Curcumin alleviates the effects of heat stress on broiler pectoral muscle via decorin (DCN) -mediated TGF-β Signaling pathway

Abstract

This study investigates the molecular mechanism by which curcumin (CUR) alleviates oxidative damage and developmental inhibition in pectoral muscles of white-feather broiler chickens under heat stress by regulating the decorin (DCN)-mediated TGF-β signaling pathway. 1-day-old Arbor Acres white-feathered broilers (n = 108) were randomly divided into 3 groups: control (normal temperature, 22 ± 1°C), heat stress (HS, 34 ± 1°C, 8 h/d), and HS + curcumin (300 mg/kg diet). After 21 days of treatment, pectoral muscle tissues were collected for TMT proteomics analysis. Primary chicken embryonic myoblasts were isolated and subjected to heat stress (45°C, 4 h) under DCN knockdown. Data were analyzed using one-way ANOVA, and P < 0.05 was considered statistically significant. Results showed that heat stress significantly increased the levels of malondialdehyde (MDA) and protein carbonyl (PC) in broiler pectoral muscles, decreased the activity of total superoxide dismutase (T-SOD), and downregulated the expression of antioxidant genes (Nrf2, NQO1, CAT, etc.) (P < 0.05). Meanwhile, heat stress inhibited key muscle development genes (Myf5, MyoG, IGF-1) and upregulated myostatin (MSTN) (P < 0.05). After curcumin supplementation, T-SOD activity and expression of some antioxidant genes were significantly restored, PC levels were reduced, expression of muscle development genes was improved, and DCN protein was significantly upregulated (P < 0.05). In vitro experiments showed that DCN knockdown exacerbated the inhibition of myoblast differentiation genes (MyoG, Myf6) by heat stress and activated the TGF-β/Smad pathway (upregulation of TGF-β1 and p-SMAD2/3) (P < 0.05). Mechanistically, curcumin inhibits the TGF-β signaling pathway by upregulating DCN, reduces oxidative damage, and promotes myoblast differentiation, ultimately alleviating the negative impact of heat stress on pectoral muscle development. This study provides a theoretical basis for the application of curcumin in poultry to resist heat stress and promote pectoral muscle development.

Introduction

Muscle development and pectoral muscle quality are core economic traits in the broiler industry, directly determining the nutritional value and market value of meat products, and also serving as the key to enhancing economic benefits in large-scale farming. High-quality broiler pectoral muscles need to have ideal muscle fiber density, antioxidant capacity, and protein metabolic homeostasis, yet this process is highly susceptible to interference from complex environmental factors (Yang et al., 2024). In recent years, the negative regulation of poultry muscle development by environmental pollution (such as heavy metal exposure) and extreme climates (high temperature, drought, cold, etc.) has become a significant challenge faced by global animal husbandry (Bacou et al., 2021). Among them, heat stress (HS) caused by high summer temperatures, due to its wide occurrence, long duration, and complex mechanisms, has become the primary environmental stress factor affecting broiler production efficiency (Oluwagbenga and Fraley, 2023).

The unique physiological structures of poultry (such as the absence of sweat glands, high basal metabolic rate, and thick feather coverage) make their thermoregulatory capacity significantly weaker than that of mammals (Bilal et al., 2021; Wasti et al., 2020). When environmental temperatures are too high, broiler chickens initiate excessive oxidative stress responses and abnormal inflammatory cascades, leading to pectoral muscle fiber developmental arrest, exacerbated oxidative damage, and meat quality deterioration (Abo et al., 2020; Elokil et al., 2024). Under heat stress, oxidative stress in broiler pectoral muscles increases (Abo et al., 2020; Kuehu et al., 2024; Liu et al., 2023), ultimately leading to increased myocyte apoptosis rate and decreased muscle fiber diameter (Chen et al., 2023). Meanwhile, key regulatory networks of muscle development are significantly inhibited, while expression of myostatin and fibrosis-related factors is upregulated, leading to pectoral muscle developmental retardation and decreased tenderness (Wu et al., 2024). This causes annual economic losses of billions of dollars to the global broiler industry (Adisseo, 2023).

Plant-derived antioxidants have become a hot research direction in heat stress resistance due to their multi-target regulatory properties and low toxic side effects (Abbas A and Alkheraije KA, 2023; Al-Hoshani et al., 2023; Hailat et al., 2024; Hayajneh et al., 2024). Curcumin (CUR), a lipophilic polyphenol extracted from Zingiberaceae plants, has been demonstrated to exert antioxidant, anti-inflammatory, and metabolic regulatory effects by regulating pathways such as Nrf2/ARE and AMPK (Cao et al., 2022; Ghafouri-Fard et al., 2022). Dietary curcumin can reduce intestinal permeability and maintain intestinal barrier integrity in heat-stressed ducks (Ruan et al., 2021) in quails, curcumin alleviates heat stress-induced immunosuppression by enhancing the activity of peripheral blood lymphocytes (Reda et al., 2020). Our previous experiments demonstrated that the supplementation of curcumin at a dose of 300 mg/kg represents the optimal balanced dose for achieving multi-target therapeutic effects and biosafety in Arbor Acres (AA) white-feathered broilers (Hu et al., 2025). However, its protective mechanism in heat stress-induced pectoral muscle injury of broilers remains unclear, particularly the gene regulatory networks governing muscle protein metabolic homeostasis and myofiber development have not been fully elucidated. Decorin (DCN), a member of the small leucine-rich proteoglycan (SLRP) family (Baghy et al., 2025), plays a key role in perimysium development, myofiber differentiation, and fibrosis inhibition through direct interaction with TGF-β superfamily members (such as MSTN and TGF-β1) (Liu et al., 2021a; Zhu et al., 2007). Studies have shown that DCN can competitively bind to key ligands in the TGF-β1/Smad signaling pathway, blocking muscle injury and fibrosis processes induced by them (Cui et al., 2024; Eremenko et al., 2024), However, whether heat stress exacerbates pectoral muscle injury by downregulating DCN expression, and whether curcumin can alleviate related injuries through activating DCN-mediated antifibrotic pathways, still need in-depth investigation.

Using Arbor Acres (AA) white-feather broiler chickens (male) as a model, this study systematically investigates the protective effects of curcumin against oxidative damage and developmental inhibition in pectoral muscles through in vivo heat stress model construction, TMT proteomics screening, and in vitro myoblast functional verification. It focuses on elucidating the molecular mechanism of the DCN/TGF-β signaling axis in this process. The findings will provide new targets for nutritional regulation strategies against heat stress in broilers and lay a theoretical foundation for the precise application of curcumin in poultry production.

Materials and methods

Broiler heat stress trial and meat sample collection

One-day-old Arbor Acres (AA) white-feather broiler chickens (male) were provided by Fujian Sunner Group (Nanping, China), and a total of 108 broilers were randomly divided into three groups: Control, heat stress (HS), and curcumin (CUR), with 3 replicates per group and 12 chickens per replicate. The stocking density was 15 birds/m², consistent with the standard of the Arbor Acres Broiler Raising Guide. The low-protein optimization strategy refers to the Technical Guidelines for Low-Protein, Low-Soybean Meal Diversified Feed Formulation for Major Livestock and Poultry issued by the General Station of Animal Husbandry of China. Both the feed ingredients and premix were purchased from Fujian Tianma Technology Group Co., Ltd. We entrusted the company to incorporate curcumin into the premix, which was then homogenized using the company's feed mixer. Subsequently, the mixing uniformity of curcumin was indirectly evaluated in accordance with the national standard GB/T 5918—2008. Temperature and humidity in the breeding house were monitored using automatic temperature and humidity recorders (Testo 175-H1, Germany), which were placed at 3 different positions (front, middle, rear) of each group's breeding area, and the average value was calculated daily. During the first week of the trial, the ambient temperature was maintained at 34±1°C, humidity was controlled at 60 %, and all groups (Control, HS, CUR) were fed a basal diet (Table S1). In the second week, the CUR group was supplemented with 300 mg/kg curcumin (Sigma-Aldrich, USA) in the basal diet (Li et al., 2021), temperature and humidity were maintained constant. In the third week, the ambient temperature was reduced to 25±1°C, while humidity remained unchanged. From week 4 to week 6, the room temperature and humidity of the Control group remained at 22±1°C, 60 %. The HS and CUR groups were subjected to a 21-day cyclic heat stress treatment, with the temperature maintained at 34±1°C from 9:00 to 17:00 and at 22±1°C from 17:00 to 9:00 the next day. On day 42 of the trial (day 21 of heat stress initiation), 9 chickens per group were randomly selected for slaughter. Fresh bilateral pectoral muscle tissues were collected into 2 mL cryotubes, rapidly frozen in liquid nitrogen for 24 h, and then stored at −80°C. The left pectoral muscles were used for the detection of antioxidant-related indices and gene expression levels, while the right pectoral muscles were ere subjected to tandem mass tag (TMT) proteomics analysis.

Determination of malondialdehyde (MDA), protein carbonyl (PC), total superoxide dismutase (T-SOD), and reactive oxygen species (ROS) levels

Following the manufacturer's instructions of the kits, MDA (Nanjing Jiancheng, China), PC (Nanjing Jiancheng, China), and T-SOD (Nanjing Jiancheng, China) in pectoral muscle tissues were detected. Absorbance at specific wavelengths was measured using a NanoDrop 2000c (Thermo Fisher, USA), and the absorbance values were converted to MDA/PC contents according to standard curves. T-SOD content in the samples was calculated based on the definition of SOD enzyme activity.

Real-time quantitative PCR

RNA was extracted from pectoral muscle tissues using Trizol (Invitrogen, USA), and the RNA was detected with a NanoDrop 2000c (Thermo Fisher, USA). RNA with an OD260/OD280 ratio between 1.8 and 2.0 was selected. The procedures and steps for reverse transcription were referenced from our previously published article (Hu et al., 2024). Primers were designed and synthesized by Sangon Biotech Co., Ltd (Shanghai, China). Gene expression was detected using a real-time fluorescence quantitative PCR detection system, and the gene expression levels were calculated by the 2^-ΔΔCt method (Damgaard and Treebak, 2022).Each sample had three biological replicates and three technical replicates. The primer sequences and parameters for muscle development and antioxidant-related genes are shown in Table 1.

Table 1.

Primer sequences and parameters for Q PCR detection of breast muscle development and antioxidant related genes.

Gene	Primer Sequence (5′→3′)	Product Length/bp	Login Number
Myf5	(F) AGGAGGCTGAAGAAAGTGAACCAAG	115	NM_001030363.2
	(R) CGATGTACCTGATGGCGTTCCTC
Myf6	(F) CCTCATCTGGGCCTGCAAAACC	135	NM_001030746.3
	(R) GCCACAGTCCGCCTTTTCAGAG
MyoD	(F) GGGAACCCACACGAGGAGGAG	113	NM_204214.3
	(R) CGGTCAGCGTTGGTGGTCTTC
MyoG	(F) CGGAGCAGAGGTTTTACGATGGG	107	NM_204184.2
	(R) CTTATCCGAGCGAGTGTGCCATG
FST	(F) TTCCTCTTCTTCCTCTGGGTCTTCG (R) CCTAGCAGCACTTCCTTCCACAAC	116	NM_205200.2
MSTN	(F) GGTACACCAAGCAAATCCCAGAGG (R) AGCACCCGCAACGATCTACAAC	146	NM_001001461.2
IGF-1	(F) GCAGTAGACGCTTACACCACAAGG (R) ACAGTACATCTCCAGCCTCCTCAG	83	NM_001004384.3
Nrf2	(F) GGGACGGTGACACAGGAACAAC (R) TCCACAGCGGGAAATCAGAAAGATC	93	NM_001396902.1
NQO1	(F) CGAGTGCTTTGTCTACGAGATGGAG (R) AGGTCAGCCGCTTCAATCTTCTTC	102	NM_001277619.2
HO-1	(F) GCTGGGAAGGAGAGTGAGAGGAC (R) GCGACTGTGGTGGCGATGAAG	107	NM_205344.2
CAT	(F) TCTCATTCCAGTGGGCAAGATTGTC (R) GCTAGGGTCATACGCCATCTGTTC	85	NM_001031215.2
GPX4	(F) CCGCTGTGGAAGTGGCTGAAG	132	NM_001346448.2
	ATCCTCCATTGGGCTGTACCTTTTC
GPX1	(F) AAGTGCTGCTGGTGGTCAACG	146	NM_001277853.3
	(R) GTTCTCCTGGTGCCCGAATTGG
SOD1	(F) GGTCATCCACTTCCAGCAGCAG (R) AAGCCATGATCTCCATCAGACAAGC	84	NM_205064.2
SOD2	(F) TTCCTGACCTGCCCTACGACTATG (R) TGGCGTGGTGTTTGCTGTGG	87	NM_204211.2
β-actin	(F) GCCCTGGCACCTAGCACAATG	129	NM_205518.2
	(R) CTCCTGCTTGCTGATCCACATCTG
GAPDH	(F)ACTGTCAAGGCTGAGAACGG	149	NM_204305.2
	(R)GCCTTCTCCATGGTGGTGAA

TMT proteomics sequencing and PRM validation

The right pectoral muscles were sent to Shanghai Majorbio Bio-pharmaceutical Technology Co., Ltd. for proteomics sequencing, and parallel reaction monitoring (PRM) based on mass spectrometry was used to validate differentially expressed proteins.

Pooled samples from 9 pectoral muscle tissues per group were mixed, and cells were lysed with RIPA lysis buffer (Beyotime, China) containing protease and phosphatase inhibitors. Protein concentration was determined using a BCA kit (Nanjing Jiancheng, China). Subsequently, six core proteins of the TGF-β signaling pathway (OL1A1, DCN, GDP1, IGH, LUM, and PYG) were selected to verify the pathway activation status based on TMT proteomics sequencing results. Target proteins were compared with a background library, and after optimizing theoretical peptide digestion parameters, 15 specific peptides (including shared peptides) from 6 target proteins were screened for PRM mass spectrometry analysis. Finally, data analysis of PRM raw files was performed using Proteome Discoverer (Thermo Scientific, version 2.2). Relative expression levels of target proteins were converted according to standard curves, and the expression trends of target proteins in different sample groups were compared with TMT sequencing results to validate the reliability of differentially expressed proteins.

Table 2

Table 2.

The information of si-RNA sequence.

gene	sequence (5′→3′)
DCN-1099	Sense: GUGGUCUAUCUUCAUAACATT
	Antisense: UGUUAUGAAGAUAGACCACTT
DCN-672	Sense: GGAGAUACGUGCUCAUGAATT
	Antisense: UUCAUGAGCACGUAUCUCCTT
DCN-471	Sense: GGAUUUACAGAACAACAAATT
	Antisense: UUUGUUGUUCUGUAAAUCCTT
DCN—NC	Sense: UUCUCCGAACGUGUCACGUTT
	Antisense: ACGUGACACGUUCGGAGA ATT

Isolation and purification of primary chicken embryonic myoblasts

Eleven-day-old specific pathogen-free (SPF) fertilized eggs were purchased from Jinan Spark Poultry Co., Ltd. (Jinan, China). After disinfection with 75 % ethanol, pectoral muscle tissues were excised and digested with 0.25 % trypsin (Beyotime, Shanghai, China) for cell extraction. After termination of digestion, the cell suspension was filtered through a 200-mesh sieve and centrifuged at 1000 rpm for 5 min. The cell precipitate was resuspended in DMEM medium containing 20 % serum (Tocyto, Australia) and 100 μM BrdU (Sigma-Aldrich, USA), inoculated into culture flasks, and incubated at 39°C with 5 % CO₂ for 2 h (differential adhesion time) to remove fibroblasts. The non-adherent cells were collected and cultured as primary chicken embryonic myoblasts. After 24 h, the medium was replaced with complete medium containing 20 % serum for continuous culture. All procedures involving chicken embryos were approved by the Animal Ethics Committee of Fujian Agriculture and Forestry University (Approval No. PZCASFAFU24042).

Induction, differentiation, and identification of primary chicken embryonic myoblasts

When cell density reached 80 % confluence, the original culture medium was replaced with differentiation medium containing 2 % horse serum (Hyclone, USA) to induce differentiation of primary chicken embryonic myoblasts. The isolated cells were evenly seeded into 6-well plates pre-embedded with cell slides in the center. After culturing to 70 % confluence, cells were fixed with 4 % paraformaldehyde, permeabilized with 0.1 % Triton X-100 (G3068-100ML, Servicebio), and blocked with 5 % BSA. Primary antibody Desmin (GB15075-50, Servicebio) was added and incubated at 4°C overnight. After thorough washing with PBS, secondary antibody CY3 (GB114304-100, Servicebio) was added and incubated for 60 min at room temperature in the dark, followed by sufficient PBS washing. DAPI (GDP1024, Servicebio) was added for nuclear staining for 10 min, followed by thorough PBS washing, mounting, and observation under an inverted fluorescence microscope (Thermo Fisher, USA).

Construction of DCN gene interference plasmid

The DCN interference plasmid was designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. based on the CDS region sequence of the chicken DCN gene from the NCBI database.

Cell transfection and detection of TGF-β signaling pathway-related gene expression

Cells were divided into DCN—NC, DCN-1099, DCN-672, and DCN-471 groups. When cell density reached 80 % and cell status was good, transfection was performed according to the instructions of Lipofectamine™ 3000 (L3000150, Invitrogen, USA). After culturing in a 39°C incubator for 6 hours, transfection efficiency was detected using a fluorescence microscope (Thermo Fisher, USA), and 1 mL of complete medium was added to continue culturing for 48 hours. The heat stress group was transferred to a 45°C incubator for an additional 4 hours. Fluorescence quantitative PCR was used to detect the expression of TGF-β signaling pathway-related genes. The primer sequences and parameters of the genes are shown in Table 3.

Table 3.

Primer sequences and parameters of TGF - β signaling pathway related genes.

Gene	Primer Sequence (5′→3′)	Product Length/bp	Login Number
DCN	(F) ATATCCGCATCGCAGACACCAAC	121	NM_001030747.3
	(R) AGTCCAGACAGACCTTCCGCATC
TGF-β1	(F) CCGACACGCAGTACACCAAGG	125	NM_001318456.1
	(R) ATTCCGGCCCACGTAGTAAATGATG
TGF-β2	(F) CTTGAGTCGCAACAGCCCAGTC	95	NM_001031045.4
	(R) AGTGGACGCAGGCAGCAATTATC
Smad2	(F) TGTCATCCATTCTGCCATTCACTCC	121	NM_001396710.1
	(R) CACCACTTCTCCTCTTGCCCATTC
Smad3	(F) AGACGGCACATCGGAAGAGGAG	81	NM_204475.2
	(R) AATGGCACTGTCACTAAGGCACTC
β-actin	(F) GCCCTGGCACCTAGCACAATG	129	NM_205518.2
	(R) CTCCTGCTTGCTGATCCACATCTG
GAPDH	(F)ACTGTCAAGGCTGAGAACGG	149	NM_204305.2
	(R)GCCTTCTCCATGGTGGTGAA

Western blotting

Cells were digested with trypsin, lysed with RIPA lysis buffer (Beyotime, China) containing protease and phosphatase inhibitors to extract total protein, and protein concentration was measured using a protein quantification kit (Nanjing Jiancheng, China). Extracted proteins were separated by 10 % SDS-PAGE (Biyuntian, China) and then transferred to a PVDF membrane (GE Healthcare, USA). Blocking was performed with 5 % BSA, and primary antibodies against DCN (bs-22748P, Bioss), MyoG (#HA500492, Huabio), TGF-β1 (#EH0012, Huabio), SMAD2 (#ET1604-22, Huabio), p-SMAD2 (#ET1612-32, Huabio), SMAD3 (#ET1607-41, Huabio), GAPDH (#EM1101, Huabio) , and p-SMAD3 (#ET1609-41, Huabio) were incubated overnight at 4°C on a shaker. After washing with 1 × TBST, appropriate horseradish peroxidase-conjugated secondary antibodies (Servicebio, China) (1:5000) were incubated for 2 hours at room temperature on a shaker. Color development and photography were performed using an ECL imaging system (BIO-RAD, USA), and grayscale value analysis of Western Blot images was conducted using ImageJ software.

Data processing and statistical analysis

Experimental data are presented as mean ± standard error of the mean (X±SEM). One-way ANOVA was performed using IBM SPSS Statistics 26.0, with a significance level of P < 0.05.

Results and analysis

Effects of curcumin on the production performance of broilers under heat stress

As shown in Table 4, the impact of heat stress on broiler production performance exhibited a stage-dependent variation. During the initial heat stress period (21-30 d), the heat-stressed group showed a significant reduction in average daily gain (ADG) alongside a significant increase in the feed conversion ratio (FCR) compared to the control group. However, this trend was reversed in the later stage (31-42 d), where the heat-stressed group demonstrated a significant improvement in ADG and a significant decrease in FCR relative to the control. Furthermore, supplementation with a high dose of curcumin during the later stage resulted in the most optimized performance, characterized by a significantly greater ADG than all other groups and a lower FCR than the control group.

Table 4.

Effects of curcumin on the production performance of broilers under heat stress.

Stage	measurement indicators	Control	HS	CUR
1-12d	ADG (g)	20.74±0.24a	20.10±0.16ab	19.68±0.32b
	DFI (g)	23.04±1.04a	24.08±0.00a	24.08±0.00a
	FCR (g)	1.11±0.06a	1.20±0.01a	1.21±0.02a
13-20d	ADG (g)	37.54±2.56a	38.63±1.54a	41.24±0.62b
	DFI (g)	49.95±1.27a	50.32±0.97a	49.87±2.92a
	FCR (g)	1.34±0.06a	1.31±0.04c	1.21±0.05b
21-30d	ADG (g)	54.20±2.86a	46.90±2.05b	49.03±1.18ab
	DFI (g)	72.71±1.02a	73.33±1.70a	68.17±2.40b
	FCR (g)	1.35±0.06a	1.57±0.07b	1.39±0.07ab
31-42d	ADG (g)	53.39±4.64a	59.61±2.95b	65.94±6.01c
	DFI (g)	104.94±2.65a	96.23±1.47a	101.13±0.35a
	FCR (g)	2.00±0.20a	1.62±0.11b	1.56±0.14b
42d	BW (kg)	2.05±0.10a	1.87±0.08b	2.13±0.06a

Note: ADG, average daily gain; DFI, daily feed intake; FCR, feed conversion ratio; BW, body weight. Experimental data are presented as mean ± standard error of the mean (X±SEM). Data were analyzed using one-way analysis of variance followed by Duncan’s multiple range test, with P < 0.05. Values with the same superscript letters indicate no significant difference among groups, while different superscript letters indicate significant differences.

Effect of curcumin on antioxidant capacity of heat-stressed broiler pectoral muscles

To investigate the effect of curcumin on the antioxidant capacity of broiler pectoral muscles under heat stress, we detected antioxidant-related indices and gene expression levels in pectoral muscles. After 21 days of heat stress, MDA levels in broiler pectoral muscles increased 0.06 nmol/mgprot (P < 0.01) (Fig. 1A), and T-SOD activity decreased 23 U/mgprot (P < 0.01) (Fig. 1B). After curcumin supplementation, MDA levels showed no significant change (P > 0.05), while T-SOD activity increased 27 U/mgprot (P < 0.01), and PC levels decreased 0.2 mmol/mgprot (P < 0.01) (Fig. 1C).

Fig. 1.

Effect of curcumin on antioxidant capacity of heat-stressed broiler pectoral muscles. A: MDA levels; B: T-SOD activity. C: PC levels. D: Effect of curcumin on antioxidant gene expression in heat-stressed broiler pectoral muscles.

Q-PCR analysis showed that after 21 days of heat stress, the transcriptional levels of Nrf2, NQO1, HO-1, CAT, GPX4, SOD1, and SOD2 in pectoral muscles all decreased extremely significantly (P < 0.01), while the transcriptional level of GPX1 decreased significantly (P < 0.05) (Fig. 1D). After curcumin addition, the transcriptional levels of NQO1, CAT, and SOD1 increased extremely significantly (P < 0.01), while those of Nrf2 and HO-1 increased significantly (P < 0.05), and the gene expressions of GPX1, GPX4, and SOD2 showed no significant differences (P > 0.05). This indicates that heat stress exacerbates oxidative damage in broiler pectoral muscles, decreases antioxidant enzyme activity and gene expression related to the Nrf2 pathway. Curcumin selectively upregulates the expression of partial antioxidant genes by activating the Nrf2 pathway, enhances antioxidant enzyme activity to alleviate protein oxidative damage, but has no significant effect on lipid peroxidation products.

Effect of curcumin on development-related genes in heat-stressed broiler pectoral muscles

To investigate the effect of curcumin on development-related genes in broiler pectoral muscles under heat stress, Q-PCR analysis revealed that after 21 days of heat stress, the expression levels of Myf5, MyoG, FST, and IGF-1 in the curcumin-supplemented group were significantly higher than those in the heat stress group (P < 0.05). The expression level of Myf6 was extremely significantly increased (P < 0.01), while the expression level of MSTN was significantly decreased (P < 0.05) (Fig. 2). These results indicate that curcumin can significantly upregulate the expression of developmental promoting genes such as Myf5, MyoG, FST, IGF-1, and Myf6, and downregulate the expression of the inhibitory gene MSTN in broiler pectoral muscles under heat stress, thereby alleviating the inhibitory effect of heat stress on pectoral muscle development.

Fig. 2.

Effect of Curcumin on Development-Related Gene Expression in Heat-Stressed Broiler Pectoral Muscles.

Proteomic analysis of broiler pectoral muscles fed curcumin under heat stress

We further employed proteomic analysis to screen key proteins and signaling pathways associated with curcumin-regulated heat-stressed muscles, aiming to reveal the molecular mechanisms by which curcumin maintains protein homeostasis in broiler pectoral muscles. Comparative analysis between the curcumin and heat stress groups identified 73 upregulated proteins (FC > 1.2, P < 0.05) and 14 downregulated proteins (FC < 0.83, P < 0.05) (Fig. 3A). Among these, proteins involved in muscle tissue repair and developmental regulation, such as COL1A1, COL6A3, LUM, and DCN, were upregulated, while proteins maintaining myocyte morphology and function, including SMAD9 and SMAD8, also showed increased expression.

Fig. 3.

Proteomic Analysis of Broiler Pectoral Muscles under Curcumin Treatment during Heat Stress. A: Volcano plot of differentially expressed proteins (73 upregulated, 14 downregulated); B: GO functional enrichment of differentially expressed proteins; C: KEGG pathway enrichment of differentially expressed proteins; D: Key proteins in TGF-β, AMPK, and other signaling pathways; E: PRM validation of six differentially expressed proteins.

GO functional enrichment analysis (Fig. 3B) indicated that curcumin regulates myocyte enzyme activities to influence extracellular matrix and collagen synthesis/processing, participate in cell signal transduction, and alleviate heat stress-induced muscle damage. KEGG enrichment analysis revealed that differentially expressed proteins were primarily enriched in pathways such as Protein digestion and absorption, Terpenoid backbone biosynthesis, and TGF-β signaling (Fig. 3C). Further analysis (Fig. 3D) showed that SLC1A5 and SLC7A1 played key roles in protein digestion and absorption, IDO and TPH dominated tryptophan metabolism, TGFBR1, SMAD2, SMAD3, and DCN were essential components of the TGF-β signaling pathway, FADS1 and FADS2 participated in α-linolenic acid metabolism, and AMPK, mTOR, etc., served as key regulatory proteins in the AMPK signaling pathway. Notably, potential crosstalk existed among pathways, such as the interaction between the DCN-involved TGF-β pathway and the AMPK pathway. These results suggest that curcumin protects pectoral muscle development by modulating the expression of multiple pathway proteins under heat stress.

To validate the reliability of proteomic sequencing results, six differentially expressed proteins were randomly selected for PRM verification (Fig. 3E). The expression trends of COL1A1, DCN, GDP1, IGH, LUM, and PYG were consistent with TMT results, confirming the objectivity and reliability of the proteomic analysis.

Induction, differentiation, and immunofluorescence identification of chicken embryonic myoblasts

To further validate the functional mechanism of DCN protein in curcumin-regulated heat-stressed muscles, we constructed a DCN protein interference vector for transfection experiments in myocytes to observe its effects on cell phenotype and related protein expression. After three rounds of differential adhesion, the number of adherent fibroblasts was significantly reduced, and the purity of myoblasts met the requirements for subsequent experiments (Fig. 4A). One day after induction of differentiation, the boundaries between myoblasts began to blur, directional cell alignment became more prominent, and some myoblasts fused with each other to form myotubes. With prolonged time, myotubes gradually became more regular and uniform in thickness. On day 5, further integration of myotubes was observed with significant thickening and elongation (Fig. 4B), indicating that the isolated myoblasts exhibited good myogenic potential and myotube formation ability. Immunofluorescence was used to identify the myoblast-specific marker gene Desmin, observed and photographed under an inverted fluorescence microscope. Red fluorescence represented Desmin protein labeled with CY3, and blue fluorescence indicated cell nuclei labeled with DAPI. The Desmin antibody bound well to cellular proteins, with most cells showing strong red fluorescence (Fig. 4C), consistent with the characteristics of primary chicken embryonic myoblasts. This confirms that most isolated cells were myoblasts.

Fig. 4.

Induction, Differentiation, and Identification of Chicken Embryonic Myoblasts. A: Purity of myoblasts after differential adhesion. Differential Adhesion of Primary Fibroblasts: 1st, 2nd, and 3rd Rounds(scale bar = 100 µm); B: Myotube formation at day 5 of differentiation (scale bar = 50 µm); C: Immunofluorescence staining of Desmin (red) and DAPI (blue) in myoblasts (scale bar = 50 µm).

Screening of siRNA fragments for DCN knockdown in myoblasts

After transfection of primary chicken embryonic myoblasts, green fluorescence was observed in fluorescence images (Fig. 5A), indicating successful transfection of the fluorescently labeled interference vector into myoblasts. Combined with Q-PCR results (Fig. 5B), the relative expression levels of the DCN gene in the DCN-1099, C, and DCN-471 groups were significantly lower than those in the NC group, showing statistical differences of P < 0.05 and P < 0.01, respectively. No significant differences were observed among DCN-1099, DCN-672, and DCN-471 groups (NS), fully demonstrating that the DCN-1099, DCN-672, and DCN-471 interference vectors effectively transfected myoblasts and inhibited DCN gene expression. Among them, DCN-471 showed the best interference effect with an efficiency of 47.08 %, making the DCN-471 interference fragment suitable for subsequent experiments.

Fig. 5.

Efficiency of DCN siRNA Fragments in Myoblasts. A: Fluorescence microscopy image of transfected myoblasts (green fluorescence indicates successful transfection, scale bar = 50 µm); B: Q-PCR analysis of DCN gene expression after siRNA transfection.

Effect of DCN knockdown on primary chicken embryonic myoblasts

Curcumin requires lipid nanoparticles for cellular uptake (Ganassin et al., 2022; Gupta et al., 2020), so curcumin was not added in cell-level experiments. To investigate the effect of DCN on oxidative stress, proliferation, and differentiation of primary chicken embryonic myoblasts, we detected reactive oxygen species (ROS) levels and expression of proliferation/differentiation-related genes after interfering with DCN expression. Heat stress increased ROS levels in myoblasts (53.3 %, P < 0.05), while DCN knockdown combined with heat stress trended toward higher ROS levels, though not significantly (13.3 %, P > 0.05) (Fig. 6A). Transcriptional levels of MyoG, Myf6, MyoD, and IGF-1 were downregulated, while MSTN was upregulated in DCN-knockdown myoblasts under heat stress (Fig. 6B), indicating inhibited myoblast differentiation and muscle development.

Fig. 6.

Effect of DCN Knockdown on Primary Chicken Embryonic Myoblasts. A: Effect of DCN knockdown on reactive oxygen species (ROS) levels in primary chicken embryonic myoblasts, Different letters indicate different significance levels, A denotes no significant difference, B indicates significant difference (P < 0.05), and C signifies extremely significant difference (P < 0.01); B: Effect of DCN knockdown on the expression of key developmental genes in myoblasts under heat stress; C: Effect of DCN knockdown on the expression of TGF-β signaling pathway proteins in myoblasts under heat stress.

To further confirm that DCN regulates myoblast growth and differentiation via the TGF-β pathway, cells were divided into four groups: Control-NC, DCN-471, HS-NC, and HS+DCN-471. Western blotting was used to detect the differentiation marker MyoG and TGF-β pathway-related proteins (Fig. 6C). Compared with Control-NC, DCN-471, HS-NC, and HS+DCN-471 groups showed reduced MyoG protein levels, increased TGF-β1, p-SMAD2, and p-SMAD3 expression, indicating activation of the TGF-β signaling pathway. Compared with HS-NC, HS+DCN-471 more potently inhibited MyoG expression and activated TGF-β1, p-SMAD2, and p-SMAD3.In summary, both DCN knockdown and heat stress inhibited MyoG expression and activated the TGF-β pathway in myoblasts, with combined heat stress and DCN knockdown exerting a stronger effect. These results confirm that DCN regulates myoblast growth and differentiation via the TGF-β pathway.

Fig. 7

Fig. 7.

The regulation of curcumin on muscle development in broilers under heat stress.

Discussion

As a core breeding variety in animal husbandry, white-feather broiler chickens exhibit rapid growth, vigorous nutritional metabolism, and a lack of sweat glands under modern intensive farming models, leading to significantly reduced tolerance to thermal environments (Sumanu et al., 2022). Heat stress disrupts the body's redox balance, triggering excessive free radical production and muscle oxidative damage (Hashemitabar and Hosseinian, 2024) . MDA serves as a key marker of in vivo oxidative damage, with its content in tissues or cells reflecting the degree of oxidative injury (Chen et al., 2024) . PC as an important indicator of muscle protein oxidation, shows a significant negative correlation with meat quality (Liu et al., 2024) . Previous studies have shown that oxidative stress significantly increases PC levels in broiler pectoral muscles, leading to disruption of muscle fiber structure and decreased pectoral muscle weight (Cartoni et al., 2023; Habashy et al., 2019). This study found that dietary curcumin supplementation under heat stress significantly enhanced T-SOD enzyme activity and reduced carbonyl content in pectoral muscles, effectively alleviating chronic heat stress-induced oxidative damage. Although curcumin did not significantly affect MDA content, its role in enhancing antioxidant enzyme activity and reducing protein oxidative damage has preliminarily revealed its anti-heat stress effect.

Heat stress triggers endoplasmic reticulum (ER) protein homeostasis imbalance, leading to the accumulation of misfolded proteins and subsequent ER stress (Folahan et al., 2024) . This study found that prolonged heat stress (21 days) upregulated the expression of HSP110, DNAJA4, and DNAJB5 in broiler pectoral muscles, indicating that the body faces both protein homeostasis disruption and activated defense mechanisms against thermal damage. In the skeletal muscle development regulatory network, Myf5 and MyoD act as key determinants of myogenesis, while MyoG and Myf6 dominate the differentiation of myoblasts into myotubes (Ma et al., 2015; Tsuji et al., 2025) . This study confirmed that curcumin intervention significantly reversed the inhibitory effect of heat stress on Myf5, MyoG, and Myf6, and upregulated MyoD expression, thereby promoting pectoral muscle development. Findings show that MSTN gene overexpression significantly inhibits the proliferation and differentiation of pectoral muscle satellite cells, leading to muscle hypoplasia (Mishra et al., 2022; Wang et al., 2025) . In MSTN-interfere mice, skeletal muscle mass significantly increases (Degens et al., 2025) . Previous studies have indicated that MSTN and IGF-1 regulate skeletal muscle growth by modulating the transcriptional levels of the MRFs family(Kumar et al., 2018) . We further confirmed that heat stress-induced MSTN overexpression suppresses satellite cell proliferation and differentiation, while curcumin relieves MSTN-mediated muscle development inhibition by downregulating MSTN and upregulating FST and IGF-1 transcription.

DCN (Decorin), an important regulatory factor in the extracellular matrix, finely modulates skeletal muscle proliferation, differentiation, and regeneration by binding to growth factors such as IGF-1 receptor, MSTN, and TGF-β(Broniec et al., 2024; Li et al., 2008) . Proteomic screening in this study revealed that curcumin significantly activated DCN protein expression under heat stress, a phenomenon consistent in both in vivo pectoral muscle tissues and in vitro myoblast models. In transgenic models, DCN overexpression has been shown to upregulate core myogenic factors like MyoD and FST (Palma-Flores et al., 2023). Experiments in duck myoblasts further indicate that DCN directly drives myoblast differentiation by promoting MyoD expression, increasing myonuclear number, and inducing myotube hypertrophy (Liu et al., 2021b) . Our in vitro studies showed that heat stress significantly suppressed the expression of differentiation genes MyoG, Myf6, MyoD, and IGF-1, while upregulating MSTN, suggesting significant inhibition of the MRFs family regulatory network. Knocking down DCN expression synergized with heat stress to exacerbate myoblast differentiation inhibition, confirming DCN's critical role in mitigating heat stress damage.

TGF-β signaling is involved in regulating heat stress-induced oxidative stress, inflammatory response, and tissue fibrosis (Deng et al., 2024). Transforming Growth Factor-β1 (TGF-β1)and Myostatin (MSTN), as members of the TGF-β superfamily, act as potent inhibitors of myoblast proliferation and differentiation, and regulators of muscle extracellular matrix (ECM) production (Gardner et al., 2011). Studies have shown that TGF-β inhibits the regulatory effect of MRFs family on muscle development by blocking the synergistic interaction between MEF2 and MRFs members (Samant et al., 2017) . SMAD3, activated by TGF-β1, binds to the bHLH region of the MyoD gene to directly suppress myocyte differentiation (Gallardo et al., 2025; Kablar, 2002) . Additionally, TGF-β1 has been found to significantly increase cellular ROS levels in skeletal muscle (Abrigo et al., 2015; Chen et al., 2021) This study found that heat stress led to a significant increase in ROS levels in myoblasts, disrupting myocyte functional structure, and significantly enhancing the transcriptional activity of TGF-β1, TGF-β2, and SMAD2, thus upregulating the TGF-β/Smad signaling pathway. Knocking down DCN expression further exacerbated this effect, suggesting that DCN may serve as a key negative regulator of the TGF-β signaling pathway. Combining the previous results, we speculate that curcumin upregulates DCN expression, antagonizes TGF-β1/SMAD2/3 signaling, reduces ROS production, relieves the inhibition of the MRFs family, and ultimately promotes pectoral muscle development and alleviates heat stress damage. Clarification of this mechanism provides an important theoretical basis for the application of curcumin in avian heat stress resistance. Future research may focus on exploring the combined effects of curcumin with other phytogenic compounds or probiotics to alleviate heat stress as well as extending the findings to other poultry species to verify their universality.

Conclusion

In summary, heat stress disrupts redox balance and protein homeostasis in white-feather broilers, inhibits muscle development-related genes, and promotes MSTN overexpression. Curcumin effectively alleviates heat stress-induced oxidative damage and promotes pectoral muscle development. In vitro studies show that heat stress suppresses myoblast-related gene transcription, while DCN relieves heat stress-induced skeletal muscle damage. Additionally, heat stress activates the TGF-β/Smad signaling pathway, and DCN knockdown negatively regulates myoblast differentiation. This study reveals the complex relationships among heat stress, oxidative stress, muscle development, and the regulatory roles of curcumin and DCN, providing a foundation for exploring the molecular mechanisms of muscle growth and development under heat stress.

Funding

The research was supported by the Science and Technology Innovation Special Fund of Fujian Agriculture and Forestry University [grant number KFB23103A] . and the Horizontal Project Funding of Fujian Agriculture and Forestry University [grant number KH230396A, KH240307A].

CRediT authorship contribution statement

Dingping Bai: Supervision, Methodology, Funding acquisition, Conceptualization. Yingxiu Hu: Writing – review & editing, Writing – original draft. Yuting Liu: Validation, Formal analysis. Mengru Xue: Software. Xuelian Liu: Resources, Investigation, Data curation.

Disclosures

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Ying-Xiu Hu reports financial support was provided by Science and Technology Innovation Special Fund of Fujian Agriculture and Forestry University. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

Data will be made available on request.