondary antibody specific to the primary antibody (goat anti - rabbit, diluted to a ratio of 1:300) was added in a dropwise manner. The sample was then incubated in the dark at room temperature for 50 min. The samples were rinsed with PBS three times, each for 5 min, and the nuclei of the cells were re-stained with DAPI, followed by a 10 min incubation at room temperature in the dark. The slides were rinsed with PBS three times before sealing. Images were observed and photographed using a microscope, and the fluorescence intensity of the images was analyzed using Image J.

2.2.10. Immunohistochemical staining

Tissue samples of the common carotid artery were fixed in a 4 % paraformaldehyde solution, routinely paraffin-embedded, and sectioned. The sections were then deparaffinized to water, subjected to antigen retrieval. Subsequently, antibodies against eNO1, NF-κB p65, and NLRP3 (1:200) were applied and incubated overnight at 4 °C. After that, the anti - rabbit secondary antibody, diluted at a ratio of 1:500, was added and incubated at room temperature for 1 h. Subsequently, streptavidin conjugated with biotin, also at a dilution of 1:500, was added. The staining of the samples was then carried out in accordance with the guidelines of the DAB staining kit. The samples were subsequently restained with hematoxylin, dehydrated using ethanol, permeabilized with xylene, sealed, and fixed, before being photographed under a microscope.

2.2.11. Western Blot

Rabbit aortic tissue or cells were frozen at −80 °C, followed by supernatant extraction and protein quantification. The 8 % or 10 % SDS-PAGE gel were prepared for protein electrophoresis. Once the membrane transfer was completed, the membrane was blocked using 5 % milk for a duration of 1 h. Subsequently, primary antibodies were added for an overnight incubation. The primary antibodies and their dilution ratios were as follows: PI3K at 1:1000, p - Akt at 1:1000, Akt at 1:1000, NF - κB p65 at 1:1000, NLRP3 at 1:1000, Caspase - 1 at 1:1000, and β - actin at 1:2000. On the next day, the membrane was washed three times with TBST. After that, it was incubated with a secondary antibody (diluted 1:2000) for 1 h. After three additional washes with TBST, ECL luminol solution was applied to the membrane, and a gel imaging system was utilized for exposure and development. The relative protein expression of each group of target proteins was analyzed using Image J software.

2.2.12. RT-qPCR

An appropriate amount of common carotid artery tissue and endothelial cell samples were collected from rabbits in each group. After adding Trizol reagent, the samples were placed on ice and ground to achieve homogenization. After phase separation with chloroform, precipitation with isopropanol, and washing with 75 % ethanol, RNA pellets were obtained. The pellets were dissolved in RNase-free water, and the purity and concentration of RNA were determined using a micro-spectrophotometer before storage at −80 °C for subsequent use. cDNA was synthesized using a reverse transcription kit under the following conditions: reverse transcription at 37 °C and inactivation of reverse transcriptase at 85 °C. The synthesized cDNA was stored at −20 °C. Specific primers for rabbit target genes (RELA, GSDMD, CASP1, AKT1, NLRP3, PIK3CA) and the internal reference gene GAPDH were designed and synthesized based on their respective mRNA sequences retrieved from GenBank (see Table 1 for primer sequences). Quantitative real-time PCR (qPCR) was performed using a qPCR kit on a real-time fluorescent quantitative PCR instrument, consisting of pre-denaturation, denaturation-annealing-extension cycles, and final verification of primer specificity via a melting curve analysis. The relative expression levels of each target gene were calculated using the 2^(-ΔΔCt) method, with GAPDH serving as the internal reference gene.

Table 1.

Primer sequences.

gene name	Forward	Reverse
RELA	GAACCTGGGGATCCAGTGTG	GTTCACCCGGCAGATCTTGA
CASP1	TCCTAGTGTTCATGTCTCATGGT	TGTGGGCTATCCTACTGGCA
NLRP3	TGAGGAGCTGGACCTCAAGA	TGGCATATCACAGTGGCGTT
PIK3CA	ACGCATCTCCACTGCTACAC	AGCCATTCATTCCACCTGGG
AKT1	CTCAAGAAGGACCCCAAGCA	CACGCACTCCATGCTGTCAT
GSDMD	CAGCCGGAACCCAAAATCCTG	GTCCCAGTCAGAGCCAATGA
GAPDH	CGAGCTGAACGGGAAACTCA	CCCAGCATCGAAGGTAGAGG

2.3. Cell experimental methods

2.3.1. Cell culture and grouping

Rabbit aortic endothelial cells were cultured in high-glucose DMEM medium supplemented with 5 % fetal bovine serum (FBS). The medium was refreshed every two days. When the cells reached 80 %–85 % confluence (adherent state), they were digested with trypsin for subculture. After sufficient subculture and expansion, cells in the logarithmic growth phase were exposed to oxidized low-density lipoprotein (ox-LDL) at a concentration of 100 μg/mL for 24 h to establish the atherosclerotic cell model.The modeled cells were divided into six groups: Control (Ctl), ox-LDL, ox-LDL + low-dose Poecilobdella manillensis (LD), ox-LDL + medium-dose Poecilobdella manillensis (MD), ox-LDL + high-dose Poecilobdella manillensis (HD), and ox-LDL + positive control (ACA). After 24 h of ox-LDL induction, the original medium was discarded. Subsequently, the prepared drug-containing sera (including sera from the low-, medium-, and high-dose Poecilobdella manillensis groups and the ACA positive control group) as well as sera from the sham-operated group and model group were diluted at a 10 % volume ratio (100 μL serum + 900 μL medium) in high-glucose DMEM medium containing 5 % FBS. These diluted serum-media mixtures were then added to the corresponding cell groups for treatment, respectively. After a 24 h incubation period, cell morphology was observed under a microscope.

2.3.2. CCK-8 kit

The cell suspension was prepared to have a density of 3 × 10³ cells per well. The wells containing the cell suspension were then incubated at 37 °C in an environment with 5 % CO₂ until the cells adhered to the well walls. After that, 10 μL of CCK - 8 solution was added to each well. The incubation was prolonged for another 4 h. Finally, the absorbance value of each well at a wavelength of 450 nm was measured.

2.3.3. Determination of ATP, LDH, IL-1β, and IL-18 by ELISA

Cells were collected from each group and lysed on ice using RIPA buffer supplemented with PMSF. The cell supernatant was then collected, and the levels of ATP, LDH, IL-1β, and IL-18 in each group were measured according to the instructions provided by the ELISA kit.

2.3.4. Flow cytometry

The supernatants from the cells in each group were collected and subsequently mixed with 10 μmol/L 2′,7′-dichlorofluorescein diacetate (DCFH-DA) for 30 min, ensuring that the procedure was conducted in a light-avoiding environment. The mixture was then transferred into a flow tube for analysis. The fluorescence intensity was measured using flow cytometry to evaluate the intracellular levels of ROS.

2.3.5. Immunocytochemistry

The cells were fixed in 4 % paraformaldehyde and rinsed with PBS for 5 min, with this rinse step repeated three times. Next, cell permeabilization was carried out using Triton X - 100 at room temperature for 20 min. After that, they were rinsed with PBS for 5 min, and this rinsing process was repeated three times. Subsequently, 5 % normal sheep serum was added, and the cells were incubated in a 37 °C oven for 60 min. The excess serum was shaken off, and then antibodies against NF-κB p65 (1:100) and NLRP3 (1:100) were added and incubated at 4 °C overnight. Following this, the cells were rinsed with PBST solution for 5 min, and this rinse was repeated four times. PV9000 reagent (polymer adjuvant) was added dropwise and incubated at 37 °C for 30 min. Then, the cells were rinsed with PBST solution for 5 min, repeated three times. PV9000 reagent (enzyme - labeled sheep anti - mouse/rabbit) was added dropwise and incubated at room temperature for 1 h. Finally, the cells were rinsed once more with PBST solution for 5 min, with this rinse repeated four times. Color development was performed using DAB for 1–2 min at room temperature, and the process was terminated with distilled water. Hematoxylin re-staining was conducted to stain the nuclei blue, involving immersion in Hematoxylin solution for 5 min, followed by a wash with tap water to remove excess dye, and a brief decolorization with 1 % hydrochloric acid ethanol for 2 s before a final wash. The samples were then dehydrated and sealed, after which they were observed under a microscope and photographed.

2.4. Statistical methods

Statistical analysis was performed with SPSS 22.0. Measurement data were expressed as mean ± standard deviation (SD). For data following a normal distribution, one - way ANOVA was used for comparisons among multiple groups, and the LSD test was applied for pairwise comparisons. In contrast, when the data did not follow a normal distribution, the non - parametric rank sum test was adopted. A p - value < 0.05 was regarded as statistically significant.

3. Results

3.1. Poecilobdella manillensis significantly improves atherosclerotic common carotid artery balloon endothelial damage in rabbits

Coagulation parameters, including prothrombin time (PT), activated partial thromboplastin time (APTT), and thrombin time (TT), are crucial indicators of the extrinsic and intrinsic coagulation pathways. Ten days after treatment with Poecilobdella manillensis, blood samples were collected for coagulation analysis. The results revealed a significant shortening of PT, TT, and APTT, along with a marked increase in fibrinogen (FIB) levels in the model group compared to the sham-operated group. Intervention with Poecilobdella manillensis or the positive control drug partially reversed these changes (Fig. 1A–D), demonstrating its potent antithrombotic effects.Dyslipidemia is a fundamental causative factor in atherosclerosis. Biochemical examinations further indicated a significant elevation in the levels of TC, TG, LDL-C, and CRP, along with a significant decline in HDL-C. Compared with the control group that did not receive surgical treatment (Fig. 1E–I), these changes were partially reversed after intervention with P.manillensis or the active drug. This indicates that P.manillensis has a lipid-lowering effect, which is crucial for preventing the progression of atherosclerosis. HE staining of the injured segment of the carotid artery indicated that the vessel wall in the sham-operated group appeared smooth, with only a single layer of endothelial cells observed in the intima and no signs of intimal hyperplasia. In contrast to the sham-operated group, significant migration and proliferation of carotid smooth muscle cells were evident in the model group, with intimal hyperplasia resulting from vascular endothelial injury. Additionally, an increase in foam cells was noted at the neoplastic endothelium, which was covered with fibroblasts. Following the intervention with P.manillensis across all dose groups, as well as the positive drug group, a reduction in vascular smooth muscle fibers was observed, and the inner wall of the vessel exhibited a tendency towards a normal structure. Notably, the effects were more pronounced in the high-dose P.manillensis group and the positive drug control group (Fig. 1L, upper panel). It indicates that P.manillensis has a protective effect in preventing vascular damage and remodeling. Oil Red O staining can directly show the situation of lipid deposition.ORO staining revealed no red staining in the endothelial cells of the sham-operated group.Conversely, numerous red lipid droplets were detected in the endothelial cells of the model group. This finding demonstrated lipid deposition, thereby suggesting the initiation of early - stage atherosclerosis. Following the intervention with low, medium, and high doses of P.manillensis, as well as the positive control group, a reduction in lipid droplet content within the endothelial cells was noted, with the most pronounced improvement observed in the high dose group of P.manillensis and the positive control group (Fig. 1L, middle panel, 1M). It indicates that P.manillensis can reduce the local lipid accumulation within the blood vessel walls. Tunel staining can detect the markers of cell apoptosis.Tunel staining results demonstrated that in the Sham group, there was very little apoptosis in the smooth muscle cells of the rabbit common carotid artery. In contrast, the model group had the highest levels of apoptosis. Significantly, compared to the model group, apoptosis in the smooth muscle cells was markedly decreased in all the drug - treated groups (Fig. 1L, lower panel, 1N),and this reduction was dose-dependent.It indicates that P.manillensis promotes the survival of vascular smooth muscle cells, which may help stabilize atherosclerotic plaques. Endothelial dysfunction is a key initiating event of atherosclerosis. We evaluated the key endothelial mediators: VEGF promotes endothelial repair and angiogenesis, NO is a vascular-protective molecule with anti-inflammatory and vasodilatory effects, and ET-1 is a potent vasoconstrictor and pro-inflammatory factor.ELISA and immunofluorescence analyses revealed that, compared to the sham - operated group, the model group had a decrease in the concentration of NO and VEGF, while the concentration of ET - 1 increased. This concentration pattern was partially reversed following interventions with P.manillensis or the positive drug (Fig. 1J–K, 1O-P). Collectively, these findings suggest that the P.manillensis exerts an inhibitory effect on atherosclerosis following carotid artery injury in rabbits, as well as a protective effect on the vascular endothelium in balloon-injured rabbits.

Fig. 1.

Poecilobdella manillensis significantly ameliorates endothelial injury induced by balloon denudation of the common carotid artery in atherosclerotic rabbits.

After 10 days of corresponding interventions, common carotid artery tissues and whole blood samples were collected from rabbits in each group for analysis. The following parameters were measured using a CA-500 fully automated coagulation analyzer: (A) Prothrombin Time (PT), (B) Thrombin Time (TT), (C) Activated Partial Thromboplastin Time (APTT), and (D) Fibrinogen (FIB). Biochemical kits were used to determine levels of (E) Total Cholesterol (TC), (F) Triglycerides (TG), (G) Low-Density Lipoprotein Cholesterol (LDL-C), and (H) High-Density Lipoprotein Cholesterol (HDL-C). ELISA kits were employed to measure concentrations of (I) C-Reactive Protein (CRP) and (K) Endothelin-1 (ET-1); (J) Nitric Oxide (NO) content was assessed using a specific assay kit. (L) Representative images of common carotid artery tissue staining (Top row: H&E staining, scale bar = 50 μm; Middle row: Oil Red O staining, scale bar = 50 μm; Bottom row: TUNEL staining, scale bar = 20 μm). (M) Quantitative analysis of the percentage area positive for Oil Red O staining was performed using ImageJ software. (N) Statistical analysis of the apoptotic index based on TUNEL staining. (O) Representative immunofluorescence images of Vascular Endothelial Growth Factor (VEGF) expression (Green fluorescence indicates VEGF-positive signal, blue fluorescence represents DAPI-stained nuclei, scale bar = 20 μm). (P) Quantitative analysis of VEGF immunofluorescence intensity was conducted using ImageJ software.Sham: sham-operated group. Model: Atherosclerosis model group. LD: The low-dose group of Poecilobdella manillensis. MD: The medium-dose group of Poecilobdella manillensis. HD: The high-dose group of Poecilobdella manillensis. ACA: Positive drug control group. All statistical results are expressed as Mean ± SD, n = 6. Significant differences compared to the Sham group or the Model group are indicated as follows: ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; "ns"indicatesno significant difference.

3.2. Poecilobdella manillensis significantly inhibits inflammatory damage of common carotid artery balloon in rabbits with atherosclerosis

To elucidate the molecular mechanisms underpinning the anti-atherosclerotic effects of Poecilobdella manillensis, we focused on the PI3K/AKT/NF-κB signaling axis and its critical downstream effector—the NLRP3 inflammasome, a multiprotein complex central to inflammatory activation and pyroptotic cell death.We detected the protein expression levels of key signaling molecules in rabbit arterial tissues using Western blotting. The results showed that compared with the sham-operated control group, the protein expression levels of PI3K, phosphorylated AKT (p-AKT), NF-κB p65, NLRP3, and Cleaved Caspase-1 in the model group were significantly elevated (Fig. 2A).Meanwhile, immunohistochemical analysis was performed to examine the expression of relevant molecules. The results demonstrated that the positive protein expression levels of eNO1, NF-κB p65, and NLRP3 in the model group were significantly higher than those in the sham-operated control group (Fig. 2D). Immunofluorescence analysis further substantiated these observations, revealing markedly intensified fluorescence signals of Caspase-1 and GSDMD in the model group (Fig. 2E and F), indicating the activation of this pro-inflammatory signaling cascade. Furthermore, the concentrations of the activated Caspase-1 processing effect cytokines - namely IL-1β and IL-18 - in the serum of the model group also significantly increased (Fig. 2G), corroborating the functional output of inflammasome activation.Complementing these proteomic findings, RT-qPCR analysis showed substantial upregulation in the mRNA expression levels of RELA, NLRP3, CASP1, AKT1, PIK3CA, and GSDMD in the model group (Fig. 2H–M). This transcriptional activation confirms that the pathogenesis of atherosclerosis entails augmented gene expression upstream of the observed protein alterations, thus establishing a comprehensive pathogenic pathway spanning from gene transcription to protein synthesis.Treatment with Poecilobdella manillensis or the positive control led to a dose-dependent attenuation of this signaling network at both transcriptional and translational levels. The reduction in PI3K and p-AKT levels suggests that the intervention interferes with the PI3K/AKT signaling hub. Concurrently, the diminished expression of NF-κB p65 and its downstream targets reflects suppressed transactivation of proinflammatory genes. Of particular importance, the pyroptosis executor GSDMD was also downregulated, implying diminished cellular membrane disruption and inflammatory demise.These synergistic inhibitory effects culminated in a significant reduction in serum levels of IL-1β and IL-18 (Fig. 2G). Taken together, the collective downregulation of these key biomarkers provides compelling evidence that Poecilobdella manillensis disrupts the PI3K/AKT/NF-κB/NLRP3 forward amplification loop. Therefore, our findings strongly support the conclusion that Poecilobdella manillensis alleviates AS-associated inflammation predominantly by targeting the upstream PI3K/AKT pathway, which in turn impedes NLRP3 inflammasome assembly and activation, ultimately suppressing Caspase-1-mediated endothelial pyroptosis and the consequent cytokine storm.

Fig. 2.

Poecilobdella manillensis significantly imroves inflammatory damage of common carotid artery balloon in rabbits with atherosclerosis.

Ten days after the corresponding interventions, common carotid artery tissues were collected from rabbits in each group to detect inflammation-related signaling pathways and protein expression:(A) Western Blot was used to determine the protein expression levels of PI3K, p-Akt, Akt, NF-κB p65, NLRP3, and Caspase-1 in common carotid artery tissues; (B) represents the statistical analysis results of the relative expression levels of each protein shown in (A); (C)Immunohistochemical staining was performed to detect the protein expression of NF-κB p65, NLRP3, and eNO1 in common carotid artery tissues (brown granular signals indicate positive expression of the target proteins, while blue signals represent cell nuclei counterstained with hematoxylin; scale bar = 20 μm); (D) represents the statistical analysis results of the positive expression levels of each protein presented in (C); (E) Immunofluorescence staining was employed to detect the protein expression of Caspase-1 and GSDMD in common carotid artery tissues (green fluorescence indicates Caspase-1- and GSDMD-positive signals, and blue fluorescence represents cell nuclei stained with DAPI; scale bar = 20 μm); (F) represents the statistical graph of the quantitative analysis of GSDMD and Caspase-1 immunofluorescence protein signals, quantified using ImageJ software (by measuring the mean fluorescence intensity of positive regions); (G) ELISA kits were utilized to measure the concentrations of IL-1β and IL-18 in serum; (H-M) Quantitative real-time polymerase chain reaction (RT-qPCR) was used to detect the relative mRNA expression levels of AKT1、CASP1、GSDMD、NLRP3、RELA and PIK3CA in common carotid artery tissues.Sham: sham-operated group. Model: Atherosclerosis model group. LD: The low-dose group of Poecilobdella manillensis. MD:The medium-dose group of Poecilobdella manillensis. HD: The high-dose group of Poecilobdella manillensis. ACA: Positive drug control group. All statistical results are expressed as Mean ± SD, n = 6. Significant differences compared to the Sham group or the Model group are indicated as follows: ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; "ns" indicates no significant difference.

3.3. Poecilobdella manillensis significantly improves atherosclerotic endothelial cell damage

To further verify the intervention effect of Poecilobdella manillensis extract on the endothelial damage caused by AS at the cellular level, an in vitro "rabbit aortic endothelial cells induced by ox-LDL" cell model was constructed. Through comparative analysis, the repair effect of the drug-containing serum of Phinomorphus worm extract on endothelial cell damage was clarified.The morphology of rabbit aortic endothelial cells was examined using an electron microscope. The results indicated that the aortic endothelial cells in the Control group exhibited a pike shape, oval form, and a well-organized arrangement resembling 'paving stones'. Additionally, the peripheral membranes of these cells were intact and displayed significant refractivity. In contrast, the cells in the Ox-LDL group appeared irregular, swollen, deformed, and ruptured, with condensed nuclei and visible cellular debris. Furthermore, the peripheral membranes of these cells exhibited weak refractivity (Fig. 3A). However, following treatment with drug-containing serum (P.manillensis low-, middle-, high-, a positive control), cell morphology showed a tendency to return to normal (Fig. 3A). CCK8 and Tunel staining results showed that, in contrast to the Control group, cellular activity significantly decreased and the apoptotic rate increased in the Ox - LDL group. Conversely, treatment with the drug - containing serum led to a significant rise in cellular activity and a reduction in apoptosis (Fig. 3B–D). Additionally, compared to the Control group, ATP production was notably lower in the Ox - LDL group, yet it increased following treatment with the drug - containing serum (Fig. 3E). ELISA and flow cytometry analyses indicated that, relative to the Control group, the levels of IL - 1β, IL - 18, LDH, and ROS were significantly higher in the Ox - LDL group. However, these levels were significantly decreased after treatment with the drug - containing serum(Fig. 3F–J). These results confirm that at the cellular level, Poecilobdella manillensis can significantly alleviate atherosclerosis (AS)-related endothelial cell damage through multiple pathways, specifically including improving cell morphology, enhancing cell viability, inhibiting cell apoptosis, restoring energy metabolism, reducing the release of inflammatory factors, and mitigating oxidative stress-induced damage.

Fig. 3.

Poecilobdella manillensis significantly improves atherosclerotic endothelial cell damage.

After rabbit aortic endothelial cells were induced with 100 μg/mL oxidized low-density lipoprotein (ox-LDL) for 24 h to establish an atherosclerotic cell model, each group was supplemented with the corresponding drug-containing serum for another 24 h of culture. Subsequently, analyses of cell morphology, viability, and injury-related indicators were performed:(A) Electron microscopy was used to observe the morphological characteristics of rabbit aortic endothelial cells in each group; (B) The CCK-8 assay was employed to determine the proliferative activity of cells in each group; (C) TUNEL staining was applied to detect cell apoptosis in each group (brown-stained cell nuclei indicate apoptotic positive cells, scale bar = 20 μm); (D) represents the statistical analysis results of the TUNEL staining apoptotic index in (C); (E) An ATP assay kit was used to measure the intracellular ATP production in each group; (F) ELISA kits were utilized to detect the concentration of IL-1βin the cell supernatant of each group; (G) ELISA kits were used to detect the concentration of IL-18 in the cell supernatant of each group; (H) ELISA kits were employed to detect the concentration of LDH in the cell supernatant of each group; (I) Flow cytometry was used to detect the level of intracellular reactive oxygen species (ROS) in each group; (J) represents the statistical analysis results of ROS fluorescence intensity in (I). Ctl:control group. ox-LDL: Atherosclerosis model group. ox-LDL-LD: The low-dose group of Poecilobdella manillensis. ox-LDL-MD:The medium-dose group of Poecilobdella manillensis. ox-LDL-HD: The high-dose group of Poecilobdella manillensis. ox-LDL-ACA: Positive drug control group. All statistical results are expressed as Mean ± SD, n = 3. Significant differences compared to the Sham group or the Model group are indicated as follows: ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; "ns" indicates no significant difference.

3.4. Poecilobdella manillensis significantly improves the inflammatory response of atherosclerotic endothelial cells

To further clarify the underlying molecular mechanisms, we detected the expression levels of key proteins in the PI3K/AKT and NF-κB signaling pathways using Western blotting and immunocytochemistry. The results showed that the levels of PI3K, phosphorylated AKT (p-AKT)、 NF-κB p65、 NLRP3、 caspase-1、 and ASC were significantly increased in the ox-LDL group; however, after Poecilobdella manillensis intervention, the expression of these proteins was notably inhibited (Fig. 4A–D). The expression levels of key pyroptotic proteins—gasdermin D (GSDMD) and caspase-1—were evaluated by immunofluorescence. Compared with the control group, the levels of caspase-1 and GSDMD were significantly higher in the ox-LDL group, and similarly, Poecilobdella manillensis intervention markedly suppressed the expression of these two proteins (Fig. 4E and F), further illustrating its direct role in inhibiting endothelial cell pyroptosis.We also analyzed the mRNA expression of core genes involved in inflammatory and pyroptotic pathways using RT-qPCR. As shown in Fig. 4G–M, compared with the control group, the expression levels of RELA, NLRP3, CASP1, AKT1, GSDMD, and PIK3CA genes were significantly upregulated in the ox-LDL group, while Poecilobdella manillensis treatment led to a dose-dependent downregulation of these genes. These findings collectively confirm, at both the transcriptional and protein levels, that Poecilobdella manillensis exerts anti-atherosclerotic (anti-AS) effects by inhibiting the activation of the PI3K/AKT and NF-κB pathways, thereby blocking the transduction of downstream inflammatory signals.

Fig. 4.

Poecilobdella manillensis significantly improves the inflammatory response of atherosclerotic endothelial cells.

After rabbit aortic endothelial cells were induced with 100 μg/mL oxidized low-density lipoprotein (ox-LDL) for 24 h to establish an atherosclerotic cell model, each group was supplemented with the corresponding drug-containing serum for another 24 h of culture. Subsequently, the expression levels of proteins and genes involved in inflammation-related pathways were detected:(A) Western Blot was used to detect the expression levels of PI3K, p-Akt, Akt, NF-κB p65, NLRP3, Caspase-1, and ASC proteins in cells of each group (with β-actin as the internal reference protein to normalize protein loading differences); (B) represents the statistical analysis results of the relative expression levels of each target protein in (A) (relative expression level = gray value of target protein band/gray value of β-actin band); (C) Immunocytochemistry staining was applied to detect the expression of NF-κB p65 and NLRP3 proteins in cells of each group (brown granules indicate positive expression signals of target proteins, blue represents cell nuclei counterstained with hematoxylin, scale bar = 20 μm); (D) represents the statistical analysis results of the positive expression levels of NF-κB p65 and NLRP3 proteins in (C) (the integrated optical density (IOD) of positive regions was quantified using ImageJ software); (E) Immunofluorescence staining was employed to detect the expression of Caspase-1 and GSDMD proteins in cells of each group (green fluorescence indicates positive signals of Caspase-1 and GSDMD, blue fluorescence represents cell nuclei stained with DAPI, scale bar = 20 μm); (F)represents the statistical analysis results of the fluorescence intensity of Caspase-1 and GSDMD in (E) (protein expression levels were quantified by mean fluorescence intensity (MFI)); (G-M) Quantitative real-time polymerase chain reaction (RT-qPCR) was used to detect the relative mRNA expression levels of AKT1, GSDMD, CASP1, NLRP3, RELA, and PIK3CA in cells of each group. Ctl:control group. ox-LDL: Atherosclerosis model group. ox-LDL-LD: The low-dose group of Poecilobdella manillensis. ox-LDL-MD:The medium-dose group of Poecilobdella manillensis. ox-LDL-HD: The high-dose group of Poecilobdella manillensis. ox-LDL-ACA: Positive drug control group. All statistical results are expressed as Mean ± SD, n = 3. Significant differences compared to the Sham group or the Model group are indicated as follows: ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; "ns" indicates no significant difference.

4. Discussion

AS is a disease influenced by factors such as hypertension, dyslipidemia, heredity, and others, primarily characterized by lipid deposition in the vascular wall and an increase in inflammatory cells. This condition is accompanied by hyperplasia of endothelial cells, leading to endothelial dysfunction, lipid metabolism disorders, and oxidative stress, which together contribute to an inflammatory response and the progressive stenosis of coronary arteries, resulting in the formation of AS plaques. In this study, we established an AS model using a high-fat diet combined with balloon injury to the rabbit carotid artery. We evaluated the potential anti-AS effects of P.manillensis by examining their impact on endothelial damage and atherosclerosis, while also exploring the associated anti-inflammatory mechanisms through the NF-κB signaling pathway. Our findings indicate that P.manillensis improved coagulation function in AS and regulated lipid metabolism disorders. Additionally, further investigations suggested that P.manillensis ameliorated endothelial injury in AS, with the involvement of the PI3K/AKT and NF-κB inflammatory pathways.

Hyperlipidemia and hemorheological abnormalities promote the oxidation of LDL to its oxidized form (ox-LDL). Excessive ox-LDL accumulation induces endothelial injury through direct cytotoxic effects, resulting in impaired vasoregulatory capacity and enhanced subendothelial retention of lipoproteins and circulating monocytes. These events drive foam cell formation via monocyte-macrophage differentiation, thereby initiating atherosclerotic pathogenesis [18,19]. The vascular endothelium maintains homeostasis through balanced secretion of vasoactive mediators: nitric oxide (NO, vasodilatory) and endothelin-1 (ET-1, vasoconstrictive). Endothelial dysfunction is characterized by a disrupted NO/ET-1 axis, manifesting as suppressed NO bioavailability concomitant with elevated ET-1 production, which exacerbates vascular tone dysregulation [20,21]. Our findings provide compelling evidence supporting the therapeutic value of Poecilobdella manillensis in restoring the crucial balance between vasoactive mediators. In the AS model group, we observed characteristic endothelial dysfunction: compared with the sham-operated group, serum concentrations of nitric oxide (NO)—a potent vasodilator and anti-inflammatory mediator—were significantly decreased, whereas levels of endothelin-1 (ET-1), a strong vasoconstrictor and proinflammatory cytokine, were sharply elevated — implying an enhancement in NO-generating capacity, which could consequently elevate NO bioavailability, improve vasodilation, and ultimately attenuate AS progression. These observations align closely with histopathological outcomes showing marked intimal hyperplasia, excessive lipid accumulation, and aggravated smooth muscle cell apoptosis in the model group.VEGF serves as a pivotal regulator of angiogenesis, playing an essential role in preserving endothelial integrity and facilitating compensatory neovascularization in ischemic tissues. In this experiment, HE staining and ORO staining were employed to assess the degree of intimal hyperplasia and atherosclerosis in the injured segment of the rabbit carotid artery, while simultaneously detecting the expression of vascular-related markers NO, ET-1, and VEGF. Following the construction of the AS model in this study, endothelial hyperplasia, lipid deposition, decreased levels of NO and VEGF, and increased levels of ET-1 were observed, confirming endothelial injury in AS. Of particular note, the downregulated VEGF expression observed in our model may reflect a chronic, decompensated state of endothelial failure, indicative of severely impaired intrinsic repair mechanisms. Treatment with Poecilobdella manillensis, however, effectively restored these aberrant indicators toward physiological ranges: both NO and VEGF levels showed clear recovery trends, while ET-1 expression was markedly suppressed. These findings are consistent with previous reports, reinforcing that Poecilobdella manillensis exhibits anti-hyperplastic and anti-atherosclerotic activities, while concurrently protecting the compromised vascular endothelium [35,36].

The PI3K/AKT pathway has been demonstrated to play a significant role in the pathogenesis of AS by influencing lipid metabolism, promoting the proliferation of smooth muscle cells and fibroblasts, and facilitating collagen production within the arterial wall [22]. NF-κB, a downstream protein of Akt, is ubiquitously present in the human body and is crucial for the regulation of immunity, inflammation, and both cell proliferation and apoptosis [23]. Research has established that the NF-κB pathway constitutes a key inflammatory pathway in the development of AS. The PI3K/AKT signaling axis exerts regulatory control over downstream NF-κB activation, thereby amplifying inflammatory mediator production through transcriptional modulation [24]. Following nuclear translocation, activated NF-κB orchestrates the transcriptional upregulation of precursor interleukin-1β (pro-IL-1β) and NLRP3 inflammasome components, which are pivotal for initiating pyroptotic cascades. Upon entering the nucleus, NF-κB promotes an increase in NLRP3 protein synthesis, which subsequently provides the necessary components for the assembly of inflammatory vesicles [25,26]. These inflammatory vesicles facilitate the activation of Caspase-1, leading to programmed cell death, commonly referred to as cellular pyroptosis [27,28]. This process is characterized by the rupture of the cell membrane and the release of intracellular inflammatory contents. In the classical pathway of cellular death, various NLRs selectively respond to corresponding stimulus signals. Pro-caspase-1 interacts with NLR family receptors through ASC scaffolding to assemble an inflammasome complex. This complex undergoes autoproteolytic processing to generate catalytically active caspase-1, which proteolytically cleaves gasdermin D (GSDMD) at the interdomain linker. The liberated N-terminal domain (NTD) of GSDMD oligomerizes and inserts into plasma membranes via lipid binding, forming transmembrane pores that induce osmotic lysis and pyroptotic cell death [29]. These permeability lesions facilitate extracellular release of IL-1β and IL-18, propagating a feedforward inflammatory cascade through paracrine signaling [30].

This study systematically revealed the intervention effect and mechanism of Poecilobdella manillensis on AS through in vivo and in vitro experiments. In the in vivo experiment, after successfully establishing an AS rabbit model via high-fat diet combined with carotid artery balloon injury, detection results showed that the expression levels of key inflammation-related indicators (including PI3K, AKT, NF-κB, NLRP3, and pro-Caspase-1) in model rabbits were significantly increased—confirming the presence of a prominent inflammatory response during the pathological progression of AS. However, after intervention with Poecilobdella manillensis, the abnormal elevation of these indicators was effectively alleviated, and its mechanism of action was clearly attributed to the "regulation of the PI3K/AKT signaling pathway": Poecilobdella manillensis inhibited the activation of the PI3K/AKT pathway, further blocking the activation of its downstream molecule NF-κB. This, in turn, reduced the assembly of the NLRP3 inflammasome and the activation of Caspase-1, ultimately suppressing the occurrence of pyroptosis and the release of pyroptosis-mediated inflammatory factors (such as IL-1β and IL-18), thereby achieving a significant inhibition of the inflammatory response in AS.The in vitro experiment further verified and expanded this mechanism: an AS cell model was constructed by inducing rabbit aortic endothelial cells with oxidized low-density lipoprotein (ox-LDL). After treating the model cells with Poecilobdella manillensis-containing serum, not only the consistent "inflammatory pathway inhibition" effect observed in the in vivo experiment was confirmed, but also significant improvements in cell viability and ATP production were detected. Meanwhile, the cell apoptosis rate, levels of lactate dehydrogenase, reactive oxygen species and ASC were notably reduced.In conclusion, the combined results of in vivo and in vitro experiments confirm that Poecilobdella manillensis can simultaneously alleviate endothelial injury and inflammatory response in AS through a multi-target mechanism involving "inhibiting inflammatory pathways—improving cellular metabolism—alleviating oxidative damage". This study provides a solid experimental basis and mechanistic support for the clinical application of Poecilobdella manillensis in AS treatment.

Drug-containing serums are currently popular and recognized protocols for in vitro studies of herbal formulas [31,32]. Unlike chemical drugs or single herbal extracts, traditional formulations may contain hundreds of chemical components with oral bioavailability (OB) ≥30 % and drug-like properties (DL) ≥0.18 [33]. These components are digested and absorbed by rats, interact with the body, modulate the neuroendocrine immune system, and subsequently act on the cells. Chen et al. treated rats with Glycyrrhiza glabra ZiYin to obtain the drug serum, which was then added to the human microglial cell line HMC-3 in the H2O2 model. The results indicated that Glycyrrhiza glabra ZiYin-containing serum reduced levels of ROS and inflammatory cytokines [34]. Thus, the drug-containing serum effectively mimicked the in vivo effects of drugs on the body. In a similar vein, the present study utilized drug-containing serum to treat aortic endothelial cells, thereby approximating the in vivo effects of P.manillensis on these cells. The findings demonstrated that the drug-containing serum significantly alleviated aortic endothelial cell damage and reduced inflammatory responses.

This study has achieved certain progress in exploring the therapeutic effect of Poecilobdella manillensis on AS, yet it still has limitations, which provide a clear direction for future research. At present, there is no systematic research report on the complete in vivo absorption, distribution, metabolism, and excretion (ADME) processes of the whole extract of Poecilobdella manillensis. Although it is known that the core active components such as hirudin can reach the effective blood concentration 1–2 h after administration, the design of "collecting blood 1 h after administration to prepare drug-containing serum" adopted in this study is still indirect evidence based on the pharmacokinetic characteristics of its single component. However, existing studies have not systematically analyzed the concentration changes of various active components in serum at different time points, their tissue distribution characteristics, and metabolic excretion pathways. As a traditional Chinese medicinal material with a complex composition, Poecilobdella manillensis contains various peptides, polysaccharides, and amino acids [37]. However, further research is still needed to clarify whether interactions occur among these components, their respective half-lives, and which constituent is the truly active one. In the future, technologies such as high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) should be used to conduct qualitative and quantitative analysis of serum samples at different time points, so as to depict the complete time-concentration curve and the tissue distribution characteristics of each component.

The study used the freeze-dried powder of the whole extract, which simulates the traditional medication form to a certain extent, but it also brings the fundamental problem of complex components and difficulty in attribution. It is difficult to evaluate the differences in bioavailability between different dose groups, and it is also impossible to deeply analyze the specific in vivo metabolic pathways of the drug.At present, it remains unclear whether hirudin is the primary active component or if multiple components exert a synergistic effect in mediating the anti-atherosclerotic (anti-AS) activity. Therefore, subsequent studies should focus on further isolation and purification of active components to identify the pharmacodynamic ingredients responsible for the anti-AS effect. Additionally, in-depth investigations into the efficacy of single-component administration versus combined-component administration are essential to establish the structure-activity relationship and compatibility principles.This research approach is supported by existing studies in the relevant field. For instance, Wang et al. found in their study on leech-derived peptide HE-D that this single peptide from leeches could modulate macrophage functions through transcriptomic regulatory mechanisms—such as inhibiting the release of inflammatory factors and regulating the expression of lipid phagocytosis-related genes—thereby exerting an anti-AS effect [38].

Cholesterol metabolism disorder is the core driving factor for the occurrence and development of AS. Although this study observed through in vivo experiments that Poecilobdella manillensis can significantly reduce the serum levels of TC, TG, and LDL-C, and increase the level of HDL-C, initially confirming its lipid-lowering phenotype, the existing research only stays at the phenotypic level of "changes in lipid indicators" and does not deeply explore the regulatory effect of Poecilobdella manillensis on the key links of cholesterol metabolism. This research status of "only focusing on the lipid-lowering phenotype and lacking metabolic mechanisms" leads to an incomplete mechanism chain of Poecilobdella manillensis in "lipid-lowering and anti-AS" and fails to fully tap its potential value in metabolic regulation. In the future, methods such as metabolomics and gene knockout should be combined to systematically explain its specific action targets and signal transduction mechanisms in lipid metabolism.

5. Conclusion

In summary, this research is the initial attempt to reveal that P.manillensis can alleviate endothelial cell injury and inflammation in rabbits experiencing balloon - induced injury to the atherosclerotic common carotid artery. Furthermore, cellular experiments confirmed that serum containing P.manillensis alleviated aortic endothelial cell injury and the inflammatory response. This research provides a foundational theoretical basis for the treatment of atherosclerosis using P.manillensis.

Consent to participate

Not applicable.

Author's contributions

Chunxia Guo and Yudong Rao wrote the paper draft. Hao Zhou and Yiran Feng corrected the draft. Jianyu Deng and Ling Yang supervised the experimentators. Ying Zhang and Xueya Zhang performed the experiments. All data were generated in-house, and no paper mill was used. All authors agree to be accountable for all aspects of work ensuring integrity and accuracy.

Consent for publication

Not applicable.

Funding

This work was supported by Yunnan Province High-level Talent Cultivation Support Program (RLMY20200003), Kunming Medicine Joint Program-Top Project (202101AY070001-097), and Yunnan Provincial Health Commission, Provincial Funds for Health Care Development (Traditional Chinese Medicine Development Category), Yunnan Health Office TCM Medical Management Development [2021] No.2, Construction of Collaborative Collaboration Base for Chinese and Western Medicine in Coronary Heart Disease.

Declaration of interest statement

The authors declare that they have no conflict of interest.

Ethics approval

Not applicable.

Data availability

The data that support the findings of this study are available from the corresponding author upon request.