ABSTRACT
The typical pathology of pulmonary hypertension (PH) is characterized by pulmonary vasoconstriction and irreversible pulmonary vascular remodeling. Vascular remodeling is the process of structural changes and cellular rearrangement of blood vessels due to injury and is a significant factor in conditions such as PH. Echinacoside (ECH) is a phenylethanol glycoside from Tibetan herbs, and our previous study found that ECH modulated calcium channels on pulmonary artery smooth muscle cells (PASMCs) and improved pulmonary vasoconstriction. To investigate the role of ECH in improving pulmonary vascular remodeling in PH, we constructed hypoxia‐induced hypoxic pulmonary hypertension (HPH) and MCT‐induced pulmonary arterial hypertension (PAH) models. Transcriptomic analysis revealed significant enrichment of Cav1.2, Cav3.2, and PKC/MAPK signaling pathways in PAH rats. ECH effectively inhibited Cav1.2 and Cav3.2 protein and mRNA expression, as well as the phosphorylation levels of PKC/MAPK, in HPH and PAH. In addition, ECH effectively reduced mean pulmonary artery pressure (mPAP) and right ventricular hypertrophy index (RVHI) and improved pulmonary vascular remodeling in HPH and PAH rats. In short, we found that ECH improved pulmonary vascular remodeling by modulating Cav1.2 and Cav3.2/PKC/MAPK pathways. Furthermore, this improvement was effective in both HPH and PAH.
Keywords: echinacoside, monocrotaline, PKC/MAPK pathway, pulmonary hypertension, voltage‐gated calcium channels
Abbreviations
- Akt
protein kinase B
- CaM
calmodulin
- Cav1.2
abstract voltage‐dependent l‐type Ca2+ channels
- Cav3.2
abstract voltage‐dependent T‐type Ca2+ channels
- DEGs
differentially expressed genes
- DNB
DNA nanoballs
- ECH
echinacoside
- EndMT
endothelial‐mesenchymal transition
- ER
endoplasmic reticulum
- ERK1/2
extracellular regulated protein kinases1/2
- FC
fold change
- FDR
false discovery rate
- GDP
guanosine diphosphate
- GTP
guanosine triphosphate
- HPH
hypoxic pulmonary hypertension
- Il‐1β
Interleukin‐1β
- Il‐6
Interleukin‐6
- LA
lumen area
- LTCCs
l‐type calcium channels
- MCT
monocrotaline
- MEK
mitogen‐activated extracellular signal‐regulated kinase
- mPAP
mean pulmonary artery pressure
- mTOR
mechanistic target of rapamycin
- NE
norepinephrine
- NF‐κB
nuclear factor κB
- P38MAPK
P38 mitogen‐activated protein kinases
- PAH
pulmonary arterial hypertension
- PASMC
pulmonary artery smooth muscle cell
- PH
pulmonary hypertension
- PI3K
phosphatidylinositol 3‐kinase
- PKC
protein kinase C
- RELM‐β
resistin‐like molecule β
- RER
rough endoplasmic reticulum
- RT‐qPCR
real‐time quantitative PCR
- RVHI
right ventricular hypertrophy index
- STAT3
signal transducer and activator of transcription 3
- TEM
transmission electron microscopy
- TNF‐α
tumour necrosis factor‐alpha
- TRPC1
transient receptor potential cation channel subfamily C member 1
- TRPC4
transient receptor potential cation channel subfamily C member 4
- TRPC6
transient receptor potential cation channel subfamily C member 6
- TTCCs
T‐type calcium channels
- VGCC
voltage‐gated calcium channels
- WA
wall area
- WT
wall thickness
1. Introduction
Pulmonary hypertension (PH) is a serious cardiovascular condition characterized by an abnormal increase in blood pressure ≥ 20 mmHg, as measured by a right cardiac catheter to monitor the resting mean pulmonary artery pressure (mPAP) [1]. PAH is the first clinical category characterized by a progressive pulmonary vascular dysfunction, encompassing endothelial injury, vasoconstriction, and remodeling. This results in right ventricular overload, increased pressure in the pulmonary artery and vascular resistance, finally leading to right heart failure, which is a significant contributor to patient mortality. HPH is the third category arising from a chronic exposure to a hypoxic environment. Sustained hypoxia triggers pulmonary artery vasoconstriction and pulmonary artery smooth muscle cell (PASMC) proliferation, leading to right ventricular hypertrophy and vascular remodeling. This results in right heart failure, which is a life‐threatening complication. Several therapeutic agents that improve hemodynamics through vasodilatation have recently been used in clinical practice and have significantly improved 5‐year survival in patients with PH [2]. However, improving pulmonary vascular remodeling remains a significant challenge.
Voltage‐gated calcium channels are transmembrane proteins that are activated during cell membrane depolarization and mediate the inward flow of calcium (Ca2+) [3, 4, 5]. Calcium channels are further divided into six subtypes based on their conductivity and voltage sensitivity: L, P, Q, R, N, and T [6]. Among them, high‐voltage‐gated l‐type and low‐voltage‐gated T‐type calcium channels regulate the function of PASMCs [7, 8]. l‐type calcium channels (LTCCs) are high‐voltage‐activated channels that primarily mediate sustained, long‐lasting inward flow of calcium and are involved in the contraction and proliferation of vascular smooth muscle cells. Calcium channel blockers (e.g., nifedipine), currently used in clinical practice, not only induce vasodilation but also inhibit the proliferation of vascular smooth muscle cells [9, 10]. T‐type calcium channels (TTCCs) are characterized by low activation voltage, a fast deactivation rate, and a short opening time. Depolarization occurs at low voltages close to the membrane resting potential, activating TTCCs [11, 12, 13]. TTCCs are involved in cellular excitatory regulation and proliferative signaling and are more sensitive to hypoxia, making them critical in HPH. Studies have shown that TTCC inhibitors (e.g., mibefradil) attenuate pulmonary vascular remodeling in animal models [14]. Existing calcium channel blockers mainly target LTCCs, and LTCC inhibitors are primarily used in the treatment of systemic vascular diseases, although they are not fully effective for PH. Therefore, TTCC inhibitors may represent a new strategy to prevent vascular remodeling.
Cav1.2 is a subtype of LTCCs, which regulates normal blood vessel tone. However, Cav1.2 overexpression in vascular smooth muscle cells, driven by certain factors, leads to a large influx of calcium ions, resulting in increased vascular resistance and remodeling [15]. A previous study showed [16] that chronic hypoxia selectively upregulates l‐type (Cav1.2) and T‐type (Cav3.2) voltage‐dependent Ca2+ channels in pulmonary arteries. Another study [17] found that severe pulmonary artery remodeling and right heart hypertrophy are closely associated with high Cav1.2 expression in MCT‐induced PAH rats. Cav3.2 is the primary subtype of TTCCs in PASMCs. The TTCC blocker TTA‐A2 improves pulmonary vascular remodeling and right heart hypertrophy [14]. Another study [18] found that PASMCs treated with Cav3.2‐specific inhibitors and TTCC inhibitors exhibited a significant reduction in the hypoxia‐induced cytoplasmic free calcium concentration.
Echinacoside (ECH) is a phenylethanol glycoside (C35H46O20) isolated from Cistanche tubulosa, and has antioxidant, anti‐inflammatory, and anti‐tumor properties [19, 20, 21, 22, 23]. Research indicates that echinacoside modulates inflammatory mediators, including the NF‐κB pathway, to inhibit the release of pro‐inflammatory factors, thereby attenuating systemic and local inflammatory responses [24, 25]. In experimental pulmonary fibrosis models, echinacoside reduces collagen deposition by regulating macrophage polarization [24]. Our previous in vitro studies showed that ECH inhibits the abnormal proliferation of PASMCs under hypoxic conditions [26] and modulates TRPC1, TRPC4, TRPC6, and CaM signaling pathways to promote PASMC proliferation [27]. Moreover, our findings revealed that ECH improves pulmonary vasoconstriction by inhibiting the influx of extracellular calcium [28]. In vivo experiments in HPH rats further demonstrated that ECH prevents HPH by improving pulmonary blood flow and blood viscosity and significantly reduces mPAP, hemoglobin, hematocrit, right ventricular hypertrophy index, and mean wall thickness percentage of pulmonary arteries [29]. These findings suggest that ECH may improve pulmonary vascular remodeling by modulating calcium signaling pathways. However, the exact molecular mechanisms used by ECH to regulate this pathway in PASMCs remain unknown. Our previous study focused solely on the role of ECH in the HPH rat model, without examining other pulmonary hypertension models. Therefore, this work explored the preventive and therapeutic effects of ECH in HPH and PAH to broaden its use.
2. Materials and Methods
2.1. Experimental Animals
Male Sprague Dawley rats, 6–8 weeks old, weighing 200–250 g, and meeting the SPF‐grade standards were purchased from Liaoning Changsheng Biotechnology Co. Ltd. (Liaoning, China, animal qualification certificate number SCXK (Liao) 2020‐0001). The rats were maintained in a constant‐temperature and humidity environment, under 12 h/12 h light/dark cycles mimicking natural day–night patterns, and subjected to 1 week of acclimatization before the experiments. Each rat had unrestricted access to both food and water. All the experiments were approved by the Ethical Review Committee for Experimental Animal Welfare of Northwest Plateau Institute of Biology, Chinese Academy of Sciences.
2.2. Experimental PAH Modeling and Grouping
The rats were randomly divided into five groups (n = 6): (1) Control, (2) PAH, (3) PAH + ECH (15 mg/kg), (4) PAH + ECH (30 mg/kg), and (5) PAH + Aspirin (8 mg/kg) (Figure 1A).
Figure 1.

Experimental protocol. (A) Experimental PAH modeling and grouping. (B) Experimental HPH modeling and grouping.
A 40‐mg/kg dose of MCT was used in the experiments, which differs from the 60‐mg/kg dose used in most other modeling experiments. This reduction was required because this experiment was performed in Xining City, Qinghai Province, China. Xining City is located 2261 m above sea level on the Qinghai‐Tibet Plateau. Our preliminary attempt at modeling PAH using a single intraperitoneal injection of 60 mg/kg of MCT resulted in a 100% mortality within 1 week. Therefore, viability was ensured using different MCT dosing levels, and 40 mg/kg was identified as the optimal dose for establishing a stable PAH model.
PAH was induced in all the groups except the control with a single intraperitoneal dose of MCT (40 mg/kg). The rats in the treatment group received their designated once‐daily dose of ECH by intragastric administration on the second day after MCT administration. Both the control and PAH groups received an equivalent volume of normal saline once a day by intragastric administration. All the rats had access to food and water ad libitum throughout the entire 28‐day experiment.
Our research group's earlier studies showed that the lowest ECH dose to reduce mean pulmonary artery pressure was 15 mg/kg in HPH rat models [29]. Therefore, we selected both 15‐mg/kg and 30‐mg/kg doses for experimentation in this study. Additionally, we found that the optimal effective dose of aspirin for the pharmacological treatment of HPH is 8 mg/kg [30].
2.3. Experimental HPH Modeling and Grouping
The HPH model was obtained using a hypobaric hypoxia chamber (Figure 1B). The rats were divided into five groups, each consisting of six animals: normoxia, HPH, HPH + ECH (30 mg/kg), HPH + ECH (15 mg/kg), and HPH+Aspirin (8 mg/kg). All the rats, except those in the normoxia group, were housed in a hypobaric hypoxia chamber mimicking an altitude of 5000 m for 28 days. All the rats, except those in the normoxia and HPH groups, received the assigned dose of the drug once daily from the first day in the chamber until day 28. The hypobaric hypoxia chamber maintains a specific humidity and temperature (72.3% RH, 22.3°C). Additionally, the chamber contains 2100 ppm CO₂ and 19.3% oxygen. The rats in the HPH and normoxia groups received the same volume of normal saline daily. All the animals in this experiment had access to food and water ad libitum.
2.4. Isolation and Culture of Rat PASMCs
SD rats were decapitated and immersed in a 75% ethanol solution for 5 min, and then their hearts and lungs were removed and immersed immediately in PBS solution with penicillin (100 U/mL) and streptomycin (100 U/mL). Two to three distal small pulmonary arteries, endothelial cells, and outer membrane cells were removed. The middle layer, which had been separated, was sectioned into small tissue blocks measuring 1 × 1 mm. These blocks were promptly placed at the bottom of a 25T culture flask, which was then inverted. The tissue was placed at the bottom of the culture bottle, and DMEM (5 mL) containing 20% FBS and 1% penicillin‐streptomycin was added. The culture bottle was incubated at 37°C under 5% CO2, with the tissue not in contact with the medium. The incubation lasted 2–4 h, and after the tissue was completely attached to the wall, the culture bottle was gently put down to completely immerse the cells in the medium and incubated until the cells were extruded from the tissue. Upon reaching 80% confluency, the cells were digested with 0.25% trypsin. Subsequently, they were transferred to culture bottles containing high‐glucose DMEM supplemented with penicillin (100 U/mL), streptomycin (100 U/mL), and 15% FBS. The passaging process was then carried out at a 1:2 ratio. The cells used in all experiments were 3–8 generations old.
2.5. Identification of PASMCs by Immunohistochemistry
Cells cultured on glass coverslips were fixed in 4% paraformaldehyde, blocked with 3% hydrogen peroxide for 15 min, and then incubated with α‐SMA antibody at a dilution of 1:200 overnight at 4°C. After washing three times in PBS for 10 min each, cells were incubated with a goat anti‐mouse secondary antibody at room temperature for 45 min, washed three times again in PBS for 10 min each, and visualized with diaminobenzidine (DAB).
2.6. Experimental Reagents
Echinacoside (ECH) (China, North Weiye Metrology Technology Co. Ltd., BWC9053‐2016, HPLC ≥ 98%); monocrotaline (MCT) (China, North Weiye Metrology Technology Co. Ltd., BWB50948, HPLC ≥ 98%); aspirin (Shanghai, Solarbio Company, HPLC ≥ 98%); norepinephrine (NE) bitartrate was purchased from Tianjin Jinyao Pharmaceutical Co. Ltd. (China). SolarBio Science & Technology Co. Ltd. (Beijing, China) supplied dimethylsulfoxide (DMSO); Fetal bovine serum was purchased from Gibco (USA, 10091‐148); DMEM high‐sugar was purchased from Pronoxair (China, PM150210); 0.25% trypsin was purchased from Pronoxair (China, PB180225); streptomycin was purchased from Pronoxair (China, P1400); Whole Protein Extraction Kit (Strong) (Shanghai, Solarbio Company, BC3710); RIPA lysis buffer (Shanghai, Solarbio, R0010); BCA Protein Quantitative Kit (Beyotime Biotechnology Co. LTD., Shanghai, P0010); 30% Acr‐Bis (Solarbio, Shanghai, A1010); 1.5 M Tris‐HCl, pH = 8.8 (Solarbio, Shanghai, T1010); 1 M Tris‐HCl, pH = 6.8 (Solarbio, T1020); SDS (Solarbio, S7180); isopropyl alcohol (Macklin, China, I811925); methanol (Macklin, China, M813895); TEMED (Shanghai, Solarbio Corporation, T8090); loading buffer 5× (Solarbio, P1040); SDS‐PAGE Electrophoresis Solution (Beyotime Biotechnology Co. Ltd., Shanghai, P004B); Fast Transfer Solution (Beyotime Biotechnology, P0021B); Protein Marker (USA, ThermoFisher Scientific, 26616); TBST 10× (Shanghai, Solarbio Corporation, T1081); skim milk powder (BD Corporation, USA, 232100); Rapid Closing Solution (Beyotime Biotechnology, Shanghai, P0252); 0.22 µM PVDF membrane (Beyotime Biotechnology, Shanghai, P0252); 0.45 µM PVDF membrane (Beyotime Biotechnology, Shanghai); 3 M filter paper (Beyotime Biotechnology, Shanghai, FFP39); supersensitive ECL chemiluminescence test kit (Proteintech, PK10003, China); Membrane Regenerating liquid (Solarbio, Shanghai, SW3020); Cav1.2 antibody (UK, Abcam, ab270987); Cav3.2 antibody (UK, Abcam, ab84815); ERK1/2 antibody (China, Proteintech Corporation, 1257‐1‐AP); p38 MAPK antibody (Proteintech, China, 51115‐1‐AP); phospho‐ERK1/2 antibody (Proteintech, 80031‐1‐RR, China); phospho‐p38MAPK antibody (Proteintech, China, 28796‐1‐AP); PKC antibody (UK, Abcam, ab181558); phospho‐PKC antibody (UK, Abcam, ab109539); α‐SMA antibody (Proteintech, China, 67735‐1); alpha‐tubulin antibodies (Proteintech, China, 112241‐AP); HRP‐labeled affinity purified goat anti‐mouse IgG (H + L) (Proteintech, SA00001‐1); HRP monoclonal affinity purified goat anti‐rabbit IgG (H + L) (Proteintech, SA00001‐2); Immunohistochemistry Kit (Elabscience, China, E‐IR‐R217); Gluta Fixative Solution (Leagene Biotech, China, DF0156); RNAsimple Total RNA Kit (Tiangen Biotech; Beijing; China); FastKing gDNA Dispelling RT SuperMix (Tiangen Biotech; Beijing; China); FastReal qPCR PreMix (SYBR Green; FP217; Tiangen Biotech; Beijing; China).
2.7. Detection of mPAP and RVHI in Rats in Each Group
The rats were anesthetized and subjected to right heart catheterization at the end of the experiment to assess mPAP by intraperitoneal pentobarbital sodium (40–60 mg/kg). A right neck incision exposed the right external jugular vein, which was ligated at its distal end. A catheter was then rinsed with heparin sodium saline. The air tightness of the proximal three‐way tube was confirmed, an incision was made in the blood vessel using microscopic scissors, and the catheter was slowly pushed along the incision with its end connected to the biological signal acquisition system (BIOPAC, MP160, United States) to accurately determine whether it entered the pulmonary artery. Finally, mPAP was recorded, dissection was performed, and the cardiac tissue was collected. Cleaning of the left ventricle + septum (LV + SP) was performed by separating the free wall of the right ventricle (RV). Next, RV/(LV + SP) was used to determine the RVHI.
2.8. Sampling and Preservation of Samples
The thorax was opened after RVHI and mPAP assessment, and the lung was quickly removed and rinsed with normal saline. Subsequently, the right upper lobe was isolated and fixed in 4% paraformaldehyde. At the same time, the remaining lung underwent cryopreservation by exposing the sample to liquid nitrogen, which was stored at −80°C until further use.
2.9. Hematoxylin and Eosin (H&E) Staining
The lung was fixed, embedded in paraffin, and cut into 4‐µm‐thick sections for subsequent hematoxylin‐eosin (H&E) staining. The rat lung samples from each group were washed with saline, fixed in 4% paraformaldehyde, embedded in paraffin, and cut into transverse sections, which were stained with H&E. Pathological changes in the lung were examined, and images were acquired using a Pannoramic 250 digital section scanner (3DHISTECH, Hungary). Furthermore, wall thickness (WT), outer diameter, wall area, lumen area, and total wall area of the rat pulmonary artery were measured using Image‐Pro Plus v6.0 software. The WT/outer diameter (WT%), wall area/total wall area (WA%), and lumen area/total wall area (LA%) were also calculated as pulmonary vascular morphology indices for further statistical analyses.
2.10. Van Gieson (VG) Staining
Fixed tissues were dehydrated using a fully automated dehydrator, embedded, sectioned, and dewaxed in water. VG staining solution was applied for 15 min; the tissues were then dehydrated using a gradient of alcohol, clarified with a clearing agent, and sealed with neutral resin. A micro‐imaging system was used to capture images of the sections. Each section was first examined at low magnification to view the entire tissue, followed by the acquisition of 400× microscopic images from three distinct regions. The collagen fiber tissue area (Area) within the captured images was measured using the Image‐Pro Plus 6.0 image analysis system (Media Cybernetics, USA). The percentage of collagen fiber tissue expression area was calculated as: Collagen fiber tissue area/Field of view area (pixel area).
2.11. Transmission Electron Microscopy (TEM)
Centrifuge to collect cell pellets. Remove the medium, resuspend in electron microscopy fixative at 4°C, mix thoroughly, and fix for 2–4 h. Store at 4°C after fixation. Pre‐embed in 1% agarose solution. Fix with 1% osmium tetroxide in the dark at room temperature for 2 h. Dehydrate at room temperature by sequentially transferring tissue through 30%, 50%, 70%, 80%, 95%, 100%, and 100% ethanol for 20 min each, followed by two 15‐min steps in 100% acetone. Perform osmotic embedding using 812 embedding medium. Section polymerized resin blocks at 60–80 nm using an ultramicrotome (RMC, PT‐PC). Retrieve sections using a 150‐mesh square copper grid. Stain copper grids in 2% uranium acetate saturated ethanol solution (light‐protected) for 8 min, followed by a 2.6% lead citrate solution (CO₂‐free) for 8 min. Observation was performed using TEM (HITACHI, HT7800), and images were collected and analyzed.
2.12. Transcriptome Experiment
Except for the control group, the rats in the PAH (model) and PAH + ECH (30 mg/kg) (treatment) groups (n = 3) were established as pulmonary hypertension models via a single intraperitoneal injection of lilium bulbine (40 mg/kg). Starting the day after injection, the rats in the treatment group received daily oral echinacoside for 28 days (Figure 2A). Following treatment completion, rats from all the groups were euthanized using an overdose of the anesthetic agent. Lung tissue from each group was promptly placed in liquid nitrogen for rapid freezing and subsequently transferred to a −80°C freezer for cryopreservation and future use.
Figure 2.

Transcriptomic analysis. (A) The experiment involved transcriptomic sequencing. (B) Flowchart showing the details of the transcriptomic analysis.
A transcriptome experiment was performed using the DNBSEQ sequencing platform. RNA sequencing was performed by isolating and purifying RNA from the rat lung tissue. The whole RNA underwent mRNA enrichment. The polyA terminus‐containing mRNA was further concentrated using OligodT magnetic beads. The interrupted buffer was used to fragment RNA, which was then reverse‐transcribed with random N6 primers. Double‐stranded DNA was created by generating double‐stranded cDNA. The ends of the generated double‐stranded DNA were patched together. A bubbling splice at the 3′ end with a protruding “T” was joined to a sticky end at the 5′ end with a protruding “A” after it was phosphorylated. The junction product was amplified by PCR using a specific primer, followed by thermal denaturation to separate the strands. The resulting single‐stranded DNA was amplified with a bridging primer to generate a circular single‐stranded library. Subsequently, employing the principle of “rolling circle amplification,” this method used an isothermal amplification reaction catalyzed by a DNA polymerase with strand displacement activity. After the primers annealed to the circular template, the polymerase extended them along the circular DNA, continuously displacing the growing strands. Ultimately, this process formed DNA Nanoballs (DNB). BIGSEQ‐2000 sequencing was used to inspect and analyze the constructed library. Figure 2B is a flow chart summarizing the main steps. The reference genome version for this experiment was GCF_000001895.5_Rnor_6.0, with a sequencing length of PE150. Subsequently, the sequencing data underwent gene quantitative analysis and various expression‐level‐based analyses (principal component analysis, correlation analysis, differential gene screening, etc.). For the differentially expressed genes (DEGs) identified between samples, online software DR.Tom was used to perform GO functional enrichment analysis, pathway enrichment analysis, clustering, protein interaction network analysis, and transcription factor analysis.
2.13. Real‐Time Quantitative PCR (RT‐qPCR)
Total RNA was extracted from the lungs using the RNAsimple Total RNA Kit (Tiangen Biotech, Beijing, China), according to the manufacturer's instructions. cDNA was synthesized using FastKing gDNA Dispelling RT SuperMix (Tiangen Biotech; Beijing; China), and the FastReal qPCR PreMix (SYBR Green; FP217; Tiangen Biotech; Beijing; China) was used to amplify the cDNA. Table 1 lists the primers used to perform RT‐qPCR. Target gene mRNA or miRNA expression was normalized to the expression of β‐actin and quantified using the comparative 2−ΔΔCT method.
Table 1.
RT‐qPCR primer sequences.
| Gene | Primer sequence |
|---|---|
| Flt4 | F: 5′‐CTCCAACTTCTTGCGTGTCA‐3′ |
| R: 5′‐ ACAAGGTCCTCCATGGTCAG‐3′ | |
| Cacna1h | F: 5′‐ GGCGAAGAAGGCAAAGCTGA‐3′ |
| R: 5′‐ GCGTGACACTGGGCATGTT‐3′ | |
| Cacna1c | F: 5′‐ GGAGGCAGAATGCAAGGGTAACT‐3′ |
| R: 5′‐ GGTGGAGACGGTAAAGAGGGC‐3′ | |
| Ednra | F: 5′‐ CACCATCTCTTCTCGGGACTAA‐3′ |
| R: 5′‐ CGGAGGAACGCATCAGACT‐3′ | |
| Pdgfrb | F: 5′‐ TGCCTCAGCCAAATGTCACC‐3′ |
| R: 5′‐ TGCTCACCACCTCGTATTCC‐3′ | |
| F2r | F: 5′‐ TGAACCCCCGCTCATTCTTTC‐3′ |
| R: 5′‐ CCAGCAGGACGCTTTCATTTTT‐3′ | |
| Figf | F: 5′‐ATTATTTGTGCAGCGGGAAA‐3′ |
| R: 5′‐ GGCATTCTCCAGAAGCAAAG‐3′ | |
| Adcy3 | F: 5′‐ AGCACCTATATGGCAGCTTCTGGA‐3′ |
| R: 5′‐ TAAGCGTGTCCTTCATGGCTAGTG‐3′ | |
| Ntrk2 | F: 5′‐ GTGGAGGAAGGGAAGTCTGTG‐3′ |
| R: 5′‐ CAGTGGTGGTCTGAGGTTGGA‐3′ | |
| Kdr | F: 5′‐ CGCGTTTTCAGAGTTGGTGG‐3′ |
| R: 5′‐ TGAGGTAGGCAGGGAGAGTC‐3′ | |
| β‐actin | F: 5′‐ ATTGCCGACAGGATGCAGAA‐3′ |
| R: 5′‐ GCTGATCCACATCTGCTGGAA‐3′ |
2.14. Western Blot
Lungs stored at −80°C were homogenized. For cell protein extraction, adherent cells were washed 2–3 times with PBS buffer, thoroughly aspirating the residual solution after the final wash. An appropriate volume of total cell protein extraction reagent was added (incorporate protease inhibitor within minutes before use to achieve a working concentration of 1×). The culture plate/bottle was repeatedly and gently tapped to ensure complete reagent–cell contact. The cells and reagents were scraped into a 1.5‐mL centrifuge tube using a cell scraper, then incubated on ice for 30 min, vortexing periodically to ensure complete cell lysis. Centrifugation was performed at 12,000 g for 5 min at 4°C. The supernatant was collected, which constituted the total protein solution. BCA was used to assess protein concentration. Proteins were separated on an SDS‐PAGE gel and transferred to a PVDF membrane. The membrane was incubated with the following primary antibodies overnight at 4°C: PKC (1:500), p‐PKC (1:500), ERK1/2 (1:500), p38MAPK (1:500), p‐ERK1/2 (1:500), p‐p38MAPK (1:500), Cav1.2 (1:100), and Cav3.2 (1:100). The membrane was washed three times with TBST (10 min each wash) and incubated with the secondary antibody in TBST (1 h, room temperature). After an additional washing procedure, the gray bands were observed using a luminescent imaging system. Protein expression was quantified using ImageJ and processed with Photoshop software.
2.15. Statistical Analysis
Statistical analyses were performed using GraphPad Prism 9.1 (GraphPad Software, Inc., California, USA) and SPSS 27.0 (IBM, Armonk, NY, USA). Differences between the groups were assessed using one‐way analysis of variance after confirming the normal distribution of data. The results were expressed as mean ± standard deviation ( S). A p value of < 0.05 was considered statistically significant.
3. Results
3.1. ECH Reduced mPAP and RVHI of HPH and PAH Rats
mPAP and RVHI, two important indicators of the development of PH, were assessed in HPH and PAH rats. mPAP was significantly reduced in PAH (Figure 3A) and HPH (Figure 3C) rats after ECH treatment, with the reduction being more pronounced in the high‐dose and aspirin‐treated groups (p < 0.05). In addition, RVHI was significantly higher (p < 0.05) in PAH (Figure 3B) and HPH (Figure 3D) rats compared with the control group, suggesting right heart hypertrophy due to long‐term high mPAP. Similarly, RVHI significantly decreased after ECH treatment, especially in the high‐dose and aspirin‐treated groups (p < 0.05). These findings suggested that ECH treatment was effective in reducing mPAP and RVHI in PAH and HPH rats. ECH was very effective in reducing mPAP and improving right heart hypertrophy in PAH rats.
Figure 3.

Effect of ECH on mPAP and RVHI in PH rats. (A) Effect of ECH on mPAP in PAH rats (n = 6) 1) p < 0.05 versus control; 2) p < 0.05 versus the PAH group; 3) p < 0.05 versus the PAH + ECH (15 mg/kg) group. (B) Effect of ECH on RVHI in PAH rats (n = 6) 1) p < 0.05 versus the control group; 2) p < 0.05 versus the PAH group. (C) Effects of ECH on mPAP in HPH rats (n = 6) 1) p < 0.05 versus the normoxia group; 2) p < 0.05 versus the HPH group; 3) p < 0.05 versus the HPH + ECH (15 mg/kg) group. (D) Effect of ECH on RVHI in HPH rats (n = 6) 1) p < 0.05 versus the normoxia group; 2) p < 0.05 versus the HPH group.
3.2. ECH Improved MCT and Hypoxia‐Induced Pulmonary Artery Remodeling
The H&E staining of the lungs in all the groups revealed normal morphology in the control group, with no signs of infiltration of inflammatory cells, edema, or hyperplastic fibrous connective tissue, and no evidence of arterial wall thickening or smooth muscle proliferation. Histopathological findings in the PAH and HPH groups revealed the presence of a serous membrane covering the tissue surface, thickened artery wall, smooth muscle cell proliferation, and small vacuoles in some portions of the media layer. In addition, the interstitium showed inflammatory cell infiltration, primarily neutrophils, brown‐yellow pigmentation in local areas, localized hemorrhage, and erythrocytosis. ECH treatment significantly improved lung morphology, with the bronchial structure appearing normal at all levels. However, although the interstitium showed minor inflammatory cell infiltration, the pulmonary arteriolar thickening was significantly reduced, and the remodeling was improved (Figure 4A,B). Figure 4C,D shows the quantitative analysis of H&E staining results, in which WT and wall area (WA) were significantly higher in both PAH and HPH groups than in the control group (p < 0.05), and they were considerably reduced by ECH treatment. In contrast, lumen area (LA) decreased significantly in the PAH and HPH groups compared with the control group (p < 0.05), and it increased to normal levels after ECH treatment.
Figure 4.

ECH improves the pathomorphological changes induced by hypoxia and MCT. (A and B) Pulmonary arteries stained by H&E. Effect of ECH on hypoxic pulmonary vascular remodeling in PAH and HPH rats. (C) The indicators of pulmonary vascular morphology WT, LA, and WA. 1) p < 0.05 versus the control group, (n = 6); 2) p < 0.05 versus the PAH group, (n = 6). (D) The indicators of pulmonary vascular morphology WT, LA, and WA. 1) p < 0.05 versus the normoxia group, (n = 6); 2) p < 0.05 versus the HPH group, (n = 6). (E and F) Pulmonary arteries stained by Van Gieson (VG) staining. Thickening of the artery walls and collagen fiber hyperplasia in the pulmonary artery outer membrane (n = 3).
Figure 4E,F shows changes in vascular collagen fibers in the lung. They increased in the PAH and HPH groups, and a certain degree of intima‐media thickening was observed. However, this effect remarkably improved after ECH treatment. In particular, collagen fiber proliferation was more pronounced in the epicardium of the pulmonary artery in the HPH group compared with the PAH group. Collagen fiber hyperplasia in the pulmonary artery periphery is an early structural change that occurs during hypoxia.
These findings indicated that ECH treatment successfully reduced these changes and significantly improved vascular remodeling in PAH and HPH.
3.3. ECH Reduced Increased Calcium Release in PASMCs
The endoplasmic reticulum (ER) is responsible for storing and regulating intracellular calcium ion levels. Calcium ion release from the ER plays a crucial role in the pathophysiology of PH. Normal rough endoplasmic reticulum (RER) forms an orderly network of flat sacs or tubules, with numerous ribosomes (small black dots) uniformly attached to its membrane surface. It serves as the primary site for protein synthesis. We examined the ER morphology in each group using TEM. Our previous study showed that 1‐µM NE significantly increased calcium release in PASMCs and effectively stimulated PASMC proliferation. In addition, according to our findings, preincubation with ECH (450 µM) effectively suppresses the NE‐induced proliferation of PASMCs [27]. Additionally, regarding the selection of effective concentrations for aspirin, studies indicate that aspirin can effectively inhibit vascular smooth muscle cell proliferation, with an effective inhibitory concentration of 2 mmol/L [31]. In the NE group, the ER undergoes a transformation from its normal flat, sac‐like, tubular network structure to a state of extensive expansion and vesicularization, with vacuolar changes of varying sizes appearing in some areas (Figure 5B). This occurs because under sustained stress conditions, large accumulations of unfolded or misfolded proteins cause an increase in osmotic pressure within the ER lumen. Water influx leads to structural swelling. The continuity of the ER membrane is disrupted, resulting in breaks and fragmentation, with a reduction in ribosome attachment. Following treatment with ECH and aspirin, the extent of ER dilation and vesicular changes significantly diminishes, restoring a relatively regular tubular or sac‐like network structure. Cavity swelling subsides, and vacuolar changes decrease or even disappear. The continuity of the ER membrane is restored, fragmentation decreases, and ribosome attachment to the rough ER increases, gradually restoring normal protein synthesis and folding functions (Figure 5C–E).
Figure 5.

Ultrastructure of the ER in each group of cells. (A–E) Representative TEM images of each cell group (scale bar = 2 µm). Red arrows indicate RER, appearing as flattened sacs with ribosomal particles attached to the membrane surface; The yellow arrows indicate the ER in an expanded, vesicular state, appearing as tubular or vesicular structures with no ribosomes on the membrane surface. The green arrow indicates the occurrence of a cavitation‐like phenomenon.
3.4. Transcriptome Results
Using Dr. Tom's online analysis software, |log2FC | ≥ 1 and Q‐value ≤ 0.05 were established to perform enrichment analysis using the phyper function in R software and calculate P‐values, followed by applying false discovery rate (FDR) correction to obtain Q‐values. Features with Q‐value ≤ 0.05 are typically considered significantly enriched. Using this screening criterion, 270 DEGs between the model and the control were analyzed. Among these, 222 were upregulated, and 48 were downregulated. Fifty‐nine DEGs were found between the treated and model groups, including 41 upregulated and 18 down‐regulated genes. A total of 405 DEGs were found between the treated and control groups, including 269 upregulated and 136 downregulated genes (Figure 6A). Figure 6B,C show the volcano plot and heatmap of DEGs, respectively.
Figure 6.

Identification of DEGs in transcriptome sequencing data from the PAH model. (A) Bar graph showing the number of DEGs. (B, C) Volcano plots and heatmaps illustrate the expression of differentially regulated genes. (D) Gene Ontology (GO) annotation of DEGs between the model and control, as well as the treated and model groups. The X‐axis represents enrichment ratio (calculated as Rich Ratio = Candidate Gene Count/Total Gene Count annotated to the term, where the candidate genes are those annotated to a specific term within the selected gene set). The Y‐axis represents GO Terms. Bubble size indicates the number of differentially annotated genes for each GO Term, while color denotes enrichment significance (Q‐value or p value). Redder colors indicate lower significance values. (E) Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of DEGs between the model and control, as well as the treated and model groups. (F) mRNA expression of DEGs associated with calcium signaling pathways by RT‐qPCR. 1) p < 0.05 versus the control group, 2) p < 0.05 versus the model group (n = 3).
DEGs were subjected to GO enrichment analysis (Figure 6D). Concerning cellular components, DEGs in the model were mainly found in the following functions: extracellular region, matrix and space, collagen trimer, basement membrane, collagen‐containing extracellular matrix, sarcolemma, actin cytoskeleton, and cell‐to‐cell junction. DEGs in the treatment group were mainly found on the cell surface, in the extracellular space and matrix, and on the plasma membrane and its exterior. Regarding molecular functions, DEGs in the model were mainly involved in the following functions: serine‐type endopeptidase activity, extracellular matrix structural constituents, growth factor, platelet‐derived growth factor, actin, calcium ion, collagen binding, metalloendopeptidase, serine‐type peptidase, and peptidase activities. DEGs in the treated group were mainly involved in the following functions: collagen, integrin, glucokinase, phosphotransferase activity, and alcohol groups as acceptors. Concerning biological processes, DEGs in the model were mainly involved in the following functions: extracellular matrix and collagen fibril organization, angiogenesis, cell and cell‐matrix adhesion, wound healing, proteolysis, positive regulation of endothelial cell proliferation, and cell migration. DEGs in the treatment group were mainly involved in the following aspects: positive regulation of ERK1 and ERK2 cascades, collagen catabolic processes, positive regulation of kinase activity, cell adhesion, and regulation of cytokine production involved in inflammatory response. The above results indicate that ECH treatment may regulate cellular proliferation in PH.
Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway enrichment analysis involves functionally classifying DEGs based on KEGG Pathway annotations. The phyper function in R software is used to perform enrichment analysis, calculate p values, and then apply FDR correction to obtain Q‐values. Functions with Q‐values ≤ 0.05 are typically considered significantly enriched. This analysis primarily reveals the pathways associated with the DEGs. KEGG pathway analysis identified pathways associated with DEGs (Figure 6E). The results indicated that DEGs in the model were primarily enriched in pathways including ECM‐receptor interaction, PI3K‐Akt signaling pathway, cancer pathways, dilated cardiomyopathy, actin cytoskeleton regulation, arrhythmogenic right ventricular cardiomyopathy, hypertrophic cardiomyopathy, and vascular smooth muscle contraction. On the other hand, DEGs in the treated group were mainly involved in calcium signaling and similar pathways. It is important to emphasize that the calcium signaling pathway had the most significantly enriched DEGs between the treated and model groups, consistent with our previous study, which showed that ECH reduced hypoxia‐induced intracellular flow of free calcium ions in PASMCs. The transcriptome sequencing analysis showed that the key DEGs in calcium signaling pathways included Ryr3, Nos2, Fgfr2, Ntrk2, Kdr, Mcoln2, Htr2b, Atp2b4, Cacna1h, Cacna1c, Cysltr1, Flt4, Ednra, Nos3, F2r, Figf, and Adcy3. Table 2 lists the most significant DEGs, with their mRNA expression demonstrating consistency with the transcriptomic results (Figure 6F). This suggested that ECH inhibited calcium ion influx by regulating these genes, thereby contributing to the treatment of PH.
Table 2.
Differentially expressed genes associated with calcium signaling pathways.
| Gene ID | Gene symbol | Type | Control average TPM | Model average TPM | Treat average TPM |
|---|---|---|---|---|---|
| 114110 | Flt4 | mRNA | 2.76 | 7.96 | 6.63 |
| 114862 | Cacna1h | mRNA | 1.23 | 2.47 | 1.92 |
| 24239 | Cacna1c | mRNA | 2.41 | 4.61 | 3.32 |
| 24326 | Ednra | mRNA | 27.42 | 42.31 | 31.31 |
| 24629 | Pdgfrb | mRNA | 23.46 | 42.23 | 32.39 |
| 25439 | F2r | mRNA | 80.27 | 122.33 | 118.72 |
| 360457 | Figf | mRNA | 6.52 | 20.26 | 10.01 |
| 64508 | Adcy3 | mRNA | 3.58 | 6.05 | 4.74 |
| 25054 | Ntrk2 | mRNA | 11.69 | 27.70 | 6.68 |
| 25589 | Kdr | mRNA | 49.07 | 70.19 | 40.07 |
The transcriptome sequencing results demonstrated that ECH contributed to cell cycle regulation by reducing the intracellular free calcium ion concentration in PASMCs. This, in turn, contributed to improved pulmonary vascular remodeling, which could be a key signaling pathway for preventing and treating PH. Therefore, based on these results, further analysis will involve representative calcium signaling pathway‐related proteins and cell cycle signaling regulatory pathways to explore and verify ECH's mechanism in preventing and treating PH.
3.5. ECH Downregulated Cav1.2 and Cav3.2 in PAH and HPH
The effect of ECH on Cav1.2 and Cav3.2 gene and protein expression by western blot (Figure 7A–C) and RT‐qPCR (Figure 7D–E) in the lung of PAH rats revealed that the expression of Cav1.2 increased compared to the controls (p < 0.05) but decreased in the PAH + ECH (30 mg/kg) and PAH + Aspirin (8 mg/kg) groups compared to the PAH group (p < 0.05). Cav3.2 expression in the PAH group was significantly upregulated compared to the controls (p < 0.05). Cav3.2 mRNA and protein expression decreased in the PAH + ECH (30 mg/kg) and PAH+Aspirin (8 mg/kg) groups compared to the PAH group (p < 0.05).
Figure 7.

Effect of ECH on Cav1.2 and Cav3.2 in PH rat lung. (A–C) Effect of ECH on Cav1.2 and Cav3.2 protein expression in PAH rats (n = 3) 1) p < 0.05 versus the control group; 2) p < 0.05 versus the PAH group; 3) p < 0.05 versus the PAH + ECH (15 mg/kg) group. (D–E) Effect of ECH on Cav1.2 and Cav3.2 mRNA expression in PAH rats (n = 3) 1) p < 0.01 versus the control group; 2) p < 0.05 versus the PAH group. (B–H) Effect of ECH on Cav1.2 and Cav3.2 protein expression in HPH rats (n = 3) 1) p < 0.05 versus the normoxia group; 2) p < 0.05 versus the HPH group. (I–J) Effect of ECH on Cav1.2 and Cav3.2 mRNA expression in HPH rats (n = 3); 1) p < 0.05 versus the normoxia group; 2) p < 0.05 versus the HPH group.
Western blot and RT‐qPCR analyses showed the respective effects of ECH on Cav1.2 and Cav3.2 and mRNA (Figure 7I,J) and protein (Figure 7F–H) expression in the lungs of HPH rats. Cav1.2 mRNA and protein expression increased significantly in the HPH group compared to the normoxia group (p < 0.05) but decreased in the HPH + ECH (30 mg/kg) and HPH+Aspirin (8 mg/kg) groups compared to the HPH group (p < 0.05). Cav3.2 mRNA and protein expression increased in the HPH group compared to the normoxia group (p < 0.05) but decreased in the HPH + ECH (30 mg/kg) and HPH+Aspirin (8 mg/kg) groups compared to the HPH group (p < 0.05).
Cav1.2 and Cav3.2 mRNA and protein expression increased in both MCT‐ and hypoxia‐induced pulmonary hypertension, and ECH inhibited the expression of both, thereby inhibiting calcium influx.
3.6. ECH Downregulated the PKC/MAPK Signaling Pathway in PAH and HPH Rats
Figure 8A–C shows the effects of ECH on ERK1/2, p‐p38MAPK, p38MAPK, p‐ERK1/2, PKC, and p‐PKC protein expression in PAH rat lung tissue. The relative p‐ERK1/2, p‐p38MAPK, and p‐PKC protein expression increased in the PAH group (p < 0.05). p‐ERK1/2, p‐p38MAPK, and p‐PKC protein expression decreased in the PAH + ECH (30 mg/kg) and PAH + Aspirin (8 mg/kg) groups compared to the PAH group (p < 0.05), demonstrating decreased PKC and MAPK‐related protein phosphorylation levels in ECH‐treated rat lungs.
Figure 8.

Effect of ECH on the PKC/MAPK signaling pathway in PH rats. (A–C) Effect of ECH on MAPK pathway‐associated protein expression in PAH rats. 1) p < 0.05 versus the control group (n = 3); 2) p < 0.05 versus the PAH group (n = 3). (D–F) Effect of ECH on MAPK pathway‐associated protein expression in HPH rats. 1) p < 0.05 versus the normoxia group (n = 3); 2) p < 0.05 versus the HPH group (n = 3).
Figure 8D–F shows the effects of ECH on ERK1/2, p‐ERK1/2, p38MAPK, PKC, p‐p38MAPK, and p‐PKC protein expression in HPH rat lung tissue. The relative p‐PKC, p‐p38MAPK, and p‐ERK1/2 protein expression increased significantly in the HPH group (p < 0.05) but decreased in the HPH + ECH (30 mg/kg) and HPH+Aspirin (8 mg/kg) groups compared to the HPH group (p < 0.05).
Our previous study revealed that hypoxia‐induced abnormal cell proliferation in rat PASMCs is mediated by the upregulation of the hypoxia‐induced mitogenic factor (HIMF), resulting in increased intracellular Ca2+ levels and the regulation of the PKC/MAPKs signaling pathway in PASMCs [32]. ERK1/2, p38MAPK, and PKC protein expression increased in PAH and HPH groups, and their phosphorylation decreased after ECH treatment, suggesting that ECH inhibited the PKC/MAPK signaling pathway in PAH and HPH.
3.7. ECH Downregulated the PKC/MAPK Pathway by Modulating Cav1.2/Cav3.2
Next, we conducted cellular experiments using PASMCs to further investigate whether ECH modulates PKC/MAPK signaling pathway activation by regulating Cav1.2 and Cav3.2. PASMCs were isolated from the pulmonary arteries of male SD rats and were identified as PASMCs by immunohistochemical staining. Spindle cells were densely packed and stained positively for PASMCs at low magnification. The purity of PASMCs was > 95% (Figure 9A), and brown‐stained myofilaments were clearly visible in the cytoplasm at high magnification (Figure 9B). Additionally, we conducted cellular experiments using specific inhibitors of Cav1.2 and Cav3.2 to more precisely investigate the relationship between ECH and the Cav1.2/Cav3.2 signaling pathways and the PKC/MAPK signaling pathway. Demethylsuberosin is a coumarin compound found in Angelica gigas Nakai. Demethylsuberosin exerts antihypertensive effects by inhibiting L‐type Cav1.2 channels. Ulixacaltamide is an orally effective T‐type calcium channel antagonist that slows the progression of epilepsy. In cell experiments, we used NE to induce increased calcium release in PASMCs, serving as the model group. Changes in the phosphorylation expression of the PKC/MAPK signaling pathway were analyzed via Western blotting. As shown in Figure 9C–F, P‐PKC, P‐p38MAPK, and P‐ERK expression were significantly upregulated following NE treatment, indicating that NE induces calcium imbalance in PASMCs, thereby activating the PKC/MAPK pathway (p < 0.05). The activation of the PKC/MAPK signaling pathway was significantly suppressed by Cav1.2 and Cav3.2 inhibitors, and ECH treatment also significantly inhibited this change (p < 0.05). Therefore, our study demonstrated that ECH effectively suppresses the activation of the PKC/MAPK signaling pathway by regulating the expression of Cav1.2 and Cav3.2.
Figure 9.

Cell experiments were conducted to investigate how ECH modulates the PKC/MAPK pathway via Cav1.2/Cav3.2. (A) Spindle cells were densely packed and stained positively for PASMCs at low magnification. (B) Brown‐stained myofilaments were clearly visible in the cytoplasm at high magnification. (C–F) Western blot analysis demonstrates the effects of Cav1.2 and Cav3.2 on the PKC/MAPK signaling pathway. 1) p < 0.05 versus the control group (n = 3); 2) p < 0.05 versus the NE group (n = 3).
4. Discussion
This study demonstrated the involvement of ECH in the treatment of HPH and PAH. Our findings showed for the first time that ECH modulated Cav1.2, Cav3.2/PKC/MAPK signaling pathways, improved pulmonary vascular remodeling, and attenuated mPAP and RVHI in HPH and PAH rats, leading to the treatment of HPA and PAH.
Our previous study assessed the preventive and therapeutic effects of ECH on HPH. ECH inhibits the proliferation of PASMCs in HPH rats via TRPC1, TRPC4, TRPC6, and CaM signaling pathways [27]. Given the pathological processes underlying PAH, the multifunctional properties of Echinacoside make it an attractive therapeutic candidate. PAH patients exhibit markedly elevated oxidative stress, leading to vascular endothelial cell damage and smooth muscle cell proliferation. Echinacoside possesses potent free radical scavenging capacity, protecting pulmonary vascular endothelial cells by reducing reactive oxygen species levels and mitigating oxidative stress‐induced vascular damage [33]. Inflammation plays a pivotal role in PAH pathogenesis and progression, with macrophage and T‐cell recruitment, along with the release of inflammatory cytokines, directly promoting pulmonary vascular remodeling. Echinacoside inhibits the secretion of pro‐inflammatory cytokines (such as IL‐1β, IL‐6, and TNF‐α) and alleviates inflammatory responses by suppressing the nuclear factor κB (NF‐κB) signaling pathway, suggesting its potential to mitigate PAH‐associated inflammation [34]. Furthermore, echinacoside may counteract excessive smooth muscle cell proliferation by modulating the STAT3 signaling pathway, thereby inhibiting vascular remodeling processes [35]. Although ECH has demonstrated multifaceted potential therapeutic value, its low oral bioavailability and rapid metabolism limit its further clinical development [33, 36]. Furthermore, while our research indicates that ECH exhibits low cytotoxicity, the potential toxicity associated with high doses or long‐term use warrants further investigation [26, 27].
Despite the findings regarding the great potential of ECH in PH treatment, previous research has significant limitations. Previous studies have often focused on hypoxia‐induced PH models, ignoring the potential treatment effect of ECH on other PH subtypes, such as PAH. Additionally, studies on the mechanisms regulating the effects of ECH treatment on PH are scarce. These gaps were initially addressed by expanding the scope of ECH treatment using two methods to build PH models: a low‐pressure oxygen chamber for the HPH model and MCT for the PAH model. The outcomes of this dual approach indicated that ECH had beneficial therapeutic effects on both PH rat models. MCT is commonly used to induce PAH models, but it is also useful for inducing PH via an inflammatory response, vascular endothelial injury, and regulation of PASMC proliferation [37]. MCT‐induced injury to pulmonary vascular endothelium leads to narrowing or obstruction of the intravascular lumen. Additionally, MCT promotes vascular endothelial cell apoptosis, continuous PASMC proliferation, and inhibition of PASMC apoptosis [38]. Secondly, transcriptomic sequencing was used to identify DEGs. This enabled a systematic study of ECH mechanisms of action in PH and corroborated our previous experimental speculation that ECH exerts its protective effects in PH mainly by regulating the cell cycle through calcium signal transduction pathways.
Aspirin is a common antiplatelet drug used to treat cardiovascular diseases. There is also growing evidence that platelets are involved in the pathogenesis of pulmonary hypertension. Previous studies have shown that platelet activation releases many factors, including growth factors, cytokines, and vasoactive substances, which cause vasoconstriction, smooth muscle cell proliferation, and perivascular inflammation. In addition, platelet aggregation leads to blood clots, and this series of changes further aggravates pulmonary hypertension [39]. Aspirin is a widely used FDA‐approved medication with therapeutic effects on pulmonary hypertension. Aspirin improves pulmonary vascular resistance in a hypoxia‐induced PH rat model by inhibiting endothelial–mesenchymal transition in vitro and in vivo through the inhibition of the HIF‐1α/TGF‐β1/Smads/Snail signaling pathway; therefore, aspirin may serve as a new therapeutic agent for hypoxic PH by acting as an inhibitor of EndMT [30]. Our previous study demonstrated that aspirin combined with ECH is effective in the treatment of HPH; thus, in this experiment, aspirin was chosen as a positive control to evaluate the therapeutic effect of ECH on PAH.
Our results demonstrated that ECH reduced mPAP and RVHI in both HPH and PAH rats, suggesting that ECH might have preventive and therapeutic effects on HPH and PAH. Secondly, H&E and VG staining were performed to assess pulmonary vascular remodeling, revealing that the pulmonary arteries of HPH and PAH rats exhibited disorganized cellular arrangement, inflammatory cell infiltration, remodeling of the pulmonary arterial wall, and severe vascular fibrosis and intima‐media thickening. All these pathologic changes improved after ECH treatment, suggesting that ECH was beneficial for pulmonary vascular remodeling and for reducing/inhibiting PH. The ECH mechanism of action in improving pulmonary vascular remodeling was further investigated using transcriptomic analysis.
Transcriptome analysis revealed increased Cav1.2 and Cav3.2 gene expression in the model group, which decreased after ECH treatment. Thus, both mRNA and protein expression were assessed. The results showed the upregulation of Cav1.2 and Cav3.2 expression in the lungs of PAH and HPH rats. However, their expression in the lungs of the PAH + ECH (15 mg/kg), HPH + ECH (30 mg/kg), and HPH+Aspirin (8 mg/kg) groups was downregulated. These findings confirmed that ECH regulated LTCCs and TTCCs, improving pulmonary vascular remodeling and inhibiting PH.
ERK1/2 and p38MAPK are prominent members of the MAPK subfamily. ERK1/2 activation is triggered by various factors, including growth factors and vasoactive substances, leading to its phosphorylation and subsequent movement into the nucleus, where it promotes the transcription and expression of specific genes and induces cell proliferation and differentiation. On the other hand, p38MAPK is located in the cytoplasm and is subsequently translocated to the nucleus when activated by G protein‐coupled receptors and cytokine stimulation to induce various pathophysiological processes, including regulation of cell growth, proliferation, differentiation, and apoptosis [40].
PKC is divided into three subfamilies: traditional, novel, and atypical. Traditional PKC contains the α, βI, βII, and γ subtypes. These subtypes are activated when the concentration of diacylglycerol and intracellular free calcium ions increases, activating MAPK‐related proteins [41]. The PKC/MAPK pathway is a common intersection pathway for cell proliferation, stress, inflammation, differentiation, functional synchronization, transformation, apoptosis, and other signal transduction pathways. Resistin‐like molecule β (RELM‐β) is a direct homologous gene of hypoxia‐induced mitosis factors. A study [42] showed that RELM‐β is activated by hypoxic conditions, leading to increased free calcium ion concentration in PASMCs. Consequently, the phosphorylation levels of PI3K, Akt, mTOR, PKC, and MAPK proteins increase. Conversely, silencing RELM‐β reduces the phosphorylation of these proteins. Thus, pulmonary vascular remodeling in HPH is inhibited by regulating calcium‐dependent PI3K/Akt/mTOR and PKC/MAPK pathways.
Our findings in PAH and HPH rat models revealed an upregulation of p‐ERK1/2, p‐p38MAPK, and p‐PKC expression in the lungs of PAH and HPH rats, indicating a potential link to the hypoxia‐ and inflammation‐induced overexpression of T‐type and LTCCs. The resulting calcium ion influx led to cellular calcium overload, which, in turn, activated PKC, promoting its phosphorylation. Activated PKC phosphorylated MAPK‐related proteins, ultimately influencing cell proliferation and differentiation. The PAH + ECH (30 mg/kg), PAH + Aspirin (8 mg/kg), HPH + ECH (30 mg/kg), and HPH+Aspirin (8 mg/kg) groups exhibited a downregulation of p‐ERK1/2, p‐p38MAPK, and p‐PKC protein expression in the lung. This indicated that ECH improved pulmonary vascular remodeling by inhibiting the PKC/MAPK pathway. Our preliminary results suggested that the effect of ECH on improving pulmonary vascular remodeling in PH rats might be mediated by the regulation of TTCCs and LTCCs and PKC/MAPK pathways in PASMCs. When stimulated by hypoxia and inflammation, ECH reduced the concentration of intracellular free calcium ions in pulmonary vessels via these channels. This then led to the regulation of the calcium‐dependent PKC/MAPK pathway, resulting in reduced PASMC proliferation and differentiation and improved pulmonary vascular remodeling in PH rats.
In conclusion, our findings support the hypothesis that external stimuli, such as hypoxia and inflammation, activate Cav1.2 and Cav3.2, thereby opening LTCCs and TTCCs. This activation leads to a significant influx of calcium ions into the cell, increasing cytosolic free calcium concentration in PASMCs. The resulting calcium ion overload triggers the phosphorylation of PKC, which in turn phosphorylates Ras and activates Raf kinase. This further binds to downstream MEK 1/2, finally entering the nucleus for transcriptional regulation (Figure 10). Furthermore, our findings suggest that ECH inhibits pulmonary vasoconstriction and vascular remodeling by regulating the Cav1.2 and Cav3.2/PKC/MAPK pathways to reduce mPAP, thereby preventing and treating PH.
Figure 10.

Schematic diagram of the proposed mechanism. Upon activation, PKC phosphorylates and activates RasGRP, which promotes nucleotide exchange on Ras, converting it from the Guanosine diphosphate (GDP)‐bound (inactive) to the Guanosine triphosphate (GTP)‐bound (active) state. Ras‐GTP recruits RAF1 to the plasma membrane and promotes its conformational activation. RAF1 is then phosphorylated at key residues such as Ser338 by upstream kinases (including PKC), leading to its full activation. Activated RAF1 directly phosphorylates mitogen‐activated extracellular signal‐regulated kinase (MEK) on Ser218 and Ser222. Dual‐phosphorylated MEK then directly phosphorylates ERK on Thr202 and Tyr204. Activated ERK translocates to the nucleus and phosphorylates various transcription factors to regulate gene expression. Arrows indicate activation or the direction of signaling. Solid arrows denote direct phosphorylation events with specific sites indicated. Dashed arrows represent indirect regulatory steps. GTP/GDP states of Ras are explicitly shown.
Our upcoming studies will continue to delve into the effects and mechanisms of ECH in treating PH from multiple perspectives. In in vivo experiments using inhibitors or gene‐silencing techniques targeting calcium signaling pathways, we aim to accurately observe the ECH effect and mechanism in treating PH. In vitro experiments will be performed to observe the activation of calcium signaling pathways in relevant cells using patch‐clamp technology. The specific regulation of these signaling pathways by ECH will be confirmed by molecular docking and Cellular Thermal Shift Assay (CETSA), demonstrating that ECH improves PH by modulating calcium channel proteins. These studies will provide direct evidence of the effect of ECH on treating PH. They will also offer an important theoretical basis for improving pulmonary vascular remodeling. More effective and accurate PH prevention and treatment plans may be developed as studies progress.
5. Conclusions
ECH improves pulmonary vascular remodeling by regulating Cav1.2 and Cav3.2/PKC/MAPK signaling pathways during PH development, thereby reducing mPAP and positively affecting the prevention and treatment of HPH and PAH.
Author Contributions
Conceptualization: Xiangyun Gai. Data curation: Yuefu Zhao, Jinyu Wang and Yujie Qiao. Investigation: Yuefu Zhao, Jinyu Wang, Yujie Qiao, Jiacheng Hu, Hongmai Wang, Qingqing Xia, and Qiuqin Hu. Provided general support: Zhanqiang Li, Cen Li, and Hongtao Bi. Animal experiment support: Hongtao Bi. Methodology: Xiangyun Gai. Writing – original draft: Yuefu Zhao, Jinyu Wang, and Yujie Qiao. Writing – review and editing: Xiangyun Gai, Yuefu Zhao, Jinyu Wang, and Yujie Qiao.
Ethics Statement
The experiments were performed according to the Guidelines for the Care and Use of Laboratory Animals (1985, NIH) and the Ethical Review Committee for Experimental Animal Welfare of Northwest Plateau Institute of Biology, Chinese Academy of Sciences approved all the experiments. All surgeries were performed under sodium pentobarbital anesthesia, and efforts were made to minimize suffering.
Conflicts of Interest
The authors declare no conflicts of interest.
Acknowledgments
We express our gratitude to the Qinghai Provincial Key Laboratory of Tibetan Medicine Pharmacology and Safety Evaluation of the Northwest Institute of Plateau Biology of the Chinese Academy of Sciences for the experimental and technical support. We would like to thank MogoEdit (https://www.mogoedit.com) for its English editing during the preparation of this manuscript. Xiangyun Gai takes responsibility for the content of the manuscript, including the data and analysis. This study was supported by the Central Government Guidance Fund for Local Science and Technology Development Program of Qinghai Province (2025‐ZY‐047) and Kunlun Talents, High‐end Innovation and Entrepreneurship Leading Talents Program of Qinghai Province (2025).
Zhao Y, Wang J, Qiao Y, Gai X, Hu J, Wang H, Xia Q, Hu Q, Li Z, Li C, Bi H, “Echinacoside Improves Pulmonary Vascular Remodeling by Regulating the L‐ and T‐Type Ca2+ Channels in the Prevention and Treatment of Pulmonary Hypertension,” Pulmonary Circulation 16 (2026): 1‐17, 10.1002/pul2.70235.
Yuefu Zhao, Jinyu Wang, and Yujie Qiao are co‐first authors of this study.
Guarantor: Xiangyun Gai.
Data Availability Statement
The data sets in the study are not publicly available, but may be obtained from the corresponding author upon reasonable request.
References
- 1. Humbert M., Kovacs G., Hoeper M. M., et al., “2022 ESC/ERS Guidelines for the Diagnosis and Treatment of Pulmonary Hypertension,” European Respiratory Journal 61, no. 1 (January 2023): 2200879. [DOI] [PubMed] [Google Scholar]
- 2. Mandras S. A., Mehta H. S., and Vaidya A., “Pulmonary Hypertension: A Brief Guide for Clinicians,” Mayo Clinic Proceedings 95, no. 9 (September 2020): 1978–1988. [DOI] [PubMed] [Google Scholar]
- 3. Liao X. and Li Y., “Genetic Associations Between Voltage‐Gated Calcium Channels and Autism Spectrum Disorder: A Systematic Review,” Molecular Brain 13, no. 1 (June 2020): 96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Andrade A., Brennecke A., Mallat S., et al., “Genetic Associations Between Voltage‐Gated Calcium Channels and Psychiatric Disorders,” International Journal of Molecular Sciences 20, no. 14 (July 2019): 3537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Heyes S., Pratt W. S., Rees E., et al., “Genetic Disruption of Voltage‐Gated Calcium Channels in Psychiatric and Neurological Disorders,” Progress in Neurobiology 134 (November 2015): 36–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Wang J. Y., Zhao Y. F., Zhao E. Q., et al., “Mechanism of Pulmonary Artery Remodeling Induced by Calcium Overload Induced by Hypoxia,” Acta Pharmaceutica Sinica 56, no. 8 (2021): 2164–2168. [Google Scholar]
- 7. Dryn D. O., Melnyk M. I., Melanaphy D., Kizub I. V., Johnson C. D., and Zholos A. V., “Bidirectional TRP/L Type Ca2+ Channel/RyR/BKCa Molecular and Functional Signaloplex in Vascular Smooth Muscles,” Biomolecules 13, no. 5 (April 2023): 759. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Liao J., Zhang Y., Ye F., et al., “Epigenetic Regulation of L‐Type Voltage‐Gated Ca2+ Channels in Mesenteric Arteries of Aging Hypertensive Rats,” Hypertension Research 40, no. 5 (May 2017): 441–449. [DOI] [PubMed] [Google Scholar]
- 9. Jy S. and Hc C., “Nifedipine Inhibits Vascular Smooth Muscle Cell Proliferation and Reactive Oxygen Species Production Through AMP‐Activated Protein Kinase Signaling Pathway,” Vascular Pharmacology 56, no. 1–2 (February 2012): 1–8, https://pubmed.ncbi.nlm.nih.gov/21708289/. [DOI] [PubMed] [Google Scholar]
- 10. Morales‐Cano D., Barreira B., Callejo M., et al., “Comparative Analysis of Antiproliferative and Vasodilator Effects of Drugs for Pulmonary Hypertension: Extensive In Vitro Study in Rats and Human,” Vascular pharmacology 155 (June 2024): 107371. [DOI] [PubMed] [Google Scholar]
- 11. Cain S. M. and Snutch T. P., “Contributions of T‐Type Calcium Channel Isoforms to Neuronal Firing,” Channels 4, no. 6 (2010): 475–482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Melgari D., Frosio A., Calamaio S., Marzi G. A., Pappone C., and Rivolta I., “T‐Type Calcium Channels: A Mixed Blessing,” International Journal of Molecular Sciences 23, no. 17 (August 2022): 9894. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Tamargo J. and Ruilope L. M., “Investigational Calcium Channel Blockers for the Treatment of Hypertension,” Expert Opinion on Investigational Drugs 25, no. 11 (November 2016): 1295–1309. [DOI] [PubMed] [Google Scholar]
- 14. Chevalier M., Gilbert G., Roux E., et al., “T‐Type Calcium Channels Are Involved in Hypoxic Pulmonary Hypertension,” Cardiovascular Research 103, no. 4 (September 2014): 597–606. [DOI] [PubMed] [Google Scholar]
- 15. Wang J., Thio S. S. C., Yang S. S. H., et al., “Splice Variant Specific Modulation of CaV1.2 Calcium Channel by Galectin‐1 Regulates Arterial Constriction,” Circulation Research 109, no. 11 (November 2011): 1250–1258. [DOI] [PubMed] [Google Scholar]
- 16. Wan J., Yamamura A., Zimnicka A. M., et al., “Chronic Hypoxia Selectively Enhances L‐ and T‐Type Voltage‐Dependent Ca2+ Channel Activity in Pulmonary Artery by Upregulating Cav1.2 and Cav3.2,” American Journal of Physiology—Lung Cellular and Molecular Physiology 305, no. 2 (July 2013): L154–L164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Guo D., Gu J., Jiang H., Ahmed A., Zhang Z., and Gu Y., “Inhibition of Pyruvate Kinase M2 by Reactive Oxygen Species Contributes to the Development of Pulmonary Arterial Hypertension,” Journal of Molecular and Cellular Cardiology 91 (February 2016): 179–187. [DOI] [PubMed] [Google Scholar]
- 18. Huang Z., “Effect of T‐Type Calcium Channel Inhibitorson MCT‐Induced Pulmonary Arterial Hypertension in Rats” (master's Thesis, Shanghai JiaoTong University, August 2019).
- 19. Li L., Wan G., Han B., and Zhang Z., “Echinacoside Alleviated Lps‐Induced Cell Apoptosis and Inflammation in Rat Intestine Epithelial Cells by Inhibiting the mTOR/STAT3 Pathway,” Biomedicine & Pharmacotherapy 104 (August 2018): 622–628. [DOI] [PubMed] [Google Scholar]
- 20. Li W., Zhou J., Zhang Y., et al., “Echinacoside Exerts Anti‐Tumor Activity via the miR‐503‐3p/TGF‐β1/Smad Aixs in Liver Cancer,” Cancer Cell International 21, no. 1 (June 2021): 304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Liu J., Tang N., Liu N., Lei P., and Wang F., “Echinacoside Inhibits the Proliferation, Migration, Invasion and Angiogenesis of Ovarian Cancer Cells Through PI3K/AKT Pathway,” Journal of Molecular Histology 53, no. 2 (April 2022): 493–502. [DOI] [PubMed] [Google Scholar]
- 22. Wei W., Lan X., Liu N., et al., “Echinacoside Alleviates Hypoxic‐Ischemic Brain Injury in Neonatal Rat by Enhancing Antioxidant Capacity and Inhibiting Apoptosis,” Neurochemical Research 44, no. 7 (July 2019): 1582–1592. [DOI] [PubMed] [Google Scholar]
- 23. Wu Y., Yang Q., Wang D., et al., “A Comparative Study of Echinacoside, Oleuropein Content and Antioxidant Properties of Different Solvent Extracts From Syringa pubescens Turcz,” Pakistan Journal of Pharmaceutical Sciences 35, no. 1 (January 2022): 35–40. [PubMed] [Google Scholar]
- 24. Zhang Y., Fan L., and Wang M., “Echinacoside Ameliorates Bleomycin‐Induced Idiopathic Pulmonary Fibrosis by Regulating Macrophage Polarization,” Journal of Molecular Histology 57, no. 1 (November 2025): 4. [DOI] [PubMed] [Google Scholar]
- 25. Zhou Q. Y., Zhou J., Li Z. B., et al., “Echinacoside Suppresses Macrophage Lipid Accumulation and Attenuates Atherosclerosis via the MDM2/PPARγ/ABCA1 Signaling Axis,” Biochim Biophys Acta (BBA)—Molecular and Cell Biology of Lipids 1870, no. 7 (October 2025): 159681. [DOI] [PubMed] [Google Scholar]
- 26. Gai X. Y., Tang F., Ma J., et al., “Antiproliferative Effect of Echinacoside on Rat Pulmonary Artery Smooth Muscle Cells Under Hypoxia,” Journal of Pharmacological Sciences 126, no. 2 (2014): 155–163. [DOI] [PubMed] [Google Scholar]
- 27. Zhao E., Wang J., Zhao Y., et al., “Echinacoside Inhibits PASMCs Calcium Overload to Prevent Hypoxic Pulmonary Artery Remodeling by Regulating TRPC1/4/6 and Calmodulin,” Open Medicine 19, no. 1 (2024): 20241044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Gai X., Wei Y., Zhang W., et al., “Echinacoside Induces Rat Pulmonary Artery Vasorelaxation by Opening the NO‐cGMP‐PKG‐BKCa Channels and Reducing Intracellular Ca2+ Levels,” Acta Pharmacologica Sinica 36, no. 5 (May 2015): 587–596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Gai X., Lin P., He Y., et al., “Echinacoside Prevents Hypoxic Pulmonary Hypertension by Regulating the Pulmonary Artery Function,” Journal of Pharmacological Sciences 144, no. 4 (December 2020): 237–244. [DOI] [PubMed] [Google Scholar]
- 30. Huang N., Zhu T. T., Liu T., et al., “Aspirin Ameliorates Pulmonary Vascular Remodeling in Pulmonary Hypertension by Dampening Endothelial‐to‐Mesenchymal Transition,” European Journal of Pharmacology 908 (October 2021): 174307. [DOI] [PubMed] [Google Scholar]
- 31. Redondo S., Santos‐Gallego C. G., Ganado P., et al., “Acetylsalicylic Acid Inhibits Cell Proliferation by Involving Transforming Growth Factor‐β,” Circulation 107, no. 4 (February 2003): 626–629. [DOI] [PubMed] [Google Scholar]
- 32. Gai X. Y., Zhao E. Q., Wang J. Y., et al., “Progress in Research on Hypoxia‐Induced Disruption of Calcium Homeostasis in Pulmonary Arterial Smooth Muscle Cells and Pharmacological Intervention,” Chinese Pharmacological Bulletin 38, no. 4 (2022): 492–496. [Google Scholar]
- 33. Sheokand A., Koli D., Wadhwa K., Sharma G., Pahwa R., and Tuli H. S., “Mechanistic Insights Into the Anticancer Potential of Echinacoside: Therapeutic Applications and Future Directions,” Archiv der Pharmazie 358, no. 11 (2025): e70153. [DOI] [PubMed] [Google Scholar]
- 34. Lei W., Chen M., Huang Z., et al., “Salidroside Protects Pulmonary Artery Endothelial Cells Against Hypoxia‐Induced Apoptosis via the AhR/NF‐κB and Nrf2/HO‐1 Pathways,” Phytomedicine 128 (June 2024): 155376. [DOI] [PubMed] [Google Scholar]
- 35. Zhang C., Sun Y., Guo Y., Xu J., and Zhao H., “JMJD1C Promotes Smooth Muscle Cell Proliferation by Activating Glycolysis in Pulmonary Arterial Hypertension,” Cell Death Discovery 9, no. 1 (March 2023): 98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Siafaka P. I., Özcan Bülbül E., Miliotou A. N., Karantas I. D., Okur M. E., and Üstündağ Okur N., “Nano‐Based Carriers for Pulmonary Drug Delivery: A Review on the Available Drug Delivery Applications and Toxicity Issues,” Journal of Drug Delivery Science and Technology 92 (February 2024): 105381. [Google Scholar]
- 37. Nogueira‐Ferreira R., Vitorino R., Ferreira R., and Henriques‐Coelho T., “Exploring the Monocrotaline Animal Model for the Study of Pulmonary Arterial Hypertension: A Network Approach,” Pulmonary Pharmacology & Therapeutics 35 (December 2015): 8–16. [DOI] [PubMed] [Google Scholar]
- 38. Schultze A. E. and Roth R. A., “Chronic Pulmonary Hypertension—The Monocrotaline Model and Involvement of the Hemostatic System,” Journal of Toxicology and Environmental Health, Part B 1, no. 4 (1998): 271–346. [DOI] [PubMed] [Google Scholar]
- 39. Kazimierczyk R. and Kamiński K., “The Role of Platelets in the Development and Progression of Pulmonary Arterial Hypertension,” Advances in Medical Sciences 63, no. 2 (September 2018): 312–316. [DOI] [PubMed] [Google Scholar]
- 40. Séverin S., Ghevaert C., and Mazharian A., “The Mitogen‐Activated Protein Kinase Signaling Pathways: Role in Megakaryocyte Differentiation,” Journal of Thrombosis and Haemostasis 8, no. 1 (January 2010): 17–26. [DOI] [PubMed] [Google Scholar]
- 41. Hambleton M., Hahn H., Pleger S. T., et al., “Pharmacological‐ and Gene Therapy‐Based Inhibition of Protein Kinase Cα/β Enhances Cardiac Contractility and Attenuates Heart Failure,” Circulation 114, no. 6 (August 2006): 574–582. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Tian H., Liu L., Wu Y., et al., “Resistin‐Like Molecule β Acts as a Mitogenic Factor in Hypoxic Pulmonary Hypertension via the Ca2+‐Dependent PI3K/Akt/mTOR and PKC/MAPK Signaling Pathways,” Respiratory Research 22, no. 1 (January 2021): 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data sets in the study are not publicly available, but may be obtained from the corresponding author upon reasonable request.
