Molecular mechanism of ethylene signaling response gene VcERF061 to promote anthocyanin synthesis in blueberry (Vaccinium corymbosum)

Abstract

Background

Blueberries are rich in anthocyanins, which have antioxidant properties. Anthocyanin content is an important indicator for evaluating blueberry quality. The mechanism of anthocyanin synthesis requires further clarification for blueberry breeding and cultivation regulation.

Results

This study mined the blueberry ERF gene family based on single-molecule real-time (SMRT) and Illumina transcriptome sequencing results, and further explored the gene function of VcERF061. In this study, a transient injection experiment was conducted on blueberry leaves and fruits. Compared to the control, the injection sites of leaves and fruits overexpressing VcERF061 showed significant anthocyanin accumulation. Similarly, in the blueberry transgenic adventitious shoot experiment, the anthocyanin content in the blueberry shoots and lateral buds of adventitious buds overexpressing the VcERF061 gene was significantly higher than that of transgenic adventitious shoots transformed with the empty vector, and a significant increase in the expression of VcMYB1, VcF3'5'H, VcDFR, VcANS, and VcUFGT. We then speculated whether VcERF061 interacts with structural genes to activate the expression of the structural gene VcANS promoter and promote anthocyanin synthesis. Unfortunately, after conducting a Y1H assay, we found that VcERF061 did not bind to the VcANS promoter, and there was no interaction between the two. Exogenous abscisic acid (ABA) and ethephon (ETH) treatment of blueberry fruit upregulated VcERF061 expression. Our previous study verified that VcMYB1 promotes the accumulation of blueberry anthocyanins, therefore, this study also analyzed VcMYB1 expression in ABA- and ETH-treated blueberry fruit, and found that the expression of VcMYB1 was also up-regulated in ABA- and ETH-treated blueberry fruits. The expression of VcMYB1 and VcERF061 were both up-regulated in ABA- and ETH-treated blueberry fruits, and both reached the maximum proportion after 12 h of treatment. The yeast two-hybrid (Y2H) experiment showed that VcMYB1 and VcERF061 did not interact with each other at the protein–protein level, but yeast one-hybrid (Y1H) experiment and tobacco leaf transient injection experiment demonstrated that VcMYB1 transcription factor can bind to the promoter sequence of VcERF061 and promote the expression of the VcERF061 gene.

Conclusion

In this study, we found that VcERF061 promoted blueberry anthocyanin accumulation, but did not directly bind to the promoters of structural genes such as VcANS. Both VcMYB1 and VcERF061 genes responded to exogenous ABA and ETH signals and exhibited similar expression patterns. There was an interaction between VcMYB1 and VcERF061. The findings of this study enrich the regulatory network of anthocyanin synthesis in plants and provide theoretical support for blueberry quality improvement.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12870-025-07712-2.

Introduction

Blueberry (Vaccinium corymbosum) is a deciduous or evergreen woody plant of the genus Vaccinium in the family Ericaceae. It is usually divided into 21 groups, with about 450 species [1]. Blueberries are rich in anthocyanins, which have antioxidant properties, and blueberry is one of the top five healthy fruits recommended by the World Food and Agriculture Organization. Studies have shown that the richer the anthocyanin content of blueberry, the stronger its antioxidant capacity and the stronger its market competitiveness [2]. Therefore, cultivating new varieties rich in anthocyanins has become a market necessity.

Anthocyanidins are glycosylated polyphenolic, water-soluble plant pigments that constitute an important class of plant flavonoid compounds that give plants diverse colors and are widely found in the flowers, fruit, leaves, stems, and seeds of plants [3]. The basic structure of anthocyanidins is 3,5,7-hydroxy-2-phenylbenzopyran, and the pigments can be form six categories according to their structure, namely pelargonidin, cyanidin, peonidin, delphinidin, petunidin, and malyidin [4]. In plants, anthocyanidins have a variety of biological functions. Their different colors make plants more ornamental and facilitate reproduction [5]. Anthocyanidins enhance biological functions, such as plant resilience, UV resistance, and free radical scavenging, and resistance to a variety of biotic and abiotic stressors [6, 7]. In addition, anthocyanidins have an antioxidant ability and important medical value due to their cancer prevention, anti-aging, cardiovascular disease prevention, and blood lipid-lowering effects [8–11].

Synthesis, transport and accumulation of anthocyanins are specifically and synergistically regulated by multiple transcription factors [12, 13]. The APETALA2/ETHYLENE RESPONSIVE FACTOR (AP2/ERF) transcription factor family is unique to plants and constitutes one of the largest families of transcription factors in plants. Members of the AP2/ERF superfamily contain a common DNA-binding domain, the AP2 domain. Depending on the AP2 domain copy number differences, AP2/ERFs are usually divided into four families: AP2, ERF, RAV, and Soloist [14, 15]. Most AP2/ERF proteins bind to GCC-box containing promoters, but the degree of activation of members in different groups varies [16]. The ethylene response factor (ERF) family is an important member of the AP2/ERF superfamily that is characterized by a single AP2 structural domain and contains the ERF and CBF/DREB subfamilies [14, 17]. The CBF/DREB subfamily mainly binds DRE/CRT (A/GCCGAC) elements in response to abiotic stress [18]. The ERF subfamily mainly binds to GCC-box (AGCCGCC) components in response to abiotic stress [19, 20]. In addition to binding to GCC-box containing promoters, ERF proteins can also bind to VWRE-box (GAAATTTC) and CE1-box (CACCG) in tobacco [21, 22]. ERF plays an important role in plant growth and is involved in regulating plant responses to hormones, abiotic and biotic stress, fruit ripening, and anthocyanin synthesis [23–28]. MYB1 is known to play a key role in the regulation of the phycocyanin synthesis pathway [29, 30]. ERF transcription factors can interact with MBY transcription factors to co-regulate phycocyanin synthesis. In apple, MdERF78 interacts with the MdMYB1 protein and enhances the transcriptional activity of MdMYB1 on the MdDFR, MdUFGT, and MdGSTF12 promoters. MYB plays an active role in anthocyanin accumulation induced by ALA (5-aminolevulinic acid) [31]. MdERF1B interacts with the MdMYB9 and MdMYB11 proteins and is able to activate the promoters of MdMYB9 and MdMYB11. In a previous study, the anthocyanin content in apple callus overexpressing MdERF1B was significantly increased [32]. A previous work showed that MdERF38 interacts with the MdMYB1 protein, a positive regulator of anthocyanin biosynthesis, to activate the transcriptional activity of MdMYB1 [26]. This promotes the binding of MdMYB1 to the MdDFR and MdUF3GT promoters, which ultimately accelerates apple anthocyanin accumulation [26]. In addition, MdMYB1 binds to the MdERF3 promoter to activate MdERF3 transcription, thereby accelerating anthocyanin biosynthesis [33]. In pear, Pp4ERF24 and Pp12ERF96 interact with PpMYB114 proteins, enhancing the activation of PpMYB114 on the PpUFGT promoter and inducing the accumulation of anthocyanins in red date pear [34].

ABA is a phytohormone essential in a variety of plant growth and development processes, such as anthocyanin biosynthesis and fruit ripening [35]. ABA plays a crucial role in fruit ripening and anthocyanin biosynthesis in non-climacteric fruit [36], including blueberry. During the fruit development of Vaccinium vitisidaea Linn., the expression of structural genes in the anthocyanin synthesis pathway was upregulated with an increase in the ABA level in the fruit [37]. Ethylene (ET) is an important hormone for plant growth, development, senescence, and stress resistance [16]. It is indispensable for color regulation during fruit ripening and developments and regulates anthocyanin biosynthesis in a variety of plants, including grapes, orchids, and blueberries [38–40]. Among these, some ERF transcription factors play an important role in ethylene-regulated anthocyanin synthesis. In recent years, some reports of ethylene promoting fruit anthocyanin accumulation in apple have helped researchers explore the mechanism of ERF transcription factors regulating fruit anthocyanin synthesis in response to ethylene signaling. The transcription of the ethylene-responsive factor MdERF3 enhances ethylene-mediated anthocyanin accumulation and apple fruit coloration [33]. Ethylene promotes the binding of MdERF1B to the MdMYC2 promoter by increasing the transcriptional activity of MdERF1B. This approach enhances MdMYC2 expression, which in turn activates anthocyanin structural gene transcription and promotes anthocyanin accumulation [41]. In addition, MdERF1B can interact with MdMYB9 and MdMYB11 proteins to promote anthocyanin biosynthesis [32]. Ethylene treatment of ‘Zijin’ mulberry fruit promoted the strong expression of the ERF5 gene and achieved positive regulation of anthocyanin accumulation [42]. In contrast, ethylene-induced PpERF105 inhibits anthocyanin biosynthesis in pear by activating the transcription of the negatively regulated transcription factor PpMYB140 [43]. Ethylene can also directly inhibit the expression of PpMYB10 and PpMYB114 through the transcription factor ERF, which ultimately inhibits anthocyanin biosynthesis in red pear [44].

Blueberry fruit is now the fastest growing fruit industry in the world because it is rich in anthocyanins and other nutritional and health components. As the main quality trait, the anthocyanin content of blueberry directly affects its economic value. However, no effective functional genes or molecular markers have been identified for the molecular-assisted breeding and quality improvement of blueberry anthocyanin content. ABA and ET can promote anthocyanin accumulation in blueberry fruit during ripening. In addition, ERFs can interact with MYB genes, which are key transcription factors that regulate anthocyanin synthesis and co-regulate anthocyanin biosynthesis in plants. We validated that VcMYB1 is the key gene that promotes anthocyanin synthesis in blueberry [45]. However, the molecular mechanism of the ERF transcription factor in blueberry that promotes anthocyanin synthesis has not been reported. Therefore, this study investigated ERF transcription factors that promote anthocyanin synthesis in blueberry. In addition, this work verified the interaction between VcERF061 and the structural gene VcANS, and explored the interaction and regulatory mode between VcERF061 and VcMYB1. The findings of this study will further enrich the plant anthocyanin synthesis network and provide theoretical support for the study of the metabolic mechanism of blueberry anthocyanin synthesis and quality improvement.

Materials and methods

Plant materials

Experimental procedures were carried out at the Research Institute of Pomology, Chinese Academy of Agricultural Sciences (Xingcheng, Liaoning, China) during the period spanning May 2021 to January 2023. The primary experimental plant material consisted of nine-year-old Vaccinium corymbosum 'Duke' specimens cultivated in the southern greenhouse facility of the Research Institute of Pomology of CAAS. The fruits harvested from apical inflorescence positions (earliest ripening) were immediately flash-frozen in liquid nitrogen and then stored at −80 ℃. Fruit sampling was performed at five developmental phases post-anthesis: 30 days (small green fruit), 40 days (green fruit), 55 days (color transition stage), 65 days (pink fruit), and 80 days (mature blue fruit). 200 mg·L⁻¹ of ABA and ETH were applied to soak blueberry fruits at the transchromic stage (60 days after flowering) for 1 min by Tang et al. [45] and Wang et al. [46], and then blueberry fruits were collected at 0, 6, 12, 18, and 24 h. Controls were blueberry fruit treated with ddH₂O. In vitro-cultured seedlings (V. corymbosum 'Legacy') were maintained in sterile histoculture vessels under controlled conditions: histoplasma seedlings subcultured every 30 days versus transgenic seedlings lines every 20 days at 24 °C with a photoperiod of 16 h light and 8 h dark. Tobacco (Nicotiana tabacum) utilized for transient expression experiments was grown in a cycle of 16 h-light-26 °C/8 h-dark-20 °C.

Gene sequence cloning of VcERF061

RNA was extracted from mature blue fruits 80 days after flowering using a plant RNA extraction kit (TaKaRa, Beijing, China, No. 9769S), and primers were designed based on the blueberry gene sequence fragments obtained from the sequencing of the lllumina and SMRT transcriptomes (See Supplementary Table 1, Additional File 1, the same below) [45], followed by reverse transcription using a reverse transcription kit (TaKaRa, Shiga, Japan) to obtain double-stranded cDNAs, which were subjected to polymerase chain reaction (PCR) amplification.

Cloning of promoter sequences of VcMYB1 and VcERF061

The upstream primers of VcMYB1 and VcERF061 were designed according to the promoter sequences of evergreen blueberry genome summarised by Yu et al. [47]. Primers of 2000 bp and 1000 bp were designed upstream of the start codon of VcMYB1 and VcERF061, respectively, and the open reading frames (ORFs) of VcMYB1 and VcERF061 were used to design the downstream primers. Blueberry fruit (V. corymbosum ‘Duke’) DNA extracted with DNA extraction kit (TaKaRa, Beijing, China, No. 9768 S) was used as the template for cloning the promoter sequences of VcMYB1 and VcERF061, and the promoter fragments of VcMYB1 and VcERF061 with lengths of 2009 and 1987 bp were finally cloned.

Quantitative real-time fluorescence PCR analysis (qRT-PCR)

Plant tissue RNA was isolated using the Total RNA Extraction Kit (TaKaRa, Beijing, China, No. 9769S). A reverse transcription kit (TaKaRa, Shiga, Japan) was used to synthesize double-stranded cDNA. qRT-PCR templates were made using the synthesized double-stranded cDNAs in compliance with the reference manual of 2 × Q3 SYBR qPCR Master Mix (Universal) (Tolo Biotech, Shanghai, China, No. 22204) for specific experimental manipulations. For each sample assay, three biological replicates and technical replicates were evaluated. VcGADPH was used as an internal reference gene for the blueberry plant material. NtACTIN was used as an internal reference gene for the tobacco plant material.

Amino acid sequence analysis and phylogenetic tree construction

Molecular Evolutionary Genetics Analysis (MEGAX64) software was used to construct the phylogenetic tree. The ERF061 protein sequence used for phylogenetic analysis was downloaded from the National Center for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov/). The ERF061 protein sequence was structurally analyzed using the Simple Module Architecture Research Tool (SMART) website (http://smart.emblheidelberg.de/) to clarify the amino acid secondary structure domains of VcERF061.

Genetic transformation of VcERF061 in blueberry

First, the blueberry genetic transformation system used in the study was constructed by referring to the transformation method of Song and Sink [48], in which the ORFs of VcERF061 were ligated into the pRI101-AN vector to form an overexpression vector of pRI101-VcERF061, and the recombinant and control vectors (containing an empty pRI101-AN) were then transformed into Agrobacterium tumefaciens EHA105. Blueberry leaves were infiltrated by transient injection, and the leaves were cultured on WPM medium containing 15 mg L⁻¹ kanamycin and 4 mg L⁻¹ trans-zeatin for 3 d. Blueberry adventitious buds about two centimeters were subjected to a four-week succession cycle and Agrobacterium-mediated screening. Positive adventitious shoots with anthocyanin accumulation were screened using WPM medium containing 50 mg L⁻¹ kanamycin and 4 mg L⁻¹ trans-zeatin. Finally, the DNA of positive indeterminate shoots was extracted for PCR amplification, and the amplified products were verified by gel electrophoresis. Three biological replicates were set up, named 35S: VcERF061#1, 35S: VcERF061#2 and 35S: VcERF061#3.

Tobacco transient transformation induced anthocyanin synthesis

Overexpression vectors for pRI101-VcERF061 and pRI101-VcMYB1 were constructed and transformed into Agrobacterium tumefaciens EHA105. Two recombinant plasmids were injected jointly or separately into the abaxial surface of tobacco leaves, with reference to the method of Espley et al. [49]. At least five leaves of the same tobacco plant were injected for each treatment. To control for differences between plants, at least six plants were injected, each containing a negative control of the pRI101 empty vector. Leaves were observed and photographed 4–7 days after injection. To ensure the accuracy of the experiment, three biological replicates were set up as above.

Determination of anthocyanin content

The plant material was ground in liquid nitrogen, weighed and the anthocyanin extract was added with 1% (v/v) HCl-methanol, the total volume of extract for each sample was 5 ml. The extracts were allowed to stand for 4 h at room temperature in an airtight, dark environment. The absorbance of the extracts from the samples was recorded at 530, 620, and 650 nm utilizing a spectrophotometer (Soptop, Shanghai, China). The optical density as well as the content of anthocyanins was calculated as follows:

Blueberry injection experiment

Agrobacterium tumefaciens EHA105 containing two recombinant plasmids, pRI101-VcERF061 and pRI101-VcMYB1, were transformed and injected jointly or separately into the abaxial surfaces of blueberry fruits or leaves according to the injection experiments method of Li et al. [50] and Tang et al. [45]. To minimize errors, plants with the consistent growth were selected 60 days after flowering, 60 blueberry fruits or leaves per plant were selected for injection. The negative control was an injection of Agrobacterium tumefaciens containing the pRI101-An empty vector. There were three biological replicates for each treatment, and the 60 injected fruits or leaves were one biological replicate. Fruits or leaves with anthocyanin accumulation at the injection sites were sampled and anthocyanin content was determined.

Yeast single hybrid (Y1H) test

The core elements in the promoter fragments of VcERF061, VcANS, and VcMYB1 were predicted using the Plant CARE website (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) and the PlantTFDB website (http://planttfdb.gao-lab.org/). A G-box binding site responsive to ABA signals was identified at position −298 bp in the VcANS promoter sequence.. The VcANS promoter sequence was then cloned into the pAbAi vector. Subsequently, the yeast strain Y1HGold was co-transformed with this recombinant vector (Y1HGold-pAbAi-VcANSpro) using the PEG/LiAc method. The full-length VcERF061 was inserted into the pGADT7 vector. pGADT7-VcERF061 was cotransformed with Y1HGold-pAbAi- VcANS pro. A VcMYB1 recognition site −5'CTGTTG3'- was found at the −240 bp position of the VcERF061 promoter sequence. Extending 10 bp each before and after the recognition site, a sequence of 26 bp in length was finally synthesized, namely −5'CTCTTTTCGACTGTTGCTCTTATCTT3'-. This promoter core element was cloned into the pAbAi vector, yielding Y1HGold-pAbAi-VcERF061pro. The full-length VcMYB1 coding sequence was cloned into the pGADT7 vector to generate pGADT7-VcMYB1. pGADT7-VcMYB1 was cotransformed with Y1HGold-pAbAi-VcERF061 pro. Yeast cells were screened for the positive plasmid in SD/-Ura medium, and a positive plasmid was detected using the Insert Check Mix1 (TaKaRa. Beijing, China, No. 630496) for yeast colony PCR for further confirmation. The empty pGADT7 vector served as a negative control. Selective cultures were performed on SD/-Leu medium containing the optimal concentration of Aureobasidin A to assess potential interactions between VcERF061 and VcANS, as well as between VcERF061 and VcMYB1.

Firefly luciferase complementation assay

The promoter sequence 1000 bp upstream of the ATG of VcERF061 was fused to the pGreenII0800-LUC vector to generate the reporter vector VcERF061pro:Luc. The ORF of VcMYB1 was also fused to the pRI 101-AN vector to form an effector. The reporter vector and effector were cotransformed into Agrobacterium tumefaciens EHA105 and transiently injected into tobacco leaves. After 2 d of injection, tobacco leaves were first sprayed with 100 mM sodium fluorescein salt and then left in a dark environment for 10 min. LUC images were acquired using a charge-coupled device imager (NightOWL LB983) and Indigo software. Dual luciferase reporter gene detection was performed using the Dual Luciferase Reporter Gene Detection Kit (Beijing Beyotime Biotechnology Co., Ltd.). Chemiluminescence was detected using a Molecular Devices (SpectraMAX L) instrument.

GUS activity analysis

The promoter sequence 1000 bp upstream of the ATG of VcERF061 was inserted upstream of the GUS reporter gene of the pCAMBIA1301 vector as a reporter vector. The ORF of VcMYB1 was recombined with the pRI 101-AN vector to form pRI 101- VcMYB1 as effector. The reporter gene and effector were transformed into Agrobacterium tumefaciens EHA105 and transiently injected into the back of 1-month-old tobacco. After injection, the leaves were incubated in a growth chamber for 48–72 h. Infected leaves were soaked with the chromogenic substrate X-gluc. The expression levels and expression patterns of GUS were characterized using histochemical staining.

Statistical analyses

Three independent biological replicates were performed for each treatment. Differences in gene expression levels and anthocyanin content between control and treatment groups were analyzed by using one-way analysis of variance (ANOVA) using SPSS Statistics 26.0 (SPSS Inc., Chicago, IL, USA). Significant differences were subsequently assessed by Duncan's test at p ≤ 0.05. All data are expressed as ± SD.

Results

Gene cloning of VcERF061

It is now generally accepted that ABA is a hormone that plays a major role in fruit ripening and anthocyanin accumulation in non-climacteric plants [35, 36]. However, in recent years, ethylene has also been reported to play an important role. As a non-climacteric plant, the molecular mechanism of the ethylene regulation of blueberry fruit ripening and anthocyanin accumulation is still unclear. Members of the AP2/ERF gene family respond to ethylene signals and promote anthocyanin accumulation. Therefore, this study mined the blueberry ERF gene family based on SMRT and Illumina transcriptome sequencing results [45]. Based on transcriptome data from blueberry fruit at different developmental stages, the FPKM (Fragments Per Kilobase of transcript Per Million mapping reads) values of the ERF transcription factors were 9.16 ± 2.1c, 123.80 ± 4.5a, and 92.28 ± 18.54b in green (45 days after flowering), pink (65 days after flowering), and blue fruit (80 days after flowering), respectively. The FDR (False Discovery Rate) between the green and pink fruit was 5.11E⁻³¹, and the value between the green and blue fruit was 3.28E⁻⁷. The log2FC value between the green and pink fruit was 3.98, and the value between the green and blue fruit was 3.61. The expression of this transcription factor appeared significantly upregulated in pink and blue fruit. Its expression trend was consistent with the trend of anthocyanin accumulation in blueberry fruit (Fig. 1A). Based on the qRT-PCR analyses, VcERF061 expression was also significantly upregulated in pink and blue fruit (Fig. 1B). This gene was cloned using cDNA from mature blueberry fruit as a template, and a gene sequence 858 bp long, encoding 285 amino acids, with a molecular weight of 31.602 kD, was obtained. The AP2/ERF protein sequences of Arabidopsis were used to construct a phylogenetic tree with the target gene. The results revealed that the target gene had a high homology with AT1G64380 (ERF61) (Fig. 1C). The SMART website was used for structural analysis of its protein sequence, and this gene contained only one AP2 structural domain that belonged to the ERF subfamily. Sequence comparison using NCBI reveled that it also had a high homology with ERF061 in other plants; thus, it was named VcERF061 (Fig. 1D). The gene accession number of VcERF061 is OQ851108.1.

Fig. 1.

Gene cloning and sequence alignment of VcERF061. A Blueberry fruits at 30 (s-green fruit), 40 (green fruit), 65 (pink fruit) and 80 (blue fruit) days after flowering. B Analysis of VcERF061 expression in blueberry fruits at different developmental stages. C Phylogenetic analysis of VcERF061 and Arabidopsis ERF family protein sequences. VcERF061 is denoted by the red five-pointed star. Arabidopsis ERF protein sequences obtained from the Tair (https://www.arabidopsis.org/about/index.jsp). D Comparative analysis of protein sequences of ERF061 of Camellia sinensis, Camellia lanceoleosa, Populus euphratica, V. corymbosum 'Duke' and Arabidopsis. These sequences were downloaded from NCBI. CsERF061: XP_028115442.1; ClERF061: KAI7995290.1, PeERF061: XP_011026904.1, AtERF061: AT1G64380.1. Bars and error bars indicate the mean ± SD from three biological replicates. Different English letters represents that the t-test difference was significant. (p < 0.05)

The VcERF061 promotes anthocyanin accumulation in blueberry

To further explore the gene function of VcERF061, the VcERF061 gene was constructed into the pRI 101-An vector containing a CaMV-35S promoter, and the recombinant vector was transformed into A. tumefaciens for subsequent transient infection assays. Plants infected with A. tumefaciens containing an empty pRI 101-An vector served as the blank control.

First, this study conducted transient infection experiments in tobacco leaves grown for about 1 month. Based on the phenotype of tobacco leaves, anthocyanin accumulation occurred in the injected region. The injected area of transgenic tobacco leaves was sampled, and the expression of the VcERF061 gene was analyzed. However, VcERF061 gene expression was not detected in the blank control (Fig. 2A). Similarly, this study measured anthocyanin content in the colored areas of injected tobacco leaves. Anthocyanin accumulation was consistent with the trend of gene expression. Anthocyanin was detected in the experimental group, and no anthocyanin accumulation was found in the control group (Fig. 2A).

Fig. 2.

Functional analysis of VcERF061 in homologous and heterologous systems. A Transient injection overexpression of (i) pRI 101-An (Control) and (ii) VcERF061-pRI 101-An (35S: VcERF061#1, 35S: VcERF061#2 and 35S: VcERF061#3) in tobacco leaves. Expression analysis of VcERF061 in transgenic tobacco leaves. Anthocyanin content in transgenic tobacco leaves. B Transient overexpression of (i) pRI 101-An (Control) and (ii) VcERF061-pRI 101-An (35S: VcERF061#1, 35S: VcERF061#2 and 35S: VcERF061#3) in blueberry leaves. Expression analysis of VcERF061 in transgenic blueberry leaves. Anthocyanin content in transgenic blueberry leaves. C Transient injection overexpression of (i) pRI 101-An (Control) and (ii) VcERF061-pRI 101-An (35S: VcERF061#1, 35S: VcERF061#2 and 35S: VcERF061#3) in blueberry fruits. Expression analysis of VcERF061 in transgenic blueberry fruits. Anthocyanin content in transgenic blueberry fruits. Bars and error bars indicate the mean ± SD from three biological replicates. Different English letters represents that the t-test difference was significant (p < 0.05)

Then, a transient injection experiment was conducted on blueberry leaves according to the above experimental method. Similarly, anthocyanin accumulation was found in blueberry leaves overexpressing the VcERF061 gene. Based on qRT-PCR analysis, VcERF061 expression was significantly upregulated in blueberry leaves overexpressing VcERF061. Among these, VcERF061 expression in blueberry leaves overexpressing VcERF061 was higher than that in the control blueberry leaves (Fig. 2B). The anthocyanin content of blueberry leaves was subsequently measured in the coloring areas. The anthocyanin content in blueberry leaves overexpressing VcERF061 was approximately 30 times higher than that in the control blueberry leaves (Fig. 2B).

Transient injection experiments were also conducted in blueberry fruit at the color change stage (Fig. 2C). Significant anthocyanin accumulation was also observed in blueberry fruit overexpressing the VcERF061. VcERF061 expression increased sixfold in blueberry fruit overexpressing VcERF061. Anthocyanin content was determined in colored areas of the injection site of blueberry fruit and the highest anthocyanin accumulation was about 2793.48 nmol/g. Both values were significantly higher than those in the control.

To further increase the reliability of the results, a genetic transformation system for blueberry was constructed, and the overexpression of VcERF061-positive adventitious buds was successfully performed (Fig. 3A, B and C). A large amount of anthocyanin accumulation was observed in the blueberry shoots and lateral buds of adventitious buds overexpressing VcERF061 (Fig. 3B, C). Similarly, the expression of VcERF061, VcMYB1, VcF3′5'H, VcDFR, VcANS and VcUFGT were significantly higher in positive adventitious shoots than in the control (Fig. 3D). The anthocyanin content in the positive adventitious shoots was higher than that of the control, showing significant upregulation (Fig. 3E).

Fig. 3.

Functional analysis of VcERF061 in blueberry adventitious buds. A Blueberry adventitious shoots genetic transformation gel electrophoresis. B Overexpression of (i) pRI-101-An (Control) and (ii) VcERF061-pRI-101-An (35S: VcERF061#1, 35S: VcERF061#2 and 35S: VcERF061#3) in blueberry shoots. C Overexpression of (i) pRI-101-An (Control) and (ii) VcERF061-pRI-101-An (35S: VcERF061#1, 35S: VcERF061#2 and 35S: VcERF061#3) in blueberry adventitious buds. D Expression analysis of VcERF061, VcMYB1, VcF3'5'H, VcDFR, VcANS and VcUFGT in adventitious buds. E Anthocyanin content in blueberry adventitious buds. Bars and error bars indicate the mean ± SD from three biological replicates. Different English letters represents that the t-test difference was significant (p < 0.05)

Based on the above homologous and heterologous expression results, it can be directly concluded that overexpression of the VcERF061 gene promotes anthocyanin accumulation in blueberry. VcERF061 overexpression could increase the anthocyanin content in blueberry fruit.

VcERF061 did not bind to the VcANS promoter

Through validation of the biological function of VcERF061, it was found that VcERF061 promoted anthocyanin synthesis in both heterologous and homologous systems. Additionally, qRT-PCR analysis of structural genes revealed an increase in their expression levels. Therefore, we speculated that VcERF061 interacts with the promoters of structural genes to activate their expression, thereby regulating anthocyanin synthesis. We analyzed the promoter of VcANS and found a G-box binding site responsive to ABA signals at the −298 bp position. Subsequently, we conducted a yeast one-hybrid (Y1H) assay to validate the interaction between the VcERF061 and VcANS. Y1H Gold yeast strains co-transformed with pAbAi-VcANS and pGADT7-VcERF061 recombinant vectors failed to grow normally on SD/-Leu medium supplemented with 300 ng/ml Aureobasidin A (Fig. 4). Therefore, VcERF061 did not bind to the VcANS promoter.

Fig. 4.

Y1H assay to validate the interaction between VcERF061 and VcANS. The full-length VcERF061 was cloned into the pGADT7 vector, and the VcANS promoter sequence was cloned into the pAbAi vector. AbA (Aureobasidin A) is a growth inhibitor of yeast cells and was used as a screening marker. The screening concentration for AbA was 300 ng/ml. The empty vectors pGADT7 and pAbAi-VcANS were used as a negative control

Exogenous ABA and ETH treatment of blueberry fruit promoted VcERF061 and VcMYB1 expression

The ERF transcription factor, as an ethylene signal response factor, can respond to ethylene signals, thereby regulating ripening and anthocyanin accumulation in climacteric fruit. In recent years, it has also been reported that ERF transcription factors can respond to ABA signaling. In addition, non-climacteric plants can be regulated by ethylene to promote fruit ripening and anthocyanin accumulation. In this general context, this work used 200 mg·L⁻¹ of ABA and ETH to treat blueberries at the color change stage, with ddH₂O-treated blueberry fruit as a control. Blueberry fruit was collected at 0, 6, 12, 18, and 24 h (Fig. 5A). RNA was extracted from blueberry fruit, and qRT-PCR analysis was performed. Analysis of the expression ratio of VcERF061 (treatment group/control group) revealed that both ABA and ETH treatments significantly induced gene expression. The increase in expression levels peaked at 12 h post-treatment, rising by 7.16-fold and eightfold respectively (Fig. 5B).

Fig. 5.

ABA and ETH treatment of blueberry fruit. A Blueberry fruits at 0 h,6 h,12 h,18 h,24 h after 200 mg·L⁻¹ ABA, 200 mg·L⁻¹ ETH and ddH₂O soaked blueberry for one minute. B Expression analysis of VcERF061 in ABA- and ETH-treated blueberry fruits. The vertical coordinate represents the ratio of VcERF061 expression in ABA- and ETH-treated to VcERF061 expression in ddH₂O-treated. C Expression analysis of VcMYB1 in ABA- and ETH-treated blueberry fruits. The vertical coordinate represents the ratio of VcMYB1 expression in ABA- and ETH-treated to VcMYB1 expression in ddH₂O-treated. Bars and error bars indicate the mean ± SD from three biological replicates

The MYB gene family plays an important regulatory role in plant anthocyanin synthesis. Our previous study verified that VcMYB1 promotes anthocyanin accumulation in blueberry. Therefore, this study also analyzed VcMYB1 expression in ABA- and ETH-treated blueberry fruit. VcMYB1 expression in ABA- and ETH-treated blueberry fruit had the maximum ratio at 12 h, exhibiting expression trends similar to VcERF061, with expression increasing by 6.53-fold and 5.41-fold, respectively (Fig. 5C).

In summary, both the VcMYB1 and VcERF061 genes responded to exogenous ABA and ETH signals and had the same gene expression trends. Therefore, we speculate that there is a reciprocal relationship between the VcMYB1 and VcERF061 genes that jointly promote anthocyanin synthesis in blueberry.

VcMYB1 and VcERF061 interaction

Both VcMYB1 and VcERF061 promoted blueberry anthocyanin accumulation, and both responded to ABA and ETH signals. Therefore, this study explored the possibility of a reciprocal relationship between these genes. This possibility was investigated at the protein–protein level. The yeast two-hybrid (Y2H) experiment showed that VcMYB1 and VcERF061 did not interact with each other at the protein–protein level.

This study also explored the relationship between VcMYB1 and VcERF061 at the DNA–protein level. We named the VcMYB1 recognition site 5'-CTGTTG-3' found on the VcERF061 promoter sequence as VcERF061-1 (Fig. 6A).

Fig. 6.

VcMYB1 can directly bind to and activate the VcERF061 promoter. A Y1H analysis showed that VcMYB1 can bind to VcERF061 promoter fragments that contain the −5 ‘CTGTTG3’- motif. AbA (Aureobasidin A) is a growth inhibitor of yeast cells and was used as a screening marker. The screening concentration for AbA was 100 ng/ml. The empty vector and the contained −5’ CTCTTTTCGACTGTTGCTCTTATCTT3’-motif VcERF061 promoter sequence were used as a negative control. B GUS activity analysis showed that VcMYB1 can activate VcERF061 promoter activity in tobacco (N. benthamiana) leaves. VcMYB1 effector vector and a reporter vector containing the VcERF061 promoter sequence −5’ CTCTTTTCGACTGTTGCTCTTATCTT3’-were co-injected into wild-type tobacco leaves to analysis their effects on GUS activity(i). The empty vector and a reporter vector contained VcERF061 promoter sequence −5’ CTCTTTTCGACTGTTGCTCTTATCTT3’-motif were used as a negative control (ii) (C) Firefly luciferase complementation assay analysis showed that VcMYB1 can activate VcERF061 promoter activity in tobacco (N. benthamiana) leaves. (i) VcERF061pro:Luc + 35Spro:empty, (ii) VcERF061pro:Luc + 35Spro:VcMYB1. Quantitative analysis of luminescence intensity. The value for a VcERF061pro:Luc was set to 1. The mean ± SE of biological triplicates were taken for every value. Different English letters represents that the t-test difference was significant

A yeast one-hybrid (Y1H) assay was then conducted. Y1H Gold Yeast strains transformed with both pAbAi-VcERF061−1 and pGADT7-VcMYB1 recombinant vectors grew normally on media containing 100 ng/ml Aureobasidin A and lacking Leu (SD/-Leu) (Fig. 6A). A tobacco leaf transient injection experiment was conducted. GUS activity in tobacco leaves was analyzed. Agrobacterium-containing effectors and reporters were simultaneously injected in the tobacco leaves. Tobacco leaves injected with effectors and reporters that did not contain transcription factor VcMYB1 served as controls. Blue color accumulation was observed in tobacco leaves treated with the injection of both effectors and reporters but not in the controls (Fig. 6B). Qualitative and quantitative experiments were performed to determine VcMYB1 transcription factor and VcERF061 promoter interactions using a firefly LUC complementation assay (Fig. 6C). Based on the experimental method, tobacco leaves were co-infested with Agrobacterium containing the VcERF061pro:LUC and 35Spro:VcMYB1 vectors. A fluorescent signal was detected in tobacco leaf after 2 days, while no fluorescent signal was observed in the control (VcERF061pro:LUC + 35Spro:empty). This study also tested for the dual fluorophore enzyme reporter gene using a dual fluorophore enzyme reporter gene assay kit. The ratio of the RLU (relative light unit) values of firefly luciferase to those of sea kidney luciferase was significantly higher than the control values in the case of sea kidney luciferase as an internal reference. Therefore, VcMYB1 bound to the promoter of VcERF061 and thus activated the expression of the VcERF061 gene.

Based on Y1H, GUS, and LUC complementation experiments, this study demonstrated that the VcMYB1 transcription factor can bind to the promoter sequence of VcERF061 and promote the expression of the VcERF061 gene. Unfortunately, no protein–protein-level interaction was observed between VcMYB1 and VcERF061.

Discussion

Anthocyanins are one of the most important quality indicators of blueberry, and the anthocyanin content can directly determine its economic value. However, studies on the anthocyanin anabolism pathway in blueberry are limited and incomplete. The regulation of anthocyanin synthesis by ERF transcription factors has been well studied in respiratory leapfrog plants. In recent years, with further understanding of how anthocyanin synthesis is regulated, reports of ERF transcription factors regulating anthocyanin accumulation in non-climacteric plants have gradually increased. However, little research has been reported on blueberries. Therefore, this study used blueberry as the target to investigate the molecular mechanism of the ERF regulation of anthocyanin synthesis in depth. The findings of the present study clarified that VcERF061 promotes anthocyanin synthesis in blueberry. The VcMYB1 transcription factor can bind to the promoter sequence of VcERF061 and activate its expression to further promote anthocyanin synthesis in blueberry. This study further enriches the anthocyanin synthesis network and provides a theoretical basis for future blueberry breeding and quality enhancement.

The sequence of the VcERF061 gene was cloned to explore the gene function of VcERF061. Then, this work analyzed the protein sequence and structural domain of VcERF061, which was found to contain an AP2 structural domain. VcERF061 was classified into the ERF family according to Nakano et al. [14] in Arabidopsis. The ERF family is further divided into the ERF subfamily and the DREB subfamily. The difference between the two is the different amino acid residues in the conserved sequence of the AP2 structural domain. The amino acids at positions 14 and 19 of the ERF subfamily are alanine and aspartic acid, respectively, while the amino acids at positions 14 and 19 of the DREB subfamily are valine and glutamic acid, respectively. Sequence alignment analysis of the VcERF061 protein was performed, and it had extremely high homology with the ERF061 protein in other plants, especially the AP2 structural domain (Fig. 1C). In Arabidopsis, AtERF061 is classified into the DREB subfamily [14]; thus, this study classified this gene into this subfamily. In tomato, the SlDREB40 gene, homologous to VcERF061, showed high expression under high temperature and drought stress [51]. FveERF (mrna32084), which is also highly homologous to VcERF061, was significantly expressed during strawberry flower development as well as fruit development and ripening [52], which is consistent with our findings that VcERF061 promotes fruit color change and fruit ripening.

The findings of this study verified that VcERF061 promotes anthocyanin accumulation in plants based on heterologous transient and homologous expression (Figs. 2, 3). Anthocyanin accumulation improves plant adaptation to low temperatures. The accumulation and degradation pattern of anthocyanin in transgenic adventitious buds may be helpful to improve the low temperature tolerance of blueberry and enable higher profits for the blueberry industry. Genes of the DREB subfamily have also been found to promote anthocyanin synthesis in fruit in previous studies. In blood orange, DREB2A promotes anthocyanin accumulation in response to blue light signals [53]. ERF transcription factors can promote anthocyanin synthesis in response to ethylene signaling. ABA plays a crucial role in fruit ripening and anthocyanin accumulation in blueberry, as a non-climacteric plant. Therefore, this study used ABA and ETH to treat blueberry fruit at the color change stage. ABA and ethylene significantly increased the gene expression of VcERF061 (Fig. 5). Our results are consistent with the expression trends of MdERF3 and MdERF1B in apple, ERF5 in "purple gold" mulberry, and PpERF105 in pear [33, 41–43]. In previous studies, ABA was found to play a dominant role in blueberry fruit development and ripening and anthocyanin synthesis. The ABA biosynthesis genes VmNSY and VmNCED1 were significantly expressed in lingonberry fruit around the color transition stage [37], and there was also a strong temporal correlation between the accumulation of free ABA in the pulp and the expression of structural genes for anthocyanin synthesis and anthocyanin concentration [54]. For other non-climacteric fruits, such as grapes, exogenous application of ETH was also found to promote the expression of genes involved in the ABA signaling pathway, including ABA biosynthesis, metabolism, transport, and signaling cascade responses, which in turn promotes fruit ripening and anthocyanin accumulation [55]. Climacteric fruits, such as apples, peaches and bananas, ethylene is produced accordingly at the onset of ripening [56]. However, for non-climacteric fruits, ethylene production during fruit ripening does not seem to change significantly during this process [57, 58]. From this we infer that ABA plays a dominant role in blueberry fruit ripening and promotes the regulation of the expression of transcription factors and structural genes related to anthocyanin synthesis, acting as an upstream regulator.

Most of the current binding characteristics of MYB and ERF transcription factors are at the protein–protein level, and the two types of protein interactions work together to regulate anthocyanin biosynthesis. Alternatively, they form complexes with MBW transcription factors to regulate anthocyanin synthesis. In apple, MdERF78 interacts with the MdMYB1 protein and enhances the transcriptional activity of MdMYB1 on the MdDFR, MdUFGT, and MdGSTF12 promoters to promote anthocyanin accumulation [31]. MdERF38 interacts with the MdMYB1 protein to increase the transcriptional activity of MdMYB1 and promotes the binding of MdMYB1 to the MdDFR and MdUF3GT promoters to accelerate apple anthocyanin accumulation [26]. In pear, Pp4ERF24 and Pp12ERF96 interact with the PpMYB114 protein, facilitating the interaction between PpMYB114 and PpbHLH3 and thereby enhancing the activation of PpMYB114 on the PpUFGT promoter and inducing anthocyanin accumulation in jujube pear [34]. The AcMYBF110-AcbHLH1-AcWDR1 complex acted directly on the promoter of the anthocyanin synthesis gene to regulate anthocyanin biosynthesis in kiwi fruit [27]. PyERF3 interacts with PyMYB114 and forms the new transcriptional regulatory complex PyERF3-PyMYB114-PybHLH3 with bHLH3, which binds to the promoters of PyDFR, PyANS, and PyUFGT to activate their transcription and thus regulates pear anthocyanin biosynthesis [59]. The transcription factor IbERF71 forms the novel complex IbERF71-IbMYB340-IbbHLH2 with IbMYB340 and IbbHLH2, which regulates anthocyanin biosynthesis by enhancing the transcriptional activity of IbANS1 in purple fleshy sweet potato [60]. However, this study explored the interaction between VcERF061 and the core gene VcMYB1, which promotes anthocyanin synthesis in blueberry. First, it was found that the VcERF061 protein and VcMYB1 protein did not interact with each other based on Y2H. Next, it was concluded that the VcMYB1 protein bound to the promoter sequence of VcERF061 and thus promoted VcERF061 expression based on Y1H, LUC complementation, and GUS assays (Fig. 6). This result was similar to the report of An et al. [33], who found that MdMYB1 bound the MdERF3 promoter to activate its transcription and thus accelerate anthocyanin biosynthesis in apple.

In recent years, the importance of the ERF family of transcription factors for phycocyanin synthesis has been further demonstrated through an in-depth study. Members of the ERF gene family can directly bind to the promoters of structural anthocyanin synthesis genes to regulate anthocyanin biosynthesis. In pear, PbERF22 significantly activates the promoter of PbUFGT to promote anthocyanin biosynthesis in early-ripening pears [61]. In carrot, DcERF1 binds to the cis-element GCC-box homolog in the DcPAL3 promoter region, activating the DcPAL3 promoter and upregulating its activity to promote anthocyanin biosynthesis [62]. In apple, MdERF78 directly binds to the MdF3H and MdANS promoters and activates gene expression, thereby playing a positive role in induced anthocyanin accumulation [31]. MdERF109 promotes light-induced anthocyanin biosynthesis through directly binding to and activating the transcription of the anthocyanin structural genes MdCHS and MdUFGT, and the regulatory gene MdbHLH3 promoter [63]. In addition, we cloned the promoter sequence of VcANS and conducted a detailed analysis. Our analysis found that the VcANS promoter sequence contains G-box binding sites responsive to ABA signals. However, the Y1H assay revealed that VcERF061 cannot bind to the VcANS promoter (Fig. 4), which may be due to the specificity among different species. This study enriches the regulatory network of ERF transcription factors in regulating anthocyanin synthesis in plants, and provides theoretical support for ERF transcription factors that promote blueberry anthocyanin synthesis and thus improve blueberry fruit quality.

Conclusions

In this study, we clarified that VcERF061 promotes the expression of VcMYB1, VcF3'5'H, VcDFR, VcANS and VcUFGT. However, through yeast one-hybrid (Y1H) assays, we found that VcERF061 cannot directly bind to the promoter of the structural gene VcANS. Subsequently, we also found that the expression of VcMYB1 and VcERF061 was up-regulated in ABA- and ETH-treated blueberry fruits at the color change stage, which led to the accumulation of anthocyanins in blueberry fruits. In addition, a VcMYB1 recognition site, 5'-CTGTTG-3', was identified in the VcERF061 promoter sequence. The yeast one-hybrid (Y1H) experiment and tobacco leaf transient injection experiment demonstrated that VcMYB1 transcription factor can bind to the promoter sequence of VcERF061 and promote the expression of the VcERF061 gene. This study enriched the regulatory network of anthocyanin synthesis and metabolism and provided a theoretical basis for selecting and breeding high-quality blueberry varieties and improving blueberry fruit quality.

Authors’ contributions

S.R.M: Writing – original draft, Visualization, Software, Investigation, Formal analysis, Data curation, Conceptualization, Writing – review & editing. Q.T: Writing – original draft, Visualization, Software, Formal analysis, Data curation, Investigation, Writing – review & editing. X.W: Formal analysis, Data curation, Investigation. F.M.C: Conceptualization, Data curation, Formal analysis, Writing – review & editing, Methodology. Y.S: Writing – review & editing, Supervision, Software, Project administration, Methodology, Formal analysis, Data curation, Conceptualization, Funding acquisition.

Funding

This work was supported by the Liaoning Provincial Science and Technology Major Project on Blueberry Germplasm Innovation and Application [grant number 2025JH1/11700017] and the Chinese Academy of Agricultural Sciences Agricultural Science and Technology Innovation Program [grant number CAAS-ASTIP].

Data availability

The original contributions presented in the study are publicly available.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.