Abstract
Background
Hepatocellular carcinoma (HCC) is one of the most common types of primary liver cancer worldwide. It is characterized by high heterogeneity and poor prognosis, and current treatment outcomes remain limited. Studies have shown that propofol possesses certain anticancer properties. However, the combined effects of albiflorin and the underlying mechanisms remain unclear. This study aimed to evaluate the anticancer activity of albiflorin in HCC, further investigate the combined effects and underlying mechanism of albiflorin and propofol.
Methods
Huh-7 cells were treated with different concentrations of albiflorin (0, 25, 50, and 100 μg/mL) and propofol (0, 30, 60, and 120 μM), either alone or in combination. The effects on cell proliferation, apoptosis, migration, and invasion were evaluated. Cell proliferation was assessed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Apoptosis and epithelial-mesenchymal transition (EMT) were measured by flow cytometry and western blotting, and cell migration and invasion were evaluated using Transwell assays. Additionally, the expression of key Wnt/β-catenin signaling molecules was analyzed by western blotting and reverse transcription-quantitative polymerase chain reaction to explore potential mechanisms.
Results
Both albiflorin and propofol alone inhibited the proliferation, migration, invasion, and EMT of Huh-7 cells in a dose-dependent manner and promoted apoptosis. The combination of albiflorin and propofol effectively enhanced the inhibitory effects of propofol on HCC cells. Mechanistic studies revealed that the combined treatment significantly downregulated the expression of Wnt3a and β-catenin, suggesting that the antitumor effects may be mediated through the suppression of the Wnt/β-catenin signaling pathway.
Conclusions
Albiflorin and propofol exert synergistic inhibitory effects on HCC cell proliferation, migration, invasion, and EMT while promoting apoptosis. These effects are likely associated with suppression of Wnt/β-catenin signaling. This study provides new experimental evidence supporting the development of multitargeted combination therapies and identifies potential molecular targets for comprehensive HCC treatment.
Keywords: Albiflorin, propofol, hepatocellular carcinoma (HCC), Wnt/β-catenin signaling pathway
Highlight box.
Key findings
• The combination of albiflorin and propofol effectively inhibits hepatocellular carcinoma (HCC) cell proliferation, migration, invasion, and epithelial-mesenchymal transition, and promotes apoptosis, likely through synergistic suppression of the Wnt/β-catenin signaling pathway.
What is known and what is new?
• Propofol exhibits significant antitumor activity in HCC, and albiflorin possesses certain anticancer properties.
• This study firstly demonstrates that albiflorin and propofol exert synergistic inhibitory effects on HCC progression.
What is the implication, and what should change now?
• This study provides experimental evidence supporting the combined use of natural compounds and anesthetics in HCC therapy and lays the groundwork for developing multi-targeted precision treatment strategies.
• Further in vivo investigations are warranted to evaluate the therapeutic potential of albiflorin and propofol.
Introduction
Hepatocellular carcinoma (HCC) is one of the most prevalent primary liver cancers worldwide and has become a leading cause of cancer-related mortality in China (1,2). Major risk factors for HCC include hepatitis B virus infection, non-alcoholic fatty liver disease, and metabolic syndrome (3). Due to the lack of obvious symptoms in the early stages, most patients are diagnosed at intermediate or advanced stages, making treatment challenging and prognosis poor. Although surgical resection, liver transplantation, and local ablation are applicable for early-stage HCC, the cure rate remains below 13% (4). While molecular targeted therapies and immune checkpoint inhibitors have improved survival in some patients, their efficacy is limited by drug resistance, recurrence, and tumor heterogeneity (5). Therefore, the development of new anticancer agents and combination treatment strategies has become a current research focus.
Studies have shown that active components of traditional Chinese medicine (TCM) exhibit unique advantages in the treatment of malignant tumors. Paeonia lactiflora, a traditional Chinese medicinal herb, possesses various biological functions, including anti-inflammatory, anticancer, antioxidant, and immunomodulatory activities (6-8). Albiflorin is the primary active constituent of Paeonia lactiflora, which has been demonstrated to alleviate inflammation, modulate the tumor microenvironment, and inhibit cancer cell growth (9,10). Albiflorin is a key active constituent of the classic TCM formula, Compound Siwu Decoction (SWD) (11,12). A recent study has demonstrated that SWD modulates myeloid-derived suppressor cells (MDSCs), inhibits HCC cell necrosis, and suppresses tumor progression (11). However, the anticancer effects and precise molecular mechanisms of albiflorin in HCC remain unclear.
Propofol (2,6-diisopropylphenol) is a widely used anesthetic and sedative agent (13). Recent studies have demonstrated that, in addition to the anesthetic effects, propofol possesses the potential to inhibit the proliferation and migration of various cancer cells and to induce apoptosis, exhibiting significant antitumor activity in HCC (14,15). Therefore, the combined application of albiflorin and propofol may exert synergistic anticancer effects in HCC treatment. However, the underlying mechanisms remain insufficiently studied.
The Wnt/β-catenin signaling pathway plays a critical regulatory role in cell proliferation, differentiation, apoptosis, and tissue homeostasis. Aberrant activation of this pathway is closely associated with the initiation, progression, and drug resistance of HCC (16,17). Approximately 30% of HCC patients exhibit excessive activation of the Wnt/β-catenin pathway, which promotes tumor growth and contributes to sorafenib resistance (18). Inhibition of this pathway has been shown to reduce tumorigenicity and cancer stem cell properties (18,19). Moreover, the Wnt/β-catenin pathway is also implicated in tumor immune evasion, ferroptosis resistance, and chemotherapy resistance (20,21). Therefore, targeting the regulation of the Wnt/β-catenin pathway may provide new therapeutic strategies for HCC.
This study aimed to evaluate the anticancer activity of albiflorin in HCC, further investigate the combined effects of albiflorin and propofol, and explore whether their potential synergistic inhibition of HCC is mediated through the Wnt/β-catenin signaling pathway. The ultimate goal is to provide new theoretical insights and therapeutic strategies for the comprehensive treatment of HCC. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1246/rc).
Methods
Cell culture
The human HCC cell line Huh-7 was obtained from the Cell Bank of the Chinese Academy of Medical Sciences (Shanghai, China). Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; BasalMedia, China) supplemented with 10% fetal bovine serum (FBS; Gibco, USA) and maintained in a humidified incubator at 37 ℃ with 5% CO2. The LO2 cells were obtained from Cellverse Co., Ltd. (iCell-h054, Shanghai, China) and grown in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, USA) supplemented with 10% FBS (Gibco, USA) at 37 ℃ with 5% CO2.
Drug treatment
Huh-7 cells were seeded into appropriate culture plates and treated with different concentrations of albiflorin (0, 25, 50, 100 µg/mL; HY-N0037, Purity: 98.67%, MedChemExpress) or propofol (0, 30, 60, 120 µM) individually, or with a combination of 100 µg/mL albiflorin and 120 µM propofol. The control group received an equal volume of drug-free medium. Treatment durations were set at 24, 48, and 72 h. After treatment, cells were harvested for subsequent experiments.
Cell proliferation assay
Cell proliferation was assessed using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell proliferation and cytotoxicity assay kit (Beyotime, China). Briefly, Huh-7 cells were seeded into 96-well plates at a density of 1×104 cells/well and subjected to the indicated treatments. Following treatment, 10 µL of MTT solution (5 mg/mL) was added to each well, and the cells were incubated at 37 ℃ for 4 h. The supernatant was then removed, and 100 µL of formazan dissolution solution was added to each well. After mixing, the plates were incubated until the formazan crystals were completely dissolved. Absorbance was measured at 570 nm using a microplate reader, and cell viability was calculated accordingly.
Cell apoptosis assay
Apoptosis was evaluated using an Annexin V-FITC/PI apoptosis detection kit [40302ES50, Yeasen Biotechnology (Shanghai) Co., Ltd.] according to the manufacturer’s instructions. Briefly, treated Huh-7 cells were collected and resuspended in 100 µL of 1× Binding Buffer. Subsequently, 5 µL of Annexin V-FITC and 10 µL of propidium iodide (PI) staining solution were added sequentially and gently mixed. The cells were incubated at room temperature in the dark for 15 min. After incubation, 400 µL of 1× Binding Buffer was added and mixed gently. The samples were placed on ice and analyzed for apoptosis by flow cytometry within 1 h.
Migration and invasion assay
Cell migration and invasion were evaluated using the Transwell assay. For the invasion assay, Matrigel (354248, Corning) was coated on the upper chamber of Transwell inserts (8 µm pore size, Corning, USA) and incubated at 37 ℃ to form a simulated basement membrane. Treated Huh-7 cells were resuspended in serum-free DMEM and adjusted to a concentration of 5×104 cells per well before seeding into the upper chamber. For the migration assay, cells were similarly resuspended to the same concentration and seeded into the upper chamber without Matrigel coating. In both assays, the lower chamber was filled with 600 µL of DMEM containing 10% FBS. After incubation at 37 ℃ with 5% CO2 for 24 h, non-migrated or non-invaded cells on the upper surface of the membrane were removed. Cells that had migrated or invaded the lower surface were fixed with 4% paraformaldehyde for 10 min and stained with 0.1% crystal violet for 20 min. Five random fields were selected, and the number of migrated or invaded cells was counted under a light microscope to calculate the average.
Western blotting assay
Total protein was extracted from treated Huh-7 cells using Radio Immunoprecipitation Assay (RIPA) lysis buffer (P0013B, Beyotime, China) supplemented with protease and phosphatase inhibitors (Roche). The lysates were incubated on ice for 30 min and centrifuged at 12,000 g for 15 min at 4 ℃. The supernatant was collected, and protein concentrations were determined using a BCA protein assay kit (P0010S, Beyotime, China). Equal amounts of protein (20 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, USA). The membranes were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4 ℃ with primary antibodies, including B-cell lymphoma-2 (Bcl-2, 12789-1-AP, 1:2,000, Proteintech), Bcl2-associated X (Bax, 50599-2-Ig, 1:2,000, Proteintech), Wnt3a (26744-1-AP, 1:2,000, Proteintech), β-catenin (51067-2-AP, 1:5,000, Proteintech), E-cadherin (14472, 1:1,000, CST), N-cadherin (14215, 1:1,000, CST), cyclin D1 (60186-1-Ig, 1:5,000, Proteintech), c-Myc (13987T, 1:2,000, CST), and GAPDH (60004-1-Ig, 1:50,000, Proteintech). The following day, membranes were washed three times with Tris-Borate-Sodium Tween-20 (TBST) and incubated with HRP-conjugated secondary antibodies (7076/7074, 1:1,000, CST) for 1 h at room temperature. After another three washes with TBST, protein bands were visualized using an enhanced chemiluminescence (ECL) detection kit (P2300, New Cell & Molecular Biotech Co., Ltd.). Images were captured using a gel imaging system (Bio-Rad, USA), and band intensities were quantified using ImageJ software.
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted using the TRIpure Total RNA Extraction Reagent (YFXM0011P, YI FEI XUE Biotechnology) according to the manufacturer’s instructions. The complementary DNA (cDNA) was synthesized using the HiScript III RT SuperMix for qPCR (R323, Vazyme). RT-qPCR was performed using the ChamQ Universal SYBR qPCR Master Mix (Q711, Vazyme) on a QuantStudio 6 Flex Real-Time PCR System (Life Technologies). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference gene, and the relative expression levels of target genes were calculated using the 2−ΔΔCt method. All experiments were conducted in triplicate. Primer sequences for the target genes are listed in Table 1.
Table 1. The RT-qPCR primer sequences.
| Name | Sequences (5'-3') |
|---|---|
| Homo GAPDH | |
| Sense | AGGTCGGAGTCAACGGATTT |
| Antisense | TGACGGTGCCATGGAATTTG |
| Homo Wnt3a | |
| Sense | ggacaaagctaccagggagt |
| Antisense | accatcccaccaaactcgat |
| Homo β-catenin | |
| Sense | cttacacccaccatcccact |
| Antisense | cctccacaaattgctgctgt |
| Homo cyclin D1 | |
| Sense | TCGTGGCCTCTAAGATGAAGG |
| Antisense | CACAGAGGGCAACGAAGGTC |
| Homo c-Myc | |
| Sense | CCCTCCACTCGGAAGGACTAT |
| Antisense | TGGACGGACAGGATGTATGCT |
RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
Statistical analysis
Statistical analyses were conducted using SPSS 22.0 software (IBM Corp., Armonk, NY, USA). The Shapiro-Wilk test was used to check the normality of the data, and the results indicated that the data followed a normal distribution, suggesting that the variables were parametric. Comparisons between two groups were performed using Student’s t-test, while differences among multiple groups were assessed by one-way analysis of variance (ANOVA), followed by Tukey’s post hoc test. P value <0.05 was considered statistically significant. All experiments were independently repeated at least three times, and data were presented as the mean ± standard deviation (mean ± SD).
Results
Albiflorin inhibits the proliferation of Huh-7 cells
We first evaluated the toxic effects of albiflorin and propofol on non-tumorigenic hepatocyte line LO2 cells, and the results showed that both albiflorin and propofol had no toxic side effects on LO2 cells (Figure S1). To investigate the effect of albiflorin on the proliferation of HCC cells, Huh-7 cells were treated with different concentrations of albiflorin (0, 25, 50, and 100 µg/mL), and cell viability was assessed using the MTT assay at 24, 48, and 72 h. The results showed that albiflorin significantly inhibited the proliferation of Huh-7 cells, with the inhibitory effect increasing with higher drug concentrations (Figure 1A). These findings indicated that albiflorin effectively suppresses the proliferation of HCC cells in a dose- and time-dependent manner.
Figure 1.
Effects of albiflorin on the proliferation and apoptosis of Huh-7 cells. (A) Cell viability of Huh-7 cells treated with different concentrations of albiflorin (0, 25, 50, 100 μg/mL) for 24, 48, and 72 h. (B,C) Flow cytometry assessed the apoptosis rates of Huh-7 cells treated with different concentrations of albiflorin for 48 h. (D-F) Western blot determined the protein expression levels of pro-apoptotic Bax and anti-apoptotic Bcl-2. * P<0.05, ** P<0.01, *** P<0.001 vs. control group. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Albiflorin promotes apoptosis in Huh-7 cells
To further investigate the effect of albiflorin on apoptosis in HCC cells, Huh-7 cells were treated with different concentrations of albiflorin (0, 25, 50, and 100 µg/mL) for 48 h. Apoptosis rates were assessed using flow cytometry analysis. The results showed that albiflorin significantly promoted apoptosis in Huh-7 cells, with the apoptosis rate increasing progressively with higher drug concentrations (Figure 1B,1C). In addition, western blotting was performed to detect the expression of apoptosis-related proteins Bax and Bcl-2. Albiflorin treatment led to upregulation of the pro-apoptotic protein Bax and downregulation of the anti-apoptotic protein Bcl-2 in a dose-dependent manner (Figure 1D-1F). These findings suggested that albiflorin effectively induces apoptosis in HCC cells in a dose-dependent manner.
Albiflorin inhibits the migration, invasion, and epithelial-mesenchymal transition (EMT) of Huh-7 cells
Transwell assays were conducted to evaluate the effects of albiflorin on the migration and invasion abilities of HCC cells. Huh-7 cells were treated with different concentrations of albiflorin (0, 25, 50, and 100 µg/mL) for 48 h. Both migration and invasion capacities were significantly reduced following treatment. Compared with the control group, the number of migrating and invading cells decreased markedly in the albiflorin-treated groups, and the inhibitory effect was dose-dependent (Figure 2A-2C). As shown in Figure 2D-2F, albiflorin dose-dependently reduced N-cadherin protein expression while enhanced E-cadherin protein level in Huh-7 cells. Notably, the 100 µg/mL group exhibited the most pronounced suppression. These results indicate that albiflorin effectively inhibits the migration, invasion, and EMT of HCC cells, with the inhibitory effects increasing with higher doses.
Figure 2.
Albiflorin inhibits migration, invasion, and EMT of Huh-7 cells. (A,B) Transwell assay showing migration ability of Huh-7 cells treated with different concentrations of albiflorin for 48 h, and cells were stained with 0.1% crystal violet; (A,C) Transwell assay showing invasion ability of Huh-7 cells treated with different concentrations of albiflorin for 48 h, and cells were stained with 0.1% crystal violet; (D-F) western blot analysis of N-cadherin and E-cadherin in Huh-7 cells. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001 vs. control group. EMT, epithelial-mesenchymal transition; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Albiflorin suppresses the activity of the Wnt/β-catenin signaling pathway in Huh-7 cells
Previous studies have shown that the Wnt/β-catenin signaling pathway plays a critical role in regulating the proliferation, migration, and invasion of HCC cells (22,23). To further explore the potential mechanism by which albiflorin inhibits the malignant behavior of HCC cells, we examined the expression levels of key molecules in the Wnt/β-catenin pathway. Huh-7 cells were treated with varying concentrations of albiflorin (0, 25, 50, and 100 µg/mL) for 48 h. Western blotting results demonstrated that the protein expression levels of Wnt3a and β-catenin progressively decreased with increasing concentrations of albiflorin (Figure 3A-3C). RT-qPCR analysis further confirmed that the messenger RNA (mRNA) levels of Wnt3a and β-catenin were also downregulated in a dose-dependent manner (Figure 3D,3E). As expected, the protein and mRNA expression levels of cyclin D1 and c-Myc, downstream factors of the Wnt/β-catenin signaling pathway, significantly decreased with increasing concentrations of albiflorin (Figure 3F-3J). These findings suggest that albiflorin negatively regulates the Wnt/β-catenin pathway by downregulating Wnt3a and β-catenin expression, thereby inhibiting the malignant biological behavior of HCC cells.
Figure 3.
Albiflorin inhibits the activity of the Wnt/β-catenin signaling pathway in Huh-7 cells. (A-C) The protein levels of Wnt3a and β-catenin in Huh-7 cells treated with different concentrations of albiflorin were examined using western blotting. (D,E) The mRNA levels of β-catenin and Wnt3a in Huh-7 cells treated with different concentrations of albiflorin were examined using RT-qPCR. (F-H) The protein levels of cyclin D1 and c-Myc in Huh-7 cells treated with different concentrations of albiflorin were examined using western blotting. (I,J) The mRNA levels of cyclin D1 and c-Myc in Huh-7 cells treated with different concentrations of albiflorin were examined using RT-qPCR. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001 vs. control group. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; mRNA, messenger RNA; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
Combined treatment with albiflorin and propofol inhibits the malignant biological behaviors of Huh-7 cells
A previous study has revealed that Propofol exhibits antitumor activity in HCC, inhibiting the proliferation, migration, and invasion of HCC cells by downregulating the expression of Twist1 (24). To evaluate the potential synergistic effects of albiflorin combined with propofol in HCC cells, Huh-7 cells were treated with varying concentrations of propofol (0, 30, 60, and 120 µM) alone or in combination with albiflorin (100 µg/mL) for 48 h. Cell proliferation, apoptosis, migration, invasion, and Wnt/β-catenin signaling activity were then assessed.
MTT assays showed that propofol alone inhibited Huh-7 cell proliferation in a dose-dependent manner, while the combined treatment group exhibited significantly lower cell viability at 24, 48, and 72 h compared to the corresponding propofol-only groups, with the inhibitory effects increasing over time (Figure 4A). Flow cytometry analysis demonstrated that propofol increased the apoptosis rate of Huh-7 cells in a dose-dependent manner (Figure 4B,4C). Notably, combined treatment further enhanced apoptosis rates compared to propofol alone (Figure 4B,4C). Western blotting revealed that the combined treatment markedly upregulated the pro-apoptotic protein Bax and downregulated the anti-apoptotic protein Bcl-2, with changes more pronounced than those observed in the single-agent groups (Figure 4D-4F).
Figure 4.
Combined effects of albiflorin and propofol on the proliferation and apoptosis of Huh-7 cells. (A) Cell viability detected by MTT assay after treatment with propofol alone or in combination with albiflorin for 48 h; (B,C) apoptosis rate assessed by flow cytometry; (D-F) protein expression levels of Bax and Bcl-2 determined by western blot. * P<0.05, *** P<0.001, **** P<0.0001 vs. control group; ## P<0.01, #### P<0.0001 vs. 120 μM propofol treatment group. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.
Additionally, Transwell assays indicated that propofol inhibited Huh-7 cell migration and invasion in a dose-dependent manner, while the combined treatment further significantly reduced both migration and invasion capacities compared to propofol alone (Figure 5A-5C). Propofol inhibited N-cadherin protein expression and increased E-cadherin protein level in Huh-7 cells in a dose-dependent manner, while the combined treatment further promoted these effects compared to propofol alone (Figure 5D-5F). Western blotting and RT-qPCR analyses showed that propofol reduced the protein and mRNA expression levels of Wnt3a, β-catenin, cyclin D1, and c-Myc in Huh-7 cells (Figure 6A-6J). The combined treatment led to further downregulation of Wnt3a, β-catenin, cyclin D1, and c-Myc expression, with suppression markedly greater than that of either agent alone (Figure 6A-6J).
Figure 5.
Combined effects of albiflorin and propofol on the migration, invasion, and EMT of Huh-7 cells. Huh-7 cells were treated with propofol alone or in combination with albiflorin for 48 h. (A,B) Cell migration ability was evaluated by Transwell assay, and cells were stained with 0.1% crystal violet; (A,C) cell invasion ability was evaluated by Transwell assay, and cells were stained with 0.1% crystal violet; (D-F) western blot analysis of N-cadherin and E-cadherin in Huh-7 cells. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001 vs. control group; # P<0.05, ## P<0.01, #### P<0.0001 vs. 120 μM propofol treatment group. EMT, epithelial-mesenchymal transition; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Figure 6.
Combined effects of albiflorin and propofol on the Wnt/β-catenin signaling pathway of Huh-7 cells. Huh-7 cells were treated with propofol alone or in combination with albiflorin for 48 h. (A-C) The protein levels of Wnt3a and β-catenin in Huh-7 cells treated with different concentrations of albiflorin were examined using western blotting; (D,E) the mRNA levels of β-catenin and Wnt3a in Huh-7 cells treated with different concentrations of albiflorin were examined using RT-qPCR; (F-H) the protein levels of cyclin D1 and c-Myc in Huh-7 cells were examined using western blotting; (I,J) the mRNA levels of cyclin D1 and c-Myc in Huh-7 cells were examined using RT-qPCR. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001 vs. control group; # P<0.05, ## P<0.01, ### P<0.001, #### P<0.0001 vs. 120 μM propofol treatment group. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; mRNA, messenger RNA; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
These results suggested that albiflorin and propofol exert synergistic effects in inhibiting HCC cell proliferation, promoting apoptosis, and suppressing migration, invasion, and EMT, potentially through the cooperative inhibition of the Wnt/β-catenin signaling pathway.
Discussion
HCC is a highly heterogeneous primary malignancy characterized by uncontrolled cell proliferation and enhanced invasive and metastatic potential (25,26). Aberrant cell proliferation and apoptosis dysregulation are key events in the initiation and progression of HCC, yet the underlying signaling mechanisms remain incompletely understood. Currently, effective therapeutic options for advanced HCC are limited, and most patients tend to develop resistance to existing targeted therapies (27). Therefore, the development of safe, effective, and mechanistically clear multi-targeted combination strategies is urgently needed to improve the prognosis of HCC.
Albiflorin, one of the major active constituents of Paeonia lactiflora, possesses notable pharmacological properties, including anti-inflammatory, antioxidant, and antitumor activities (28,29). Previous studies have shown that albiflorin exhibits significant protective effects and multi-pathway regulatory capacity in various disease models (9,10,30). Albiflorin can inhibit osteoclastogenesis and alleviate titanium particle-induced osteolysis by suppressing reactive oxygen species accumulation and the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signaling pathway (30). In addition, in central nervous system injury, albiflorin alleviates neuroinflammation in middle cerebral artery occlusion model rats by activating the phosphoglycerate kinase 1 (PGK1)/nuclear factor erythroid 2-related factor 2(Nrf2)/heme oxygenase-1 (HO-1) signaling pathway (31). Yu et al. demonstrated that albiflorin can effectively alleviate mesangial proliferative glomerulonephritis by inhibiting the PI3K/AKT/NF-kappaB (NF-κB) signaling pathway, thereby suppressing abnormal cell proliferation, inflammatory responses, and fibrosis (32). Propofol, a widely used intravenous anesthetic in clinical practice, has also been found to exhibit antitumor potential beyond its sedative effects (15,33). Previous reports have shown that propofol can inhibit tumor cell invasion and metastasis by downregulating factors such as Twist1, vascular endothelial growth factor (VEGF), and matrix metalloproteinase-9 (MMP9), and it can modulate cancer cell metabolism and oxidative stress (14,24,34,35). However, the combined effect of albiflorin and propofol in HCC has not yet been elucidated.
In this study, Huh-7 HCC cell model was established and treated with varying concentrations of albiflorin and propofol, either alone or in combination. The results showed that albiflorin significantly inhibited cell viability, suggesting a potent antiproliferative effect. Propofol also effectively induced apoptosis and suppressed the migration and invasion of HCC cells, and its inhibitory effects were further enhanced when combined with albiflorin. Additionally, we observed that the combination of albiflorin and propofol markedly downregulated the expression of the anti-apoptotic protein Bcl-2 while upregulating the pro-apoptotic protein Bax, indicating a synergistic effect of the two agents in promoting apoptosis.
The Wnt/β-catenin signaling pathway is a critical regulator of cellular stemness, proliferation, differentiation, and migration, and is considered a key driver of malignant phenotypes in various cancers (20,36,37). Previous studies have shown that activation of the Wnt pathway is closely associated with the maintenance of stemness in HCC cells, initiation of EMT, immune evasion, and resistance to targeted therapies (23,38,39). In the present study, albiflorin and propofol were found to reduce the expression levels of Wnt3a and β-catenin, with the combined treatment exhibiting a more pronounced inhibitory effect. These findings suggest that albiflorin and propofol may jointly suppress malignant behaviors of HCC cells through synergistic inhibition of the Wnt/β-catenin signaling pathway. Moreover, activation of the Wnt signaling pathway can upregulate transcription factors such as Snail and Twist, thereby inducing EMT and enhancing the migratory and invasive capabilities of tumor cells (39-41). In our study, the combination treatment significantly reduced the number of transmembrane cells and invasive potential, inhibited EMT, further supporting its efficacy in inhibiting metastatic behavior. Notably, a previous study has reported that propofol also plays a beneficial role in modulating the tumor microenvironment, improving immune status, and enhancing sensitivity to radiotherapy and chemotherapy (42). Therefore, combination with natural compounds like albiflorin may enhance therapeutic efficacy while reducing toxicity, providing a novel strategy for multi-targeted treatment of HCC. Moreover, our study suggested that albiflorin and propofol might be combined with existing systemic therapies such as sorafenib, lenvatinib, or immune checkpoint inhibitors for HCC treatment. Given that the Wnt/β-catenin pathway is involved in treatment resistance and immune evasion (43,44), there is a rationale for exploring these combinations as a means to overcome current therapeutic limitations. Biomarkers such as alpha-fetoprotein and des-γ-carboxy prothrombin are widely used for the detection and monitoring of HCC (45). Future studies could investigate whether albiflorin and propofol influence these biomarkers and whether biomarker changes could be used to monitor treatment response. This would align our study with algorithm-based patient management strategies (46) that combine imaging, serologic testing, and molecular profiling to guide individualized therapy.
Despite the scientific relevance of this study, several limitations should be noted. First, we conducted this study using only a single cell line. Validation in additional HCC cell lines such as HepG2, SMMC-7721, or MHCC97H would make our study more convincing. Second, the findings are based primarily on in vitro experiments, and further validation using animal models or patient-derived tumor tissues is lacking. Another limitation is the exclusive use of short-term functional assays for proliferation, apoptosis, migration, and invasion. Incorporating colony formation assays, soft agar anchorage-independent growth, or tumorsphere formation would allow evaluation of whether albiflorin and propofol combinations exert sustained effects on tumor growth and whether they affect cancer stem cell-like properties. Additionally, the potential involvement of other signaling pathways, such as PI3K/AKT, JAK/STAT, MAPK, and TGF-β, in mediating the synergistic effects of albiflorin and propofol should be systematically explored through integrative multi-omics approaches.
Conclusions
This study is the first to demonstrate that the combination of albiflorin and propofol effectively inhibits HCC cell proliferation, migration, invasion, and EMT, and promotes apoptosis, likely through synergistic suppression of the Wnt/β-catenin signaling pathway. These findings provide experimental evidence supporting the combined use of natural compounds and anesthetics in HCC therapy and lay the groundwork for developing multi-targeted precision treatment strategies.
Supplementary
The article’s supplementary files as
Acknowledgments
None.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Footnotes
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1246/rc
Funding: None.
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1246/coif). The authors have no conflicts of interest to declare.
Data Sharing Statement
Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1246/dss
References
- 1.Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 2021;71:209-49. 10.3322/caac.21660 [DOI] [PubMed] [Google Scholar]
- 2.Llovet JM, Pinyol R, Kelley RK, et al. Molecular pathogenesis and systemic therapies for hepatocellular carcinoma. Nat Cancer 2022;3:386-401. 10.1038/s43018-022-00357-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Wang J, Qiu K, Zhou S, et al. Risk factors for hepatocellular carcinoma: an umbrella review of systematic review and meta-analysis. Ann Med 2025;57:2455539. 10.1080/07853890.2025.2455539 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Vogel A, Martinelli E, ESMO Guidelines Committee . Updated treatment recommendations for hepatocellular carcinoma (HCC) from the ESMO Clinical Practice Guidelines. Ann Oncol 2021;32:801-5. 10.1016/j.annonc.2021.02.014 [DOI] [PubMed] [Google Scholar]
- 5.Xie Q, Zhang P, Wang Y, et al. Overcoming resistance to immune checkpoint inhibitors in hepatocellular carcinoma: Challenges and opportunities. Front Oncol 2022;12:958720. 10.3389/fonc.2022.958720 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ma W, Ren H, Meng X, et al. A review of the ethnopharmacology, phytochemistry, pharmacology, pharmacokinetics and quality control of Paeonia lactiflora Pall. J Ethnopharmacol 2024;335:118616. 10.1016/j.jep.2024.118616 [DOI] [PubMed] [Google Scholar]
- 7.Wang X, Li N, Li Y, et al. A novel polysaccharide from Paeonia lactiflora exerts anti-tumor activity via immunoregulation. Arabian Journal of Chemistry 2022;15:104132. [Google Scholar]
- 8.Bae T, Jang J, Lee H, et al. Paeonia lactiflora root extract suppresses cancer cachexia by down-regulating muscular NF-κB signalling and muscle-specific E3 ubiquitin ligases in cancer-bearing mice. J Ethnopharmacol 2020;246:112222. 10.1016/j.jep.2019.112222 [DOI] [PubMed] [Google Scholar]
- 9.Gao Y, Chen Y, Wang N, et al. Albiflorin ameliorates neuroinflammation and exerts neuroprotective effects in Parkinson's disease models. Immunopharmacol Immunotoxicol 2025;47:201-12. 10.1080/08923973.2025.2457960 [DOI] [PubMed] [Google Scholar]
- 10.Xu YJ, Mei Y, Shi XQ, et al. Albiflorin ameliorates memory deficits in APP/PS1 transgenic mice via ameliorating mitochondrial dysfunction. Brain Res 2019;1719:113-23. 10.1016/j.brainres.2019.05.037 [DOI] [PubMed] [Google Scholar]
- 11.Feng Z, Chan YT, Lu Y, et al. Siwu decoction suppress myeloid-derived suppressor cells through tumour cells necroptosis to inhibit hepatocellular carcinoma. Phytomedicine 2024;133:155913. 10.1016/j.phymed.2024.155913 [DOI] [PubMed] [Google Scholar]
- 12.Sheng Y, Li L, Wang C, et al. Solid-phase extraction-liquid chromatographic method for the determination and pharmacokinetic studies of albiflorin and paeoniflorin in rat serum after oral administration of Si-Wu decoction. J Chromatogr B Analyt Technol Biomed Life Sci 2004;806:127-32. 10.1016/j.jchromb.2004.03.041 [DOI] [PubMed] [Google Scholar]
- 13.Short CE, Bufalari A. Propofol anesthesia. Vet Clin North Am Small Anim Pract 1999;29:747-78. 10.1016/s0195-5616(99)50059-4 [DOI] [PubMed] [Google Scholar]
- 14.Wu J, Zhou F, Lai S, et al. Propofol Inhibits Biological Function of Hepatocellular Carcinoma Cells through LINC00475-Mediated Sonic Hedgehog Pathway. Pharmacology 2023;108:127-37. 10.1159/000527200 [DOI] [PubMed] [Google Scholar]
- 15.Xu Y, Pan S, Jiang W, et al. Effects of propofol on the development of cancer in humans. Cell Prolif 2020;53:e12867. 10.1111/cpr.12867 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Klaus A, Birchmeier W. Wnt signalling and its impact on development and cancer. Nat Rev Cancer 2008;8:387-98. 10.1038/nrc2389 [DOI] [PubMed] [Google Scholar]
- 17.Zucman-Rossi J, Villanueva A, Nault JC, et al. Genetic Landscape and Biomarkers of Hepatocellular Carcinoma. Gastroenterology 2015;149:1226-1239.e4. 10.1053/j.gastro.2015.05.061 [DOI] [PubMed] [Google Scholar]
- 18.Lachenmayer A, Alsinet C, Savic R, et al. Wnt-pathway activation in two molecular classes of hepatocellular carcinoma and experimental modulation by sorafenib. Clin Cancer Res 2012;18:4997-5007. 10.1158/1078-0432.CCR-11-2322 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Vilchez V, Turcios L, Marti F, et al. Targeting Wnt/β-catenin pathway in hepatocellular carcinoma treatment. World J Gastroenterol 2016;22:823-32. 10.3748/wjg.v22.i2.823 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Luke JJ, Bao R, Sweis RF, et al. WNT/β-catenin Pathway Activation Correlates with Immune Exclusion across Human Cancers. Clin Cancer Res 2019;25:3074-83. 10.1158/1078-0432.CCR-18-1942 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wang Y, Zheng L, Shang W, et al. Wnt/beta-catenin signaling confers ferroptosis resistance by targeting GPX4 in gastric cancer. Cell Death Differ 2022;29:2190-202. 10.1038/s41418-022-01008-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lei C, Wang Q, Tang N, et al. GSTZ1-1 downregulates Wnt/β-catenin signalling in hepatocellular carcinoma cells. FEBS Open Bio 2020;10:6-17. 10.1002/2211-5463.12769 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Huang G, Liang M, Liu H, et al. CircRNA hsa_circRNA_104348 promotes hepatocellular carcinoma progression through modulating miR-187-3p/RTKN2 axis and activating Wnt/β-catenin pathway. Cell Death Dis 2020;11:1065. 10.1038/s41419-020-03276-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zheng H, Fu Y, Yang T. Propofol inhibits proliferation, migration, and invasion of hepatocellular carcinoma cells by downregulating Twist. J Cell Biochem 2019;120:12803-9. 10.1002/jcb.28551 [DOI] [PubMed] [Google Scholar]
- 25.Befeler AS, Di Bisceglie AM. Hepatocellular carcinoma: diagnosis and treatment. Gastroenterology 2002;122:1609-19. 10.1053/gast.2002.33411 [DOI] [PubMed] [Google Scholar]
- 26.Llovet JM, Montal R, Sia D, et al. Molecular therapies and precision medicine for hepatocellular carcinoma. Nat Rev Clin Oncol 2018;15:599-616. 10.1038/s41571-018-0073-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.El-Serag HB, Marrero JA, Rudolph L, et al. Diagnosis and treatment of hepatocellular carcinoma. Gastroenterology 2008;134:1752-63. 10.1053/j.gastro.2008.02.090 [DOI] [PubMed] [Google Scholar]
- 28.Sun S, Jimu RB, Lema AK, et al. A systematic review on the origin, anti-inflammatory effect, mechanism, pharmacokinetics, and toxicity of albiflorin. Arabian Journal of Chemistry 2024;17:105836. [Google Scholar]
- 29.Zhang L, Xu J, Yin S, et al. Albiflorin attenuates neuroinflammation and improves functional recovery Albiflorinter spinal cord injury through regulating LSD1-mediated microglial activation and ferroptosis. Inflammation 2024;47:1313-27. 10.1007/s10753-024-01978-8 [DOI] [PubMed] [Google Scholar]
- 30.Wang Q, Tao H, Wang H, et al. Albiflorin inhibits osteoclastogenesis and titanium particles-induced osteolysis via inhibition of ROS accumulation and the PI3K/AKT signaling pathway. Int Immunopharmacol 2024;142:113245. 10.1016/j.intimp.2024.113245 [DOI] [PubMed] [Google Scholar]
- 31.Ou Z, Li P, Wu L, et al. Albiflorin alleviates neuroinflammation of rats after MCAO via PGK1/Nrf2/HO-1 signaling pathway. Int Immunopharmacol 2024;137:112439. 10.1016/j.intimp.2024.112439 [DOI] [PubMed] [Google Scholar]
- 32.Yu H, Wang Y, He Z, et al. Albiflorin ameliorates mesangial proliferative glomerulonephritis by PI3K/AKT/NF-κB pathway. Hum Exp Toxicol 2023;42:9603271221145386. 10.1177/09603271221145386 [DOI] [PubMed] [Google Scholar]
- 33.Jiang S, Liu Y, Huang L, et al. Effects of propofol on cancer development and chemotherapy: Potential mechanisms. Eur J Pharmacol 2018;831:46-51. 10.1016/j.ejphar.2018.04.009 [DOI] [PubMed] [Google Scholar]
- 34.Wang Z, Cao B, Ji P, et al. Propofol inhibits tumor angiogenesis through targeting VEGF/VEGFR and mTOR/eIF4E signaling. Biochem Biophys Res Commun 2021;555:13-8. 10.1016/j.bbrc.2021.03.094 [DOI] [PubMed] [Google Scholar]
- 35.Zhang J, Zhang D, Wu GQ, et al. Propofol inhibits the adhesion of hepatocellular carcinoma cells by upregulating microRNA-199a and downregulating MMP-9 expression. Hepatobiliary Pancreat Dis Int 2013;12:305-9. 10.1016/s1499-3872(13)60048-x [DOI] [PubMed] [Google Scholar]
- 36.Zhang Y, Wang X. Targeting the Wnt/β-catenin signaling pathway in cancer. J Hematol Oncol 2020;13:165. 10.1186/s13045-020-00990-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.He S, Tang S. WNT/β-catenin signaling in the development of liver cancers. Biomed Pharmacother 2020;132:110851. 10.1016/j.biopha.2020.110851 [DOI] [PubMed] [Google Scholar]
- 38.Khalaf AM, Fuentes D, Morshid AI, et al. Role of Wnt/β-catenin signaling in hepatocellular carcinoma, pathogenesis, and clinical significance. J Hepatocell Carcinoma 2018;5:61-73. 10.2147/JHC.S156701 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Zhang Q, Bai X, Chen W, et al. Wnt/β-catenin signaling enhances hypoxia-induced epithelial-mesenchymal transition in hepatocellular carcinoma via crosstalk with hif-1α signaling. Carcinogenesis 2013;34:962-73. 10.1093/carcin/bgt027 [DOI] [PubMed] [Google Scholar]
- 40.Mahmood MQ, Walters EH, Shukla SD, et al. β-catenin, Twist and Snail: Transcriptional regulation of EMT in smokers and COPD, and relation to airflow obstruction. Sci Rep 2017;7:10832. 10.1038/s41598-017-11375-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Yang Y, Zhang N, Zhu J, et al. Downregulated connexin32 promotes EMT through the Wnt/β-catenin pathway by targeting Snail expression in hepatocellular carcinoma. Int J Oncol 2017;50:1977-88. 10.3892/ijo.2017.3985 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Zhao W, Yun K. Propofol enhances the sensitivity of glioblastoma cells to temozolomide by inhibiting macrophage activation in tumor microenvironment to down-regulate HIF-1α expression. Exp Cell Res 2022;418:113277. 10.1016/j.yexcr.2022.113277 [DOI] [PubMed] [Google Scholar]
- 43.Huang Y, Peng M, Yu W, et al. Activation of Wnt/β-catenin signaling promotes immune evasion via the β-catenin/IKZF1/CCL5 axis in hepatocellular carcinoma. Int Immunopharmacol 2024;138:112534. 10.1016/j.intimp.2024.112534 [DOI] [PubMed] [Google Scholar]
- 44.Samant C, Kale R, Pai KSR, et al. Role of Wnt/β-catenin pathway in cancer drug resistance: Insights into molecular aspects of major solid tumors. Biochem Biophys Res Commun 2024;729:150348. Erratum in: Biochem Biophys Res Commun 2025;778:152424. 10.1016/j.bbrc.2024.150348 [DOI] [PubMed] [Google Scholar]
- 45.Attia AM, Rezaee-Zavareh MS, Hwang SY, et al. Novel Biomarkers for Early Detection of Hepatocellular Carcinoma. Diagnostics (Basel) 2024;14:2278. 10.3390/diagnostics14202278 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Shahini E, Pasculli G, Solimando AG, et al. Updating the Clinical Application of Blood Biomarkers and Their Algorithms in the Diagnosis and Surveillance of Hepatocellular Carcinoma: A Critical Review. Int J Mol Sci 2023;24:4286. 10.3390/ijms24054286 [DOI] [PMC free article] [PubMed] [Google Scholar]






