Skip to main content
European Journal of Medical Research logoLink to European Journal of Medical Research
. 2025 Nov 25;31:8. doi: 10.1186/s40001-025-03530-2

miR-188-5p accelerates intervertebral disc degeneration by mediating P4HB to regulate ferroptosis in nucleus pulposus cells

Jing Yan 1, Shuo Miao 1, Yuning Zhu 1, Yi Gao 1, Rui Chen 1, Yuting Gong 1, Quan Zhou 1,✉
PMCID: PMC12772016  PMID: 41291815

Abstract

Background

Intervertebral disc degeneration (IDD) has the characteristics of global, high incidence and high disability rate, which brings a heavy economic and psychological burden to patients. Current clinical treatments are not effective in slowing the progression of IDD. Ferroptosis is an important cause of IDD development. The mechanism by which miR-188-5p regulates ferroptosis in nucleus pulposus cells (NPCs) has not been reported.

Methods

Firstly, bioinformatics was used to screen the miRNA and mRNA of differentially expressed genes in IDD. Then, clinical nucleus pulposus (NP) tissues were obtained for expression identification. TBHP induced ferroptosis in NPCs and detected the expression differences of miR-188-5p, P4HB and oxidative stress indicators, and verified the ability of transfection with miR-188-5p inhibitor to inhibit TBHP. Subsequently, the function of the miR-188-5p/P4HB axis was verified through experiments such as luciferase assay, cell transfection, and functional rescue. Finally, in vivo experiments were conducted to evaluate the ability of miR-188-5p to regulate IDD.

Results

Bioinformatics combined with a series of histological, cytological, and animal experiments revealed that miR-188-5p is an important ferroptosis driver in NPCs. MiR-188-5p accelerates IDD by mediating P4HB to regulate ferroptosis in NPCs. Finally, the rat IDD model confirmed that the miR-188-5p inhibitor significantly increased the height and signal intensity of the intervertebral space and inhibited intervertebral disc degeneration in rats.

Conclusions

Collectively, our findings establish miR-188-5p as a ferroptosis driver in IDD. Knockdown of miR-188-5p significantly upregulated P4HB expression, suppressed ferroptosis, and attenuated IDD progression. This study identifies miR-188-5p as a potential therapeutic target, providing a novel mechanistic framework for IDD treatment strategies.

Keywords: IDD, Bioinformatics, Ferroptosis, miR-188-5p, P4HB

Introduction

Intervertebral disc degeneration (IDD) is the primary cause of low back pain, and has developed into a globally highly disabling disease. Its etiology is complex, involving multi-link, multi-factor and multi-pathway interactions, and is the result of the interaction of various pathogenic factors including cell senescence, cell death, inflammation, and oxidative stress [1]. The intervertebral disc is composed of the central nucleus pulposus (NP), the surrounding annulus fibrosus and the cartilaginous end plate of the adjacent vertebral body [2]. The pathological changes of IDD include reduced water content in the NP, death of nucleus pulposus cells (NPCs) and imbalance of cell metabolism. With the aggravation of intervertebral disc degeneration, the NP tissue protrudes from the ruptured annulus fibrosus and compresses nerves, causing corresponding symptoms and signs [3]. At present, there is still a lack of effective treatment for IDD.

Ferroptosis is an iron-dependent programmed cell death mode with lipid peroxidation accumulation, which is different from apoptosis, autophagy and necrosis. In this process, the production of excess ROS will inhibit the action of glutathione peroxidase 4 (GPX4), thus promoting the occurrence of lipid peroxidation, and ferroptosis occurs in cells [4]. Studies found that ferroptosis has an important function in lung reperfusion injury [5], cancer [6], diabetes [7], and intervertebral disc degeneration [8]. The cystine-glutamate reverse transporter (System Xc-) consists of the light chain subunit SLC7A11 and the heavy chain subunit SLC3A2. The transporter is present on the cell membrane and takes in extracellular cysteine and excretes intracellular glutamate. Cystine is an essential precursor for synthesizing glutathione (GSH), a major intracellular antioxidant.SLC7A11 promotes cystine uptake and GSH biosynthesis, thereby preventing oxidative stress and ferroptosis [9]. GPX4 is a key antioxidant enzyme in cells, which can directly reduce lipid peroxides by GSH to prevent oxidative damage [10].

MicroRNAs (miRNAs) are small, single-stranded, non-coding RNAs that regulate post-transcriptional gene expression by binding to the 3' untranslated region (UTR) of target mRNAs, leading to mRNA degradation and negative regulation [11]. miRNAs participate in various biological processes such as cellular development, inflammation, and oxidative stress [12]. Our previous bioinformatics analysis revealed upregulated miR-188-5p and downregulated P4HB expression in degenerated NP tissues compared to normal NP tissues. Biological analysis predicted that P4HB is a target gene of miR-188-5p. P4HB has been proved to be a ferroptosis inhibitor [13], but the mechanism by which the miR-188-5p/P4HB pathway regulates ferroptosis has not been reported.

This study aims to further explore the regulatory mechanism of miR-188-5p/P4HB on NPCs ferroptosis, especially elucidating that miR-188-5p represents a potential therapeutic target for IDD.

Materials and methods

Screening of differential miRNA and mRNA in human NP tissue

By GEO database (https://www.ncbi.nlm.nih.gov/geo/), we use "intervertebral disc degeneration", "IDD" or "IVDD" term for the transcriptome data of human nucleus pulposus tissue. Finally, we screened and obtained the miRNA GSE116726 dataset, as well as the mRNA GSE34095 and GSE167199 datasets. These three datasets were derived from clinical nucleus pulposus tissue transcriptome sequencing and were divided into the normal group and the degenerated intervertebral disc group. Among them, the miRNA gene dataset is GSE116726 (Normal = 3, IDD = 3), and the miRNA gene datasets are GSE34095 (Normal = 3, IDD = 3) and GSE167199 (Normal = 3, IDD = 3).

Microarray data analysis

We used the "limma" package to screen the DEGs of mRNA and miRNA gene datasets. For mRNA datasets, we define genes with |logFC| > 0 and p < 0.05 as differentially expressed genes. For the miRNA dataset, genes with |logFC| > 1 and p < 0.05 are defined as differentially expressed genes. Use the "pheatmap" package to generate heat maps for further visualization and analysis.

Functional verification of differential miRNAs

miRPathDB (https://mpd.bioinf.uni-sb.de/overview.html) searched the function of the miR-188-5p gene, and then performed GO analysis to visualize functional enrichment.

Ferroptosis-related gene dataset

FerrDb (http://www.zhounan.org/ferrdb/current/operations/download.html) was used to retrieve all ferroptosis-regulating genes.

Acquisition of NP tissues

We collected NP tissues of patients undergoing lumbar surgery in Huaian Hospital Affiliated to Xuzhou Medical University from January 2022 to June 2023, and obtained a total of 12 normal NP tissues and 12 degenerative NP tissues. All patients provided informed consent before surgery. The study was approved by the Ethics committee of Huaian Hospital affiliated to Xuzhou Medical University (approval number: HEYLL2021082). We confirm that all experiments were performed in accordance with relevant named guidelines and regulations. The Pfirrmann scale was used to define the grade of degeneration in NP. Pfirrmann grade I–II was defined as normal tissue from patients with fresh thoracolumbar fracture and scoliosis, while Pfirrmann grade III–V was defined as degenerative NP tissue. It is derived from patients with lumbar disc herniation, stenosis or spondylolisthesis [14]. The clinical characteristics of the surgical patients are shown in Table 1.

Table 1.

Clinical characteristics of surgery patients

Variable Normal (n = 12) IDD (n = 12) P-value
Age, years 42.42 ± 15.4 43.08 ± 14.5 0.906a
Sex, n (%)
 Male 7 6 0.221b
 Female 5 6

Statistical analysis was conducted on the age, gender and grouping of the surgical patients.

aStudent’s t-test

bTwo-sided chi-square. Data are present as the mean ± SD

Isolation of NP cells

NP tissues were sliced into 2–3 mm3 pieces under sterile conditions, washed three times with PBS, and digested with 0.25 mg/mL type II collagenase (Invitrogen; Thermo Fisher Scientific) at 37 °C for 4 h and cultured in DMEM/F12 medium. The medium changes every 3 days. Cells were incubated at 37 °C with 5% CO₂.

Western blot

Proteins were extracted using RIPA and PMSF (Beyotime, Guangzhou, China) and protein concentrations were measured using a BCA kit (Beyotime, Guangzhou, China). The following were incubated: rabbit anti-P4HB (1:2000, 11245-1-AP, Proteintech, China), rabbit anti-GPX4 (1:2000, 30388-1-AP, Proteintech, China), rabbit anti-SLC7A11 (1:3000, 26864-1-AP, Proteintech, China), mouse anti-GAPDH (1:50000, 60004-1-Ig, Proteintech, China), and goat anti-rabbit or mouse antibodies (1:50000, V926-32211/32210, Vicmed, China). GAPDH served as the control.

RT-qPCR

RNA was extracted using Trizol (TianGen, Beijing, China), and RNA expression was quantified using LightCycler480II (Roche Diagnostics, Indianapolis, USA). A 20 µl PCR reaction system was prepared, and then the reaction was carried out under the conditions of 15 min at 95 °C, 20 s at 95 °C, 30 cycles, and 20 s at 60 °C. Primers used were:

miR-188-5p: Forward CACGCACATCCCTTGCAT, Reverse CCAGTGCAGGGTCCGAGGTA; P4HB: Forward CACTGCAAACAGTTGGCTCC, Reverse CCGTTGTAATCAATGACCGT; GPX4: Forward GAGGCAAGACCGAAGTAAACTAC, Reverse CCGAACTGGTTACACGGGAA; SLC7A11: Forward TGTGGGGTCCTGTCACTATTTG, Reverse GATATCACAGCAGTAGCTGCAGG; GAPDH: Forward TGTGGGCATCAATGGATTTGG, Reverse ACACCATGTATTCCGGGTCAAT; U6: Forward CTCGCTTCGGCAGCACA, Reverse AACGCTTCACGAATTTGCGT.

CCK-8 assay

NP cells were cultured in 96-well plates (4000 cells/well), and cell viability was assessed using a CCK-8 kit (Vicmed, Xuzhou, China). Absorbance was measured at 450 nm using a microplate reader.

MDA, GSH, and ROS detection

MDA and GSH levels were measured using respective kits (Beyotime, Guangzhou, China) at 532 nm and 412 nm, respectively. ROS levels were visualized under a fluorescence microscope using a ROS detection kit (Beyotime, Guangzhou, China).

Fe2+ detection

The iron content was determined in accordance with the kit instructions (Beyotime, Guangzhou, China). The optical density value was measured at 520 nm using a microplate reader (Thermo Fisher Scientific, USA).

Cell immunofluorescence

Cells were cultured in confocal dishes, incubated with primary antibodies, followed by secondary antibodies under light-protected conditions. Fluorescence intensity was observed under a Leica confocal microscope.

Flow cytometry

NPCs were collected and resuspended in 195 mL of Annexin V-FITC binding buffer. Subsequently, 5 μl of Annexin V-FITC conjugate and 10 μl of PI staining solution were sequentially added to the cell suspension with gentle mixing. The mixture was then incubated at room temperature (25 °C) protected from light for 20 min (Beyotime, Guangzhou, China). Cell apoptosis analysis was conducted using a flow cytometer (Beckman Coulter, California, USA).

Luciferase assay

The P4HB 3'-UTR binding site for miR-188-5p was inserted into the GV272 vector to construct an expression vector. Then, Wt or Mut P4HB 3'-UTR plasmid and miR-188-5p mimic were co-transfected into 293 T cells. Luciferase activity was measured 48 h post-transfection using the Promega kit (Madison, WI, USA). Luciferase activity was normalized to Renilla luciferase activity. P4HB protein expression in 293 T cells was detected by western blot.

Gene overexpression and knockdown

miR-188-5p mimic/inhibitor, mimic/inhibitor control and overexpressed P4HB plasmids were synthesized by Shanghai Shenggong Bioengineering Company of China.

Establishment and treatment of rat IDD model

Our research confirmed compliance with the ARRIVE guidelines and was conducted in accordance with the relevant designated guidelines and regulations. Approved by the Animal Ethics Committee of Xuzhou Medical University (approval number: 202111T011), male SD rats (250–300 g) were randomized into Sham, IDD, and IDD+ miR-188-5p inhibitor groups, with 3 rats in each group. Rats were anesthetized with 1% pentobarbital sodium (4 ml/kg). In the IDD group, a longitudinal incision was made on the tail skin to expose the tail intervertebral disc. Needle punctures were performed at the 7th/8th caudal vertebrae (Co7/8) under radiographic guidance. A 21G needle was inserted into the disc space, rotated for 5 s, and maintained for 30 s. Every 7 days, injections were administered at a dosage of 4 µl, with a concentration of 1 µg µl−1. Four weeks later, miR-188-5p inhibitor was injected into the IDD group's tail disc space using a 31G needle. In the Sham group, only the tail skin was incised to expose the tail disc [15, 16].

Imaging evaluation

X-ray and MRI examinations were performed on the rats 4 weeks after drug injection. Existing disc height index (DHI) and Pfirrmann grading criteria were used [17].

Histological analysis

Tail intervertebral discs were fixed, decalcified, dehydrated, embedded in paraffin, and sectioned (Scheme 1). Sections were stained with hematoxylin–eosin (HE) and subjected to immunohistochemical staining for P4HB, SLC7A11, and GPX4, analyzed using Image J.

Scheme 1.

Scheme 1.

The upregulated miR-188-5p reduces the expression of P4HB, thereby inhibiting the antioxidant defense system, inducing oxidative stress, activating ferroptosis of nucleus pulposus cells, and ultimately aggravating intervertebral disc degeneration

Statistical analysis

All quantitative data are expressed as mean ± standard deviation (SD) and were processed through GraphPad Prism 8.4. Comparative analyses between two experimental groups employed Student's t-test, while multigroup comparisons utilized one-way ANOVA with appropriate post hoc tests. Gene expression correlations were quantified using Pearson's linear correlation coefficient. Experimental procedures were replicated independently in triplicate to ensure reproducibility.

Results

Identification of differentially expressed P4HB in NP tissues

GEO datasets GSE34095 and GSE167199 were screened for differential mRNA expression (Fig. 1A, B). Intersection with the FerrDb dataset yielded seven differential genes (Fig. 1C). Heatmaps revealed consistent downregulation of P4HB and upregulation of TMBIM4 in both datasets (Fig. 1D, E). Studies have confirmed that P4HB [13] and TMBIM4 [18] are ferroptosis suppressor genes. Therefore, combining the above factors, P4HB was selected as the target gene for the study.

Fig. 1.

Fig. 1

Identification of differentially expressed P4HB in NP tissues. A Volcano plot of GSE34095; B volcano plot of GSE167199; C Venn diagram for ferroptosis-related gene screening; D heatmap of seven differential genes in GSE34095; E heatmap of seven differential genes in GSE167199

Identification of differentially expressed miR-188-5p in NP tissues

The upstream miRNA of P4HB was matched through miRDB, Targetscam, starbase and miRTarbase websites. The transcriptome dataset GSE116726 of intervertebral disc degeneration NP tissue was screened from the GEO database, and differential genes were screened by volcanic map and thermal map (Fig. 2A, B). In addition, the upstream miRNA predicted by P4HB was intersected to obtain miR-188-5p (Fig. 2C), and its expression was upregulated in the GSE116726 dataset (Fig. 2D). miRPathDB combined with GO and KEGG analysis showed that miR-188-5p is enriched in enzyme activity and cell signaling regulation (Fig. 2E–H).

Fig. 2.

Fig. 2

Identification of differentially expressed miR-188-5p in NP tissues. A, B Volcano plot and heatmap of GSE116726; C Venn diagram for target gene miRNA screening; D miR-188-5p expression difference in GSE116726; E biological process; F cellular component; G molecular function; H KEGG. ****P < 0.0001

Differential expression of miR-188-5p and P4HB in clinical NP tissues

RT-qPCR showed significantly upregulated miR-188-5p and downregulated P4HB in degenerated NP tissues compared to normals (Fig. 3A, B). Pearson correlation analysis revealed a significant negative correlation between P4HB and miR-188-5p expressions (R = −0.870; P < 0.001; Fig. 3C). Western blot confirmed downregulated P4HB, SLC7A11, and GPX4 proteins in degenerated tissues (Fig. 3D, E). The content of GSH decreased in the degenerated NP tissue, while the contents of MDA and iron ions increased. (Fig. 3F, G, H). These findings suggest that miR-188-5p and P4HB may regulate NP cell ferroptosis in IDD.

Fig. 3.

Fig. 3

Differential expression of miR-188-5p and P4HB in clinical NP tissues. A miR-188-5p expression; B P4HB, SLC7A11, GPX4 expressions; C Pearson correlation analysis; D, E protein expressions of P4HB, SLC7A11 and GPX4; F GSH content; G Fe2+ content; F MDA content. **P < 0.01, ***P < 0.001

The expression difference of miR-188-5p and P4HB in NPCs induced by TBHP

Type II collagen and aggrecan are characteristically expressed in the extracted NPCs (Fig. 4A). Tert-butyl hydrogen peroxide (TBHP) is widely used to activate oxidative stress in NPCs [19]. qRT-PCR results showed that compared with the control group, TBHP promoted miR-188-5p expression (Fig. 4B) and inhibited P4HB, SLC7A11 and GPX4 expressions (Fig. 4C). Western Blot confirmed that TBHP significantly inhibited P4HB, SLC7A11 and GPX4 expression (Fig. 4D, E). CCK8 results showed that TBHP significantly inhibited the proliferation of NPCs (Fig. 4F). TBHP inhibited the production of GSH and accelerates its consumption, while on the other hand increased the content of MDA, iron ions and ROS (Fig. 4G–J). Cellular immunofluorescence confirmed that TBHP inhibited P4HB, SLC7A11 and GPX4 expression (Fig. 4K). These results indicate that TBHP induces oxidative stress, altering miR-188-5p, P4HB, SLC7A11, and GPX4 expressions.

Fig. 4.

Fig. 4

The expression difference of miR-188-5p and P4HB in NPCs induced by TBHP. A Type II collagen and aggrecan are characteristically expressed in the extracted NPCs, 20x; B miR-188-5p expression of NPCs; C P4HB, SLC7A11 and GPX4 mRNA expression of NPCs; D, E P4HB, SLC7A11 and GPX4 protein expression; F CCK8 detection of cell proliferation; G, H, I, J detection of GSH, MDA, Fe2+ and ROS in injured NPCs; K detection of immunofluorescence-associated proteins in NPCs by confocal microscopy, 20×. *P < 0.05, **P < 0.01, ***P < 0.001

Regulation of NPCs’ ferroptosis by miR-188-5p

We cultured NPCs with miR-188-5p inhibitor and TBHP. Western Blot results showed that TBHP inhibited P4HB, SLC7A11 and GPX4 protein expression compared with the control group. However, miR-188-5p inhibitor can reverse the above expression effect induced by TBHP (Fig. 5A, B). The same results were obtained by qRT-PCR (Fig. 5C). Meanwhile, miR-188-5p inhibitor significantly reversed miR-188-5p upregulated expression induced by TBHP (Fig. 5D). TBHP significantly accelerated the consumption of GSH and promoted the contents of MDA, Fe2+ and ROS. However, miR-188-5p inhibitor significantly reversed these effects (Fig. 5E–H). The CCK8 results indicated that TBHP inhibited the proliferation of NPCs, while miR-188-5p inhibitor can weaken this effect (Fig. 5I). Moreover, miR-188-5p inhibitor significantly inhibits cell death (Fig. 5J). TBHP induced a large number of vacuoles in the mitochondria of cells, and the mitochondrial morphology disappeared. The miR-188-5p inhibitor weakened the mitochondrial damage (Fig. 5K). These results indicated that miR-188-5p could regulate ferroptosis in NPCs.

Fig. 5.

Fig. 5

Regulation of NPCs ferroptosis by miR-188-5p. A, B miR-188-5p inhibitor reversed the expression of related proteins induced by TBHP; C, D miR-188-5p inhibitor reversed the expression of related genes induced by TBHP; E, F, G detection of GSH, Fe2+ and MDA in NPCs; H ROS indices in injured NPCs were detected by fluorescence microscopy, 10×; I miR-188-5p inhibitor promotes proliferation of NPCs by CCK8; J TBHP promotes cell death; K mitochondrial morphology (TEM), 500 nm. *P < 0.05, **P < 0.01, ***P < 0.001

miR-188-5p directly regulates P4HB expression

Bioinformatics analysis predicted P4HB as a miR-188-5p target gene. We transferred both inhibitor control, miR-188-5p inhibitor, mimic control and miR-188-5p mimic into NPCs. Western Blot results showed that transfecting NPCs with miR-188-5p inhibitor significantly promoted P4HB expression, while miR-188-5p mimic had the opposite effect (Fig. 6A, B). The same conclusion was reached by the qRT-PCR experiment (Fig. 6C). Figure 6D shows the base pairing. Luciferase assay showed significantly reduced luciferase activity when miR-188-5p mimic was co-transfected with Wt P4HB 3'-UTR, indicating targeting of P4HB by miR-188-5p (Fig. 6E). Subsequently, western blot further confirmed downregulated P4HB protein in the miR-188-5p mimic-Wt group (Fig. 6F, G). Western blot analysis revealed that miR-188-5p mimic significantly suppressed protein expressions of P4HB, SLC7A11 and GPX4. However, co-transfection of P4HB with NPCs markedly reversed the downregulation of protein expressions (Fig. 6H, I). The same results were obtained by qRT-PCR (Fig. 6J). Flow cytometry analysis demonstrated that miR-188-5p overexpression markedly induced apoptosis in NPCs. Notably, P4HB expression effectively counteracted this pro-apoptotic effect (Fig. 6K). Collectively, these findings suggest that miR-188-5p directly regulates P4HB expression.

Fig. 6.

Fig. 6

miR-188-5p directly regulates P4HB expression. A, B Expression of P4HB protein; C gene expression of P4HB; D base pairing sequence; E luciferase test; F, G protein expression of P4HB in 293 T cells; H, I protein expression of P4HB, SLC7A11 and GPX4 in NPCs; J gene expression of P4HB, SLC7A11 and GPX4 in NPCs; K the apoptosis of cells in each group was detected by flow cytometry. *P < 0.05, **P < 0.01, ***P < 0.001

The downregulation of miR-188-5p alleviates puncture-induced IDD in vivo

To evaluate the potential of miR-188-5p to delay IDD, we randomly established a Sham group, an acupuncture IDD model group, and an IDD + miR-188-5p inhibitor treatment group. The IDD model group was injected with miR-188-5p inhibitor 4 weeks after surgery, followed by radiological and histological analysis 8 weeks after surgery (Fig. 7A). Changes in DHI and magnetic resonance imaging (MRI) signal strength were recorded. For example, X-ray images showed that the DHI of the IDD + miR-188-5p inhibitor group was significantly improved compared with the IDD group with intervertebral space collapse and endplate cartilage destruction; both groups were lower than the sham group (Fig. 7B, C). The changes in disc signal in T2-weighted MRI images are closely related to the degree of degeneration, and the lower the signal intensity, the more severe the disc degeneration. Compared with the sham group, the IDD group showed significantly lower signal changes. In contrast, the intervertebral signal was significantly enhanced in the miR-188-5p inhibitor group compared with the IDD group (Fig. 7D, E). DHI and MRI results showed that the downregulation of miR-188-5p has great therapeutic prospects for delaying IDD. HE staining showed that the boundary of NP and annulus fibrosus was clear and regular in the sham group; on the other hand, the IDD group showed an unclear boundary and obvious morphological destruction, while the IDD + miR-188-5p inhibitor group was significantly improved compared with the IDD group (Fig. 7F). Moreover, immunohistochemical staining results showed that compared with the sham group, the expressions of P4HB, SLC7A11 and GPX4 in the IDD group were significantly downregulated. However, compared with the IDD group, injection of miR-188-5p inhibitor significantly promoted the expression of P4HB, SLC7A11 and GPX4 (Fig. 7G–I). Therefore, the potential of down-regulating miR-188-5p in the treatment of IDD was further demonstrated.

Fig. 7.

Fig. 7

Fig. 7

The downregulation of miR-188-5p alleviates puncture-induced IDD in vivo. A The process of in vivo experiments; B X-rays of the intervertebral disc; C disc height index (DHI); D MRI images of the disc. E Pfirrmann grading of intervertebral disc; F HE staining, scale = 500 μm; G immunohistochemical staining of P4HB, scale = 500 um; H immunohistochemical staining of SLC7A11, scale = 500 µm; I GPX4 immunohistochemical staining, scale = 500 µm. **P < 0.01, ***P < 0.001

Discussion

IDD causes chronic low back pain, significantly affecting patients’ quality of life, and neither conservative nor surgical treatment has successfully slowed or reversed the degenerative process [20]. Therefore, we need to focus on the pathogenesis of IDD in order to find effective treatment measures. Currently, NPCs’ loss exacerbates IDD, with various cell death forms, including apoptosis, pyroptosis, necroptosis, autophagy and ferroptosis, contributing to IDD progression [21]. Ferroptosis plays a key role in driving NP cell death and the progression of IDD [22–24]. AgingNPCs produce excess ROS, resulting in intracellular iron accumulation, GSH depletion, GPX4 inactivation, and increased lipid peroxidation, disrupting iron homeostasis in intervertebral discs and initiating ferroptosis [25].

In this study, we first obtained differential genes miR-188-5p and P4HB through bioinformatics analysis, and P4HB is predicted as a miR-188-5p target gene. We hypothesized that miR-188-5p regulates NPCs ferroptosis through P4HB. At present, there are no relevant research reports on the mechanism of miR-188-5p in IDD. Previous studies reported that miR-188-5p knockdown inhibits osteosarcoma cell proliferation and migration, suppresses ferroptosis [26]. Studies have confirmed that downregulation of miR-188-5p expression predicts poor prognosis in renal cell carcinoma patients, and low expression of miR-188-5p can promote the growth and invasion of cancer cells [27]. Hou et al. found that silencing miR-188-5p enhances neuron viability and reduces apoptosis [28]. Knockdown of miR-188-5p can enhance the proliferation, migration and invasion of human keloid fibroblasts, and inhibit cell death [29]. Studies have reported that miR-188-5p is expressed at a low level in renal cell carcinoma, and overexpression of miR-188-5p can inhibit cell growth, colony formation, invasion and migration by regulating the AKT/mTOR signaling pathway through MARCKS [24]. Studies have shown that miR-188-5p was significantly reduced in hepatocellular carcinoma, and its expression level was highly correlated with the overall survival of hepatocellular carcinoma, and found that miR-188-5p could achieve hepatocellular carcinoma inhibition by targeting fibroblast growth factor 5 (FGF5) [30].

P4HB has been confirmed to be a ferroptosis-promoting gene [13]. Studies have found that the use of the P4HB inhibitor PACMA31 has the same ferroptosis-promoting effect as the System XC-inhibitor erastin [31]. Pan et al. confirmed that P4HB knockdown promotes ferroptosis by regulating SLC7A11-mediated GSH synthesis [32]. Additionally, increased P4HB expression correlates with poor prognosis in some cancers [33].

Therefore, in order to further study the relationship between miR-188-5p and P4HB, and their roles in IDD, we collected clinical NP tissues for further verification through Western Blot and qRT-PCR, and found that miR-188-5p expression was upregulated and the expression of P4HB was downregulated in the degraded NP tissues, showing a negative correlation between the gene expressions. SLC7A11 and GPX4 were also downregulated. MDA and iron ions accumulate in the degenerated NP tissue, while the content of GSH decreases. Then, TBHP induced oxidative stress in NPCs, which promoted the upregulation of miR-188-5p expression and the expression of MDA, ROS and iron ions oxidation indices, while downregulating the expression of P4HB, SLC7A11 and GPX4, accelerated the consumption of GSH and inhibited cell proliferation. However, transfection with the miR-188-5p inhibitor reversed these results. Then, we transfected the miR-188-5p inhibitor/mimic into NPCs. Western blot results showed that miR-188-5p inhibitor expression promoted P4HB expression, and miR-188-5p mimic could reverse the above results. Therefore, miR-188-5p may regulate ferroptosis of NPCs by directly regulating P4HB expression. The luciferase assay demonstrated that miR-188-5p and Wt P4HB 3'-UTR plasmid showed significant fluorescence value reduction, indicating the targeting relationship between miR-188-5p and P4HB. Western blot showed downregulated P4HB protein in the miR-188-5p mimic-Wt group. Western blot analysis demonstrated that transfection with the miR-188-5p mimic significantly suppressed the protein expression of P4HB, SLC7A11, and GPX4 in NPCs. Notably, co-transfection of P4HB effectively reversed the downregulation of these protein expressions. Flow cytometry analysis demonstrated that the miR-188-5p mimic markedly induced apoptosis in NPCs. Notably, P4HB expression effectively counteracted this pro-apoptotic effect. Many studies have reflected the effects of ferroptosis on cells by detecting cell death through flow cytometry [1, 34, 35]. Therefore, it was further confirmed that miR-188-5p directly regulated the expression of P4HB. In order to further evaluate the ability of down-regulating miR-188-5p to delay IDD, we constructed the rat IDD model by acupuncture, and injected the miR-188-5p inhibitor 4 weeks later. X-ray results showed that the IDD model of rats with acupuncture showed significant narrowing of the maximum space and destruction of cartilage plates. However, MRI imaging results also confirmed that the intervertebral signal intensity of the IDD group was significantly decreased compared with that of the normal group, but these imaging results were significantly reversed by the miR-188-5p inhibitor, indicating the ability of the miR-188-5p inhibitor to treat IDD in vivo. Immunohistochemistry further confirmed that compared with the IDD group, the miR-188-5p inhibitor significantly promoted the expression of P4HB, SLC7A11 and GPX4, which further demonstrated the potential of down-regulating miR-188-5p in the treatment of IDD.

Conclusions

In this study, we found that miR-188-5p is a ferroptosis driver. Knockdown of miR-188-5p significantly upregulated P4HB expression, suppressed ferroptosis, and attenuated IDD progression. Therefore, we first confirmed the mechanism by which the miR-188-5p/P4HB axis regulates IDD and the potential of miR-188-5p in the treatment of IDD. This research achievement provides a new potential target for the treatment of IDD. However, our research also has some limitations. It is unknown whether miR-188-5p is involved in the occurrence and development of IDD through other mechanisms. This still requires further research.

Acknowledgements

Not applicable.

Abbreviations

IDD

Intervertebral disc degeneration

NP

Nucleus pulposus

NPCs

Nucleus pulposus cells

DEGs

Differentially expressed genes

Author contributions

Jing Yan, Shuo Miao and Yuning Zhu contributed equally to this work. Jing Yan and Quan Zhou designed the study. Jing Yan, Shuo Miao, Yuning Zhu, Yi Gao, Rui Chen carried out this experiment. Yuning Zhu and YuTing Gong analyzed the data. Jing Yan wrote the manuscript. Quan Zhou reviewed the manuscript and revised it.

Funding

This study was supported by the National Natural Science Foundation of China (82372480) and Jiangsu Province Postgraduate Research and Practical Innovation Program (KYCX25_3269). This study was also supported by the Scientific Research Project of Jiangsu Provincial Health Commission (M2022125).

Data availability

The data used in this research can be reasonably obtained from the corresponding author.

Declarations

Ethics approval and consent to participate.

All patients provided informed consent before surgery. The study was approved by the Ethics committee of Huaian Hospital affiliated to Xuzhou Medical University (approval number: HEYLL2021082). We confirm that all experiments were performed in accordance with relevant named guidelines and regulations. Our research confirmed compliance with the ARRIVE guidelines and was conducted in accordance with the relevant designated guidelines and regulations. This research was approved by the Animal Ethics Committee of Xuzhou Medical University (approval number: 202111T011).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Jing X, Wang W, He X, Liu X, Yang X, Su C, et al. HIF-2α/TFR1 mediated iron homeostasis disruption aggravates cartilage endplate degeneration through ferroptotic damage and mtDNA release: a new mechanism of intervertebral disc degeneration. J Orthop Translat. 2024;46:65–78. 10.1016/j.jot.2024.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Yang X, Chen Y, Guo J, Li J, Zhang Pu, Yang H, et al. Polydopamine nanoparticles targeting ferroptosis mitigate intervertebral disc degeneration via reactive oxygen species depletion, iron ions chelation, and GPX4 ubiquitination suppression. Adv Sci. 2023;10(13):e2207216. 10.1002/advs.202207216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lu X, Li D, Lin Z, et al. HIF-1α-induced expression of the m6A reader YTHDF1 inhibits the ferroptosis of nucleus pulposus cells by promoting SLC7A11 translation. Aging Cell. 2024. 10.1111/acel.14210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Lin J, Ou H, Luo B, et al. Capsaicin mitigates ventilator-induced lung injury by suppressing ferroptosis and maintaining mitochondrial redox homeostasis through SIRT3-dependent mechanisms. Mol Med. 2024;30(1):148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Li C, Gao P, Zhuang F, Wang T, Wang Z, Wu G, et al. Inhibition of ALOX12-12-HETE alleviates lung ischemia–reperfusion injury by reducing endothelial ferroptosis-mediated neutrophil extracellular trap formation. Research. 2024;7:0473. 10.34133/research.0473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Tamura K, Tomita Y, Kanazawa T, Shinohara H, Sakano M, Ishibashi S, et al. Lipid peroxidation regulators GPX4 and FSP1 as prognostic markers and therapeutic targets in advanced gastric cancer. Int J Mol Sci. 2024;25(17):9203. 10.3390/ijms25179203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Galeone A, Annicchiarico A, Buccoliero C, Barile B, Luciani GB, Onorati F, et al. Diabetic cardiomyopathy: role of cell death, exosomes, fibrosis and epicardial adipose tissue. Int J Mol Sci. 2024;25(17):9481. 10.3390/ijms25179481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Fan C, Chu G, Yu Z, et al. The role of ferroptosis in intervertebral disc degeneration. Front Cell Dev Biol. 2023;11:1219840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zhang W, Feng J, Ni Y, et al. The role of SLC7A11 in diabetic wound healing: novel insights and new therapeutic strategies. Front Immunol. 2024;15:1467531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gawargi FI, Mishra PK. MMP9 drives ferroptosis by regulating GPX4 and iron signaling. iScience. 2024;27(9):110622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Prieto I, Kavanagh M, Jimenez-Castilla L, Pardines M, Lazaro I, del Herrero Real I, et al. A mutual regulatory loop between miR-155 and SOCS1 influences renal inflammation and diabetic kidney disease. Mol Ther Nucleic Acids. 2023;34:102041. 10.1016/j.omtn.2023.102041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zhang L, Jin W, Hu M, Su Y, Zhang Y, Yuan F, et al. Silencing miR-155-5p expression improves intestinal damage through inhibiting inflammation and ferroptosis in necrotizing enterocolitis. Heliyon. 2024;10(17):e37087. 10.1016/j.heliyon.2024.e37087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Feng D, Li L, Li D, et al. Prolyl 4-hydroxylase subunit beta (P4HB) could serve as a prognostic and radiosensitivity biomarker for prostate cancer patients. Eur J Med Res. 2023;28(1):245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ji ML, Jiang H, Zhang XJ, et al. Preclinical development of a microRNA-based therapy for intervertebral disc degeneration. Nat Commun. 2018;9(1):5051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bai T, Lei P, Zhou H, Liang R, Zhu R, Wang W, et al. Sigma-1 receptor protects against ferroptosis in hepatocellular carcinoma cells. J Cell Mol Med. 2019;23(11):7349–59. 10.1111/jcmm.14594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zhang Y, Yang S, You X, et al. CircSPG21 ameliorates oxidative stress-induced senescence in nucleus pulposus-derived mesenchymal stem cells and mitigates intervertebral disc degeneration through the miR-217/SIRT1 axis and mitophagy. Stem Cell Res Ther. 2025;16(1):49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhao W, Liu Y, Hu Y, et al. SOX4 accelerates intervertebral disc degeneration via EZH2/NRF2 pathway in response to mitochondrial ROS-dependent NLRP3 inflammasome activation in nucleus pulposus cells. J Transl Med. 2025;23(1):395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Li Q, Peng J, Ding F. 1,25(OH)₂D₃ inhibits ferroptosis in nucleus pulposus cells via VDR signaling to mitigate lumbar intervertebral disc degeneration. Sci Rep. 2025;15(1):7968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wang W, Cheng Z, Yu M, et al. Injectable ECM-mimetic dynamic hydrogels abolish ferroptosis-induced post-discectomy herniation through delivering nucleus pulposus progenitor cell-derived exosomes. Nat Commun. 2025;16(1):3131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Qiu C, Cheng L, Di D, et al. TNFα-reliant FSP1 up-regulation promotes intervertebral disc degeneration via caspase 3-dependent apoptosis. Genes Dis. 2024;12(1):101251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chen J, Yang X, Li Q, Ma J, Li H, Wang L, et al. Inhibiting DNA methyltransferase DNMT3B confers protection against ferroptosis in nucleus pulposus and ameliorates intervertebral disc degeneration via upregulating SLC40A1. Free Radic Biol Med. 2024;220:139–53. 10.1016/j.freeradbiomed.2024.05.007. [DOI] [PubMed] [Google Scholar]
  • 22.Li Z, Cheng P, Xi H, et al. Tomatidine alleviates intervertebral disc degeneration by activating the Nrf2/HO-1/GPX4 signaling pathway. Drug Des Devel Ther. 2024;18:6313–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li Y, Zhang Y, Lu X, et al. Circular RNA IARS modulates the progression and ferroptosis of osteosarcoma via sponging miR-188-5p from RAB14. Neoplasma. 2024;71(3):279–88. [DOI] [PubMed] [Google Scholar]
  • 24.Shen H, Jin J, Wang H, Yu N, Liu T, Sheng H, et al. Integrated analysis identifies microRNA-188-5p as a suppressor of AKT/mTOR pathway in renal cancer. Cancer Sci. 2023;114(8):3128–43. 10.1111/cas.15832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hou D, Pei C, Yu D, et al. miR-188-5p silencing improves cerebral ischemia/reperfusion injury by targeting Lin28a. Metab Brain Dis. 2023;38(7):2327–38. [DOI] [PubMed] [Google Scholar]
  • 26.Liu Y, Li L, Wang JY, et al. Lncrna GNAS-AS1 knockdown inhibits keloid cells growth by mediating the miR-188-5p/RUNX2 axis. Mol Cell Biochem. 2023;478(4):707–19. [DOI] [PubMed] [Google Scholar]
  • 27.Chen YC, Oses-Prieto JA, Pope LE, et al. Reactivity-based probe of the Iron(II)-dependent interactome identifies new cellular modulators of ferroptosis. J Am Chem Soc. 2020;142(45):19085–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pan CF, Wei K, Ma ZJ, et al. Circp4hb regulates ferroptosis via SLC7A11-mediated glutathione synthesis in lung adenocarcinoma. Transl Lung Cancer Res. 2022;11(3):366–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Yuan Z, Jing H, Deng Y, et al. P4HB maintains Wnt-dependent stemness in glioblastoma stem cells as a precision therapeutic target and serum marker. Oncogenesis. 2024;13(1):42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Fang F, Chang RM, Yu L, Lei X, Xiao S, Yang H, et al. MicroRNA‐188‐5p suppresses tumor cell proliferation and metastasis by directly targeting FGF5 in hepatocellular carcinoma. J Hepatol. 2015;63(4):874–85. 10.1016/j.jhep.2015.05.008. [DOI] [PubMed] [Google Scholar]
  • 31.Zhang L, Li YW, Xie T, et al. Potential role of P4HB in the tumor microenvironment and its clinical prognostic value: a comprehensive pan-cancer analysis and experimental validation with a focus on KIRC. Cancer Cell Int. 2025;25(1):1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Dai C, Li Q, Wang L, et al. Long noncoding LINC00115 facilitates cell growth and inhibits apoptosis by regulating the miR-4701-5p/P4HB axis in bladder cancer. Tohoku J Exp Med. 2025;265(2):69–81. [DOI] [PubMed] [Google Scholar]
  • 33.Huang R, Wu D, Zhang K, Hu G, Liu Yu, Jiang Yi, et al. ARID1A loss induces P4HB to activate fibroblasts to support lung cancer cell growth, invasion, and chemoresistance. Cancer Sci. 2024;115(2):439–51. 10.1111/cas.16052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wu T, Wang Y, Shen B, Guo K, Zhu Z, Liang Y, et al. FBXO2 alleviates intervertebral disc degeneration via dual mechanisms: activating PINK1-Parkin mitophagy and ubiquitinating LCN2 to suppress ferroptosis. Adv Sci. 2025;12(36):e06150. 10.1002/advs.202506150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wu T, Teng Y, Song D, et al. A strategy targeting ferroptosis for mitochondrial reprogramming and intervertebral disc degeneration therapy. Theranostics. 2025;15(17):9159–78. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data used in this research can be reasonably obtained from the corresponding author.


Articles from European Journal of Medical Research are provided here courtesy of BMC

RESOURCES