Skip to main content
NCBI home page
Biomolecules & Therapeutics logoLink to Biomolecules & Therapeutics
. 2025 Dec 22;34(1):154–164. doi: 10.4062/biomolther.2025.224

Targeting YAP-TEAD Interaction with Honokiol to Inhibit Melanoma Progression and Metastasis

Chaelin Lee 1,†, Hien Thi Thu Do 1,†, Xiang Fei 2,†, Sanha Lee 2, Soonsil Hyun 3, Seung-Yong Seo 2,*, Inmoo Rhee 1,*
PMCID: PMC12782857  PMID: 41423957

Abstract

The Hippo-YAP/TEAD pathway plays a central role in melanoma progression by regulating tumor cell proliferation, survival, and migration. Using a NanoLuc Binary Technology (NanoBiT) protein-protein interaction assay, we screened honokiol-based small molecules and identified several analogues that disrupt the YAP-TEAD interaction. HK03 was the most effective analogue, leading to a pronounced reduction in Cyr61 levels and diminished Erk and Akt phosphorylation in B16-F10 melanoma cells. HK03 also blocked epithelial–mesenchymal transition (EMT) and impaired melanoma cell migration in wound-healing assays. In vivo, HK03 treatment markedly reduced metastatic burden in a B16-F10 lung metastasis model. These findings suggest that honokiol derivatives, particularly HK03, represent potential lead compounds for targeting the YAP-TEAD axis in melanoma therapy.

Keywords: YAP-TEAD, Cyr61, Hippo signaling pathway, Honokiol, Melanoma

INTRODUCTION

Melanoma is an aggressive skin cancer with rising global incidence, accounting for the majority of skin cancer-related deaths despite representing only 1% of skin cancer cases (Caraban et al., 2024). Its progression involves dysregulation of multiple signaling pathways, including MAPK, PI3K-Akt, and Hippo-YAP/TEAD pathways, which regulate cell proliferation, survival, and metastasis. The Hippo signaling pathway was first discovered in Drosophila melanogaster and plays a fundamental role in stem cell function, regeneration, organ growth control, and tumor suppression (Fu et al., 2022; Zhong et al., 2024). The Hippo pathway is a highly conserved kinase cascade that is triggered via the activation of Ste20-like protein kinases (MST) and large tumor suppressor kinases (LATS) (Chu et al., 2008; Sarmasti Emami et al., 2020). The MST kinases, which combine with adaptor proteins Salvador 1 (SAV1), phosphorylate the LATS kinases leading to the activation of the complex LATSs and scaffolding protein MOB1 cofactors (Couzens et al., 2017). This activated complex then phosphorylates the downstream targets, such as Yes-associated protein (YAP) and transcriptional co-activator (TAZ) (Johnson and Halder, 2014), resulting in YAP-TAZ nuclear exportation, cytoplasmic retention, and degradation through β-transducin repeat-containing E3 ubiquitin-protein ligase (β-TrCP) (Zhao et al., 2021). Instead of the complex formation with YAP-TAZ, the TEA domain-containing sequence-specific transcription factors (TEADs) interact with the transcription cofactor vestigial-like protein 4 (VGLL4), which suppresses target gene expression (Yamaguchi, 2020). Therefore, in the active state of Hippo pathway, YAP-TAZ complex activity is blocked, and YAP- and TAZ-related gene expression is repressed (Ma et al., 2019). Conversely, when the Hippo pathway is inactive, YAP and TAZ translocate and accumulate in the nucleus where they form complexes with TEADs or different transcription factors, which results in the gene transcription (Cunningham and Hansen, 2022). The downstream effectors of Hippo transcription cofactors comprise cysteine-rich angiogenic protein 61 or CCN1 (Cyr61), connective tissue growth factor or CCN2 (CTGF), Myc, and Axl that control a wide range of biological functions including not only cell proliferation, differentiation, and apoptosis but also inflammation and cancer (Chu et al., 2008; Zhou et al., 2016).

The dysregulation of Hippo pathway is prevalent in human cancer cells where YAP/TAZ/TEAD complex has been demonstrated to be crucial for multiple hallmarks of tumors (Pobbati and Hong, 2020). Several research groups have developed multiple strategies to disrupt this interaction, including direct protein-protein interaction (PPI) inhibitors, such as IAG933, have been designed to bind the Ω-loop pocket of TEAD, directly competing with YAP for TEAD binding. Another approach involves small molecules that bind to the lipidation site in TEAD’s hydrophobic central pocket, acting allosterically to inhibit YAP-TEAD complex formation (Holden et al., 2020). Flufenamic acid and niflumic acid, nonsteroidal anti-inflammatory drugs, interact with the TEAD central pocket leading to the inhibition of the YAP-TEAD target gene expression and the cancer cell growth (Pobbati et al., 2015). Moreover, TED-347, a chloromethylketone analogue of flufenamic acid, as a covalent TEAD inhibitor blocks YAP-TEAD interaction (Bum-Erdene et al., 2019). Another covalent TEAD suppressor, K975, was discovered to treat the efficacy of human malignant pleural mesothelioma (MPM) xenograft models (Kaneda et al., 2020). Recently, Lu et al. (2019) synthesized a vinylsulfonamide derivative (DC-TEADin02), which binds covalently to TEAD in HEK293T cells transfected with Flag-TEAD4. Triazole efficiently binds to TEAD palmitate pocket resulting in the inhibition of palmitoylation in intestinal epithelium in vivo (Li et al., 2020). Overall, the diversity of small molecules targeting the TEAD central pocket has been being developed, and any approach that might help in the discovery of new TEAD regulators would be useful.

Honokiol (5,3′-Diallyl-2,4′-dihydroxybiphenyl) is a bioactive natural chemical derived from the bark of Magnolia officinalis that has a wide range of pharmacological activities (Maruyama and Kuribara, 2006; Usach et al., 2021). M. officinalis bark extract has been used in Chinese and Japanese traditional drugs for centuries (Lee et al., 2011). Numerous in vitro and in vivo investigations showed that honokiol has anticancer effects by altering several biological targets and signal transduction pathways (Ong et al., 2019). It is being reported that honokiol decreases cancer cell growth and promotes cell death (Cheng et al., 2016). Furthermore, this lignan can suppress cancer cell growth but remains toxic to normal cells (Lee et al., 2019a). Honokiol has been demonstrated to regulate multiple processes involved in cancer initiation and progression through different signaling molecules and pathways including cell cycle, apoptosis, ROS production, autophagy, epithelial-mesenchymal transition (EMT), angiogenesis, MAPK, NF-κB, and PI3K/Akt/mTOR signaling pathways (Banik et al., 2019; Huang et al., 2018; Lin et al., 2016; Mottaghi and Abbaszadeh, 2022). In this study, we demonstrated that honokiol analogues could inhibit the binding between YAP and TEAD, decrease the transcription of target genes Cyr61 and block the migration signaling pathway. Despite recent advances in developing small molecules that disrupt the YAP-TEAD interaction, most efforts have centered on synthetic scaffolds targeting the TEAD palmitoylation pocket, with limited translation to natural product derivatives. Honokiol, a bioactive compound from Magnolia species, exhibits diverse anticancer properties, but its potential to interfere with YAP-TEAD signaling remains uncharacterized. In this study, we screened a series of honokiol analogues to identify novel inhibitors of the YAP-TEAD interaction, leading to the discovery of HK03 as a selective modulator. Unlike prior studies, our approach combines live-cell NanoBiT screening with functional transcriptomic validation to elucidate mechanism-based inhibition. This work addresses a current gap in the field by establishing honokiol derivatives as natural product-based inhibitors of YAP-TEAD signaling with anti-melanoma efficacy.

MATERIALS AND METHODS

Materials

Cell culture medium includes DMEM (Capricorn, Cat No. DMEM-HPA), fetal bovine serum (FBS) (Corning, Cat No. 35-015-CV), penicillin-streptomycin (Gibco, Cat No.15140-122). DNA plasmids: pRK5-Myc-TEAD1 (Addgene, Cat. No.33109), pcDNA Flag Yap1 (Addgene, Cat. No.18881), pBiT1.1-N [TK/LgBit] Vector, pBiT2.1-N [TK/SmBit] Vector from NanoBit Protein: Protein Interaction System (Promega, Cat. No. N2014). Cloning materials: Taq DNA polymerase kit; restriction enzymes: NheI (NEB, Cat. No. R0131S), EcoRI (NEB, Cat. No. R0101S); NucleoSpin Gel and PCR Clean-up, 4 DNA Ligase (NEB, Cat. No. M0202T); E. coli DH5α competent cell (HIT TM-DH5α Value 108, Real-biotech, Cat. No. RH617), LB broth (w/o Amp), LB agar plate (w/ Amp). Reporter assay: LipofectamineTM 3000 Reagent (Invitrogen, Cat. No. L3000015), GibcoTM Opti-MEMTM I Reduced Serum Medium (Invitrogen, Cat. No. 31985062).

Antibodies: Mouse β-actin Ab (Santa Cruz, Cat#sc-47778), Rabbit Akt Ab (Cell Signaling, Cat#4691), Rabbit phospho-Akt Ab (Cell Signaling, Cat#4060), Rabbit Cyr61 (Cell Signaling, Cat#39382), Rabbit GSK-3β (Cell Signaling, Cat#9315), Rabbit phospho-GSK-3β (Cell Signaling, Cat#9336), Rabbit p44/42 MAPK (Erk1/2) (Cell Signaling, Cat#4695), Rabbit phospho-p44/42 MAPK (Erk1/2) (Cell Signaling, Cat#4370).

Compound preparation

All honokiol analogues were synthesized as previously described (Lee et al., 2019b). The identity and purity of all compounds were confirmed by 1H NMR, 13C NMR, and high-resolution mass spectrometry. All compounds showed a purity of ≥95% as deter-mined by HPLC analysis. Stock solutions were prepared by dissolving each compound in dimethyl sulfoxide (DMSO; Sigma-Aldrich) at a concentration of 20 mM. These stock solutions were aliquoted and stored at –20°C protected from light until use. Working solutions were freshly prepared before each experiment by diluting the stock solutions into the appropriate culture medium, ensuring a final DMSO concentration not exceeding 0.1% (v/v).

Cell culture and cell viability

GP2-293 cells (human embryonic kidney-derived cells transformed with adenovirus type 5 DNA; ATCC, Cat. No. CRL-1573), A549 human lung carcinoma cells (ATCC, Cat. No. CCL-185), LLC1 murine lung carcinoma cells (ATCC, Cat. No. CRL-1642), and B16-F10 murine melanoma cells (ATCC, Cat. No. CRL-6475) were obtained from ATCC. All cell lines were maintained in DMEM supplemented with 10% fetal bovine serum (FBS; Corning) and 1× penicillin-streptomycin (Gibco). Cells were cultured in humidified in-cubators at 37°C with 5% CO2. For subculturing, cells were washed once with sterile PBS and detached using 0.25% trypsin-EDTA (Gibco) for 3-5 min at 37°C. The detached cells were neutralized with complete medium, collected, and reseeded at appropriate densities depending on experimental requirements. For treatments, transfected GP2-293 cells and B16-F10 cells were seeded into plates at specified densities (e.g., 1.5×106 cells per well in 6-well plates for transfection or 5×104 cells per well in 96-well plates for assays) and incubated overnight to allow cell attachment. As needed, cells were stained and analyzed using a BD FACSCanto II flow cytometer (Biopolymer Research Center for Advanced Materials).

Cell viability was assessed using the MTT assay. B16-F10 cells were seeded at 5×103 cells per well in 96-well plates and allowed to adhere overnight. Cells were then treated with honokiol analogues at various concentrations for 24 h. After treatment, 10 µL of MTT solution (5 mg/mL in PBS) was added to each well and incubated for 4 h at 37°C. The medium was carefully removed, and 100 µL of DMSO was added to dissolve the formazan crystals. Absorbance was measured at 570 nm using a microplate reader (Molecular Devices). Cell viability was expressed as a percentage relative to untreated control cells.

Plasmid construction

The YAP (amino acids 50-171) and TEAD (amino acids 194-411) coding sequences were amplified by PCR using Phusion High-Fidelity DNA Polymerase (NEB, Cat. No. M0530S) with specifically designed primers (sequences listed in Supplementary Table 1). Templates used were pcDNA-Flag-YAP (Addgene, Cat. No. 18881) for YAP and pRK5-Myc-TEAD1 (Addgene, Cat. No. 33109) for TEAD. The PCR products were purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) and digested with EcoRI (NEB, Cat. No. R0101S) and NheI (NEB, Cat. No. R0131S) at 37°C for 2 h. The digested products were ligated into similarly digested SmBiT and LgBiT vectors (Promega NanoBiT system) using T4 DNA Ligase (NEB, Cat. No. M0202T) at 16°C overnight. The ligation mixtures were transformed into DH5α competent cells (Re-al-biotech, Cat. No. RH617) by heat shock, plated onto LB agar containing ampicillin (100 µg/mL), and in-cubated overnight at 37°C. Positive clones were screened by colony PCR and confirmed by Sanger sequencing (Cosmo Genetech Co., Ltd) to verify the correct insertion and reading frame. The resulting constructs were designated SmBiT-YAP and LgBiT-TEAD plasmids and used for NanoBiT assays.

YAP-TEAD protein-protein interaction (PPI) reporter assay

1.5×106 GP2-293 cells were plated in a 6-well plate 24 hr before transfection. SmBiT-YAP and LgBiT-TEAD plasmids (1 µg each) were transfected together into GP2-293 cells using Lipofectamine. After a 6-h transfection, the fresh medium was changed, and cells were harvested after 24-h transfection. 5×104 transfected cells were seeded and stimulated by honokiol analogues for 24 h. The medium was aspirated and 50 µL Opti-MEM medium was added to each well. Then, 12.5 µL Nano-Glo Live Cell Reagent (1:20 diluted) containing cell-permeable Furimazine substrate was added, and the biosensor activity was immediately measured using Berthold Technologies Lumat LB 9507. In this study, all honokiol analogues were evaluated at a single concentration of 20 μM in the NanoBiT YAP-TEAD PPI assay as an initial functional screen to prioritize candidates.

Realtime PCR

Total RNA was extracted using Trizol reagent (Invitrogen) following the manufacturer’s recommendation. cDNA was synthesized by reverse transcription using RevertAid first strand cDNA synthesis kit (Thermo Scientific) and quantitative real-time PCR was per-formed using PowerSYBR® green PCR Master Mix (Applied Biosystems) in StepOneTM real-time PCR system (Thermo Fisher). Data were analyzed with the 2(-∆CT) method and normalized based on β-actin determined in the same sample. Analysis of all samples was performed in triplicate. Primers were synthesized by Cosmo Genetech Co., Ltd (Table 1).

Table 1.

List of real-time PCR primers

Gene Primer pair sequence
m-Cyr61 F: GAGGCTTCCTGTCTTTGGCAC
R: ACTCTGGGTTGTCATTGGTAAC
m-Myc F: TGAGCCCCTAGTGCTGCAT
R: AGCCCGACTCCGACCTCTT
m-Axl F: ATGCCAGTCAAGTGGATTGCT
R: CACACATCGCTCTTGCTGGT
Open in a new tab

Western blotting

1×106 B16-F10 cells/well were subjected to the indicated formulation in a 6-well plate for 24 h and lysed in cold lysis RIPA buffer together with protease and phosphatase inhibitor cocktail. Lysate was cleared by centrifugation for 10 min at 4°C. The collected lysates were electrophoresed through SDS-PAGE and then transferred into the PVDF blotting membrane. After blocking for 30 min, the membrane was incubated overnight at 4°C with the primary antibody. The membrane was then incubated in the HRP-conjugated goat anti-mouse IgG or goat anti-rabbit IgG followed by detection using ECL. The blots were measured via ImageJ and the ratios were compared with the β-actin blots.

Wound healing assay

B16-F10 cells were seeded at a density of 1-1.2×106 cells per well in 6-well tissue culture plates (SPL Life Sciences) and cultured in complete DMEM at 37°C with 5% CO2 until they reached 100% confluency (typically within 24 h). Prior to wounding, cells were washed once with sterile PBS (Gibco) to remove non-adherent cells and debris.

A linear wound was created in the cell monolayer using a sterile 200 µL pipette tip held perpendicular to the plate surface. Detached cells were removed by gently washing twice with PBS, and fresh serum-free DMEM containing the HK03 candidate compound at the indicated concentration (e.g., 20 µM) or vehicle control (0.1% DMSO) was added to each well. Images of the wound area were captured at 0, 6, 9, and 12 h post-treatment using the ZOETM Fluorescent Cell Imager (Bio-Rad) under brightfield mode. The wound width at each time point was measured using ImageJ software (NIH) by averaging measurements taken at five random locations along the wound. Wound closure was calculated as a percentage relative to the initial wound width at 0 h.

Melanoma metastasis assay in vivo

To evaluate the effect of HK03 on melanoma metastasis, an experimental lung metastasis model was established using B16-F10 murine melanoma cells. Female C57BL/6 mice (6-8 weeks old) were injected via the tail vein with 8×105 B16-F10 cells suspended in PBS to induce pulmonary metastases. Mice were randomly assigned to three groups: (1) Mock group (no tumor cell injection), (2) Control group (B16-F10 injection with vehicle treatment), and (3) HK03-treated group (B16-F10 injection with HK03 administered i.v. at 20 mg/kg on days 3, 6, 9, and 12 post-injection). On day 14, mice were sacrificed, and lungs were harvested, washed with PBS, and fixed in 4% paraformaldehyde. Gross lung images were captured to visualize metastatic nodules, and the number of metastatic foci was counted in a blinded manner. All animal procedures were conducted in accordance with the guidelines of the Korean Council on Animal Care, and the study protocol was approved by the Sejong Animal Care and Use Committee under protocol number SJ-20160303.

Statistical analysis

All experiments were repeated with at least triplicate assays. Statistical analysis was performed using GraphPad Prism 5 software (GraphPad Software Inc, CA, USA). Paired, two-tailed Student’s t-test or two-way ANOVA were used to compare two result groups. p values <0.05 were considered significant.

RESULTS

Honokiol analogues effect on YAP-TEAD interaction

One of potential remedies for anti-cancer therapeutics was honokiol, which was demonstrated to decrease cancer cell growth and promote cell death (Hashem et al., 2022). However, it remains unclear whether honokiol analogues can modulate the Hippo pathway by altering YAP-TEAD interaction. The honokiol analogues were systematically designed to optimize YAP-TEAD binding disruption while improving pharmaceutical properties. The design strategy focused on four key modifications: 1) 4’-O-alkylated analogues such as HK02-HK07, HK09, HK11, HK16, HK18, and HK19 to increase metabolic stability by protecting the phenolic 4’-OH group susceptible to phase II metabolism, increase lipophilicity for improved membrane permeability, and systematically evaluate optimal alkyl chain lengths (ethyl, n-butyl, allyl) for YAP-TEAD binding; 2) 2-O-alkylated analogues such as HK12, HK13, HK14, HK15, and HK17 providing additional hydrogen bonding through ketone functionality and allowing electronic modulation via substituents (F, Cl, NO2) for optimal protein-protein interaction disruption; 3) cycloalkyl modified analogues such as HK06 and HK07 using cyclopropyl and cyclobutyl groups, respectively, to impose conformational constraints for improved binding selectivity and metabolic stability against oxidative metabolism; and 4) ester prodrugs such as HK11, HK16, and HK21 to improve aqueous solubility and potentially extend plasma half-life by reducing rapid metabolism. The complete chemical characterization data, including molecular formulas, molecular weights, purity, and structural modifications for all synthesized analogues are summarized in Supplementary Table 1. In the YAP-TEAD PPI screening assay, GP2-293 cells were transfected with the combination between SmBiT-YAP and LgBiT-TEAD plasmids for 24 h, and next stimulated by honokiol analogues at the concentration of 20 µM. The results of the cell viability assay revealed that the transfected GP2-293 cells exerted robust survival in the presence of this concentration of analogues (Supplementary Fig. 1). In the initial phase, the impact of 21 honokiol analogues on the YAP-TEAD interaction was examined (Table 2, Fig. 1). Several analogues exhibited approximately 60% inhibition of luminescence, while about 3 analogues showed an even higher reduction of around 80%. Particularly, HK03, HK05, HK10, and HK16 reduced the NanoBiT luminescent signal by more than 80% at 20 μM (Fig. 1), and were therefore selected for further evaluation of their anti-cancer activities. Within this focused honokiol analogue library, a clear trend emerged at the 4′-oxygen position: the 4′-O-n-butyl analogue HK03 showed stronger inhibition of the YAP-TEAD interaction than analogues bearing shorter alkyl chains or cycloalkyl substituents, suggesting that an appropriate balance of hydrophobic bulk and conformational flexibility at this site is beneficial for activity. By contrast, modification at the 2-O-position generally led to weaker effects on YAP-TEAD inhibition, indicating that this region is less tolerant to substitution or that such changes do not favor productive binding to the complex. Taken together, these preliminary SAR observations support further optimization around the 4′-O-alkyl motif, particularly n-butyl-type substituents, as a promising handle for enhancing YAP-TEAD inhibitory potency.

Table 2.

The structure of honokiol analogues

graphic file with name bt-34-1-154-t2f1.jpg
Open in a new tab

Fig. 1.

Fig. 1

Open in a new tab

Inhibition of YAP–TEAD interaction by honokiol analogues in the NanoBiT assay. (A) Druggable sites on the YAP/TAZ-TEAD complex, including the central pocket (purple) and two protein–protein interaction interfaces (interface 1, red; interface 3, green). (B) Schematic illustration of the NanoBiT YAP-TEAD protein–protein interaction assay, in which disruption of the YAP-TEAD complex reduces luminescent signal. (C) Inhibitory activity of honokiol analogues (20 μM) on the YAP–TEAD NanoBiT assay, expressed as luminescence (%) relative to vehicle control. Data are presented as mean ± SEM (n = 3 independent experiments); *, **, and *** indicate p<0.05, 0.01, and 0.001, respectively, versus control.

Honokiol analogues change the expression of target genes

When the Hippo pathway is deactivated, YAP-TAZ complex is translocated into the nucleus and binds with TEAD protein to initiate the transcription of target genes. These downstream effectors of Hippo transcription cofactors comprise Cyr61, Myc, Axl (Mokhtari et al., 2023). Several honokiol analogues, namely HK03, HK05, and HK16, were found to inhibit the interaction between YAP and TEAD (Fig. 1). As a result, further consideration is given to the potential of these compounds to reduce the transcription of Cyr61, Myc, and Axl genes in some cancer cell types. To clarify the function of these candidates, lung cancer cells (A549 cells, LLC1 cells) and melanoma cells (B16-F10 cells) were treated with honokiol analogues at the concentration of 20 μM for one day. The real-time PCR results indicated that all three analogues, HK03, HK05, and HK16, showed no significant effect on the transcription of downstream target genes in human lung cancer A549 cells (Fig. 2A). In mouse lung cancer LLC1 cells, HK03 exhibited a significant inhibitory effect on the transcription of Cyr61, while the expression of Myc and Axl mRNA remained unchanged with all three analogs (Fig. 2B). In melanoma B16-F10 cells, HK03 demonstrated a consistent effect by reducing the production of Cyr61 mRNA by more than 80% (Fig. 2C).

Fig. 2.

Fig. 2

Open in a new tab

The effect of honokiol analogues on the transcription of target genes in cancer cells. Cancer cells [(A) A549, (B) LLC1, (C) B16-F10] were exposed to honokiol analogues (20 μM) for 24 h, then RNA was isolated for further experiments. cDNA was synthesized from 3 ng total RNA with Oligo-dT primers. Quantitative PCR was performed using SYBR green primary mix from ABI company. Data was normalized to non-stimulated controls. The experiments were repeated three independent times, and the results are shown as the mean values ± SEM. Statistical differences were analyzed by two-tailed, paired t-test, *p<0.05, **p<0.01, ***p<0.001 as compared with untreated group.

HK03 Suppresses Cyr61 Expression in Melanoma Cells

To investigate the effect of HK03 on Cyr61 expression, melanoma cells were treated with HK03, and protein levels were analyzed via Western blot (Fig. 3). HK03 significantly reduced the expression of Cyr61, which is involved in migration and promotion of tumor progression. The Western blot analysis showed a significant decrease in Cyr61 protein levels, as demonstrated by a lower intensity of the Cyr61 band relative to the housekeeping control, β-actin. Quantification of the Cyr61/β-actin ratio further confirmed this reduction, indicating that HK03 effectively downregulates Cyr61 expression in melanoma cells. Given that Cyr61 is involved in tumor growth, metastasis, and resistance to therapy, these findings suggest that HK03 may exert its anti-cancer effects, at least in part, through Cyr61 inhibition.

Fig. 3.

Fig. 3

Open in a new tab

The impaired expression of Cyr61 by HK03 stimulation. B16-F10 cells were exposed to HK03 (20 μM) for 24 h, then the cells were harvested and lysed by RIPA buffer. The lysates were collected and immunoblotted with anti-Cyr61 antibody. The blots were measured via ImageJ and the ratios were compared with the β-actin blots. Representative blot images are displayed. The experiments were repeated three independent times, and the results are shown as the mean values ± SEM. Statistical differences were analyzed by a two-tailed, paired t-test, **p<0.01, as compared with the unstimulated group.

HK03 blocks the Akt and Erk signaling pathways

As indicated above, HK03 considerably reduced the expression of Cyr61 protein, the Hippo pathway target gene. Cyr61 was demonstrated to be involved in the migration of cancer cells, so it was considered which downstream signal HK03 could regulate in the migrating process. Several studies, which focused on the Cyr61-related migration, indicated that Akt and Erk activation contributed to the EMT in tumor cells and induce migration capability (Zhang et al., 2015). To determine whether HK03 affects key signaling pathways involved in melanoma progression, we examined its impact on ERK and AKT phosphorylation. ERK and AKT signaling pathways are critical for cell survival, proliferation, and metastasis, making them potential therapeutic targets in melanoma. Western blot analysis revealed that HK03 treatment significantly reduced the levels of phosphorylated ERK (p-ERK) and phosphorylated AKT (p-AKT), while the total ERK and AKT protein levels remained unchanged (Fig. 4). This suggests that HK03 specifically inhibits the activation of these pathways rather than affecting their overall expression. Quantification of the p-ERK/ERK and p-AKT/AKT ratios confirmed a statistically significant reduction in phosphorylation upon HK03 treatment. The suppression of ERK and AKT signaling by HK03 indicates that it may reduce melanoma cell proliferation and survival, which are often driven by the activation of these pathways in aggressive tumors. These results suggest that HK03 functions as a potent inhibitor of oncogenic signaling pathways in melanoma cells.

Fig. 4.

Fig. 4

Open in a new tab

The phosphorylation of Erk, Akt, GSK-3β under HK03 treatment in melanomas. Melanoma cells (B16-F10 cells) were stimulated by HK03 (20 μM) and after 24-h incubation, the cells were subjected to RIPA buffer and the collected supernatants were utilized to determine the protein activation via western blotting with different antibodies. The blots were measured via ImageJ and the ratios were compared with β-actin blots. Representative blot images are displayed. The experiments were repeated three independent times, and the results are shown as the mean values ± SEM. Statistical differences were analyzed by a two-tailed, paired t-test, **p<0.01, ***p<0.001, as compared with the unstimulated group.

HK03 suppresses on the migration capacity and metastasis of melanoma cells

To further explore the functional consequences of HK03 treatment, we performed a wound healing assay to assess melanoma cell migration. Cancer cell migration is a crucial step in metastasis, allowing tumor cells to invade surrounding tissues and disseminate to distant organs. Cyr61 has been shown to play a key role in promoting cell migration by regulating cytoskeletal dynamics and enhancing cell motility. Given that HK03 suppresses Cyr61 expression, we hypothesized that it might also impair melanoma cell migration. Images captured at 0, 6, and 12 h post-wounding revealed that control cells exhibited significant wound closure over time, demonstrating their intrinsic migratory capacity (Fig. 5). In contrast, HK03-treated cells displayed markedly reduced migration ability, as evidenced by a significantly slower wound closure rate. Quantitative analysis confirmed a substantial reduction in the wound closure percentage in HK03-treated cells compared to the controls. This suggests that HK03 effectively suppresses melanoma cell migration, potentially by altering cytoskeletal dynamics, cell adhesion properties, or signaling pathways associated with motility.

Fig. 5.

Fig. 5

Open in a new tab

The reduction of migration ability in HK03-treated melanoma cells. B16-F10 cells were seeded and grown until 100% confluent. A wound was generated by using a small-top western blotting tip and cells were treated with HK03 (15 μM). Images were captured using ZOETM Fluorescent Cell Imager after 0, 6, 9, and 12 h of treatment. Cell migration was monitored under bright field microscopy (scale bar: 100 µm). The length of the wound line was measured via ImageJ. The experiments were repeated three independent times, and the results are shown as the mean values ± SEM. Statistical differences were analyzed by two-tailed, paired t-test, **p<0.01, ***p<0.001, as compared with unstimulated group.

HK03 Reduces Metastatic Burden in a Mouse Model

Metastasis is a process by which tumor cells spread from the primary tumor site to other parts of the body via the bloodstream or lymphatic system (Leong et al., 2022). YAP-TAZ is a signaling molecule involved in promoting tumor cell metastasis by activating genes such as Axl, CTGF, Cyr61, which are associated with tumor cell migration, invasion, and epithelial-mesenchymal transition (EMT) (Kumar and Hong, 2024). Based on the inhibitory effects of HK03 on these pro-metastatic genes, its therapeutic efficacy against lung metastasis of B16-F10 melanoma cells was evaluated. To evaluate the therapeutic potential of HK03 in vivo, a metastatic melanoma model was established using B16-F10 cells injected into mice. HK03 was administered at regular intervals, and metastatic nodules in the lungs were quantified upon sacrifice (Fig. 6). Representative lung images revealed a significant reduction in metastatic nodules in the HK03-treated group (20 mg/kg) compared to the control group (0 mg/kg). Quantitative analysis confirmed a substantial decrease in the number of lung nodules in mice receiving HK03 treatment, with a statistically significant reduction compared to untreated controls. These results suggest that HK03 effectively inhibits melanoma metastasis in vivo, supporting its potential as an anti-metastatic agent. The observed reduction in metastasis would be attributed to suppress Cyr61 expression and inhibit melanoma cell migration, as demonstrated in vitro.

Fig. 6.

Fig. 6

Open in a new tab

The recovery of metastasis by the treatment of HK03. The injection schedule for B16-F10 metastasis mouse model. Mice (n=3 per group) were divided into three groups and intravenously injected with either PBS (control) or HK03 (20 mg/kg) every three days. After 14 days metastatic nodules in lungs were counted. The mice were sacrificed to count the number of metastatic nodules in lungs. “Mock” refers to the no-treatment control group, “Vehicle” refers to cells treated with 0.1% DMSO as the vehicle control, and “HK03” refers to cells treated with 20 µM HK03. *p<0.05, Statistical differences were analyzed by one-way ANOVA followed by Tukey’s multiple comparison test.

Implications of HK03 in Melanoma Treatment

Taken together, these findings suggest that HK03 inhibits melanoma progression through multiple mechanisms, including the downregulation of Cyr61 expression, suppression of ERK and AKT signaling, and impairment of cell migration. The observed suppression of cell migration is likely linked to the inhibitory effect of HK03 on Cyr61, as Cyr61 has been reported to facilitate tumor cell motility and invasiveness. Furthermore, the in vivo data demonstrate that HK03 effectively reduces metastatic burden, reinforcing its potential as a therapeutic agent for melanoma treatment. By targeting these critical pathways, HK03 may offer therapeutic potential for melanoma treatment, either as a standalone agent or in combination with existing therapies. Further studies will be required to explore the molecular mechanisms underlying the effects of HK03 and to evaluate its efficacy in in vivo models of melanoma. Additionally, investigating whether HK03 influences other aspects of tumor biology, such as apoptosis, angiogenesis, or immune modulation, could provide deeper insights into its therapeutic potential. These results highlight HK03 as a promising candidate for future melanoma research and drug development (Fig. 7).

Fig. 7.

Fig. 7

Open in a new tab

The effect of HK03 on melanomas. HK03 inhibits key oncogenic pathways involved in melanoma progression. HK03 suppresses Cyr61 expression, which is regulated by the TEAD-YAP/TAZ transcriptional complex. Additionally, HK03 inhibits the phosphorylation of ERK and AKT, both of which are critical for melanoma cell migration and survival. The inhibition of these pathways ultimately leads to a reduction in melanoma cell migration. Red inhibitory lines indicate suppression by HK03. YAP, Yes-associated protein; TAZ, transcriptional coactivator with PDZ-binding motif; TEAD, TEA domain transcription factor; Akt, protein kinase B; Erk, extracellular signal-regulated kinase, Cyr61, cysteine-rich angiogenic inducer 61.

DISCUSSION

Cancer remains a formidable challenge, prompting extensive research efforts to develop effective treatment strategies. One prominent approach in anti-cancer therapy involves targeting the signaling pathways that regulate cancer initiation, progression, and metastasis (Hashem et al., 2022; Sanchez-Vega et al., 2018). Among these pathways, the Hippo signaling pathway is a critical regulator of cell growth, proliferation, and migration, and its dysregulation has been implicated in various malignancies (Fu et al., 2022; Misra and Irvine, 2018). The interaction between Yes-associated protein (YAP) and the transcription factor TEA domain (TEAD) plays a central role in this pathway, functioning to transactivate target genes essential for modulating cancer cell activities, including proliferation, survival, and differentiation.(Dey et al., 2020; Thompson, 2020).

In our screening for disruptors of the YAP-TEAD interaction, we identified small molecules with promising anti-cancer properties, particularly honokiol analogues. They have demonstrated the ability to modulate tumor cell growth and apoptosis through various mechanisms, including the induction of apoptosis, autophagy, NF-κB signaling, and epithelial-mesenchymal transition (EMT) (Mottaghi and Abbaszadeh, 2022; Ong et al., 2019). The role of the Hippo pathway in cancer is underscored by its influence on cellular proliferation and migration, suggesting that compounds capable of modulating this pathway could offer novel therapeutic avenues.

Among the analogues screened, HK03 emerged as a selective and potent inhibitor capable of modulating YAP-TEAD target genes by obstructing their interaction. Specif-ically, HK03 effectively inhibited the binding of YAP to TEAD1, leading to reduced transcription of downstream target genes. Notably, HK03 significantly decreased the expression of Cyr61 mRNA and protein in melanoma cells. Cyr61 is a crucial gene promoting EMT, a process characterized by the loss of epithelial features and the acquisition of migratory and invasive properties closely linked to metastasis (Hou et al., 2014; Zhou et al., 2020). In addition to its effects on Cyr61, HK03 treatment resulted in decreased phosphorylation of Akt despite an increase in total Akt protein levels. This suggests that HK03 suppresses Akt activation while inducing compensatory upregulation of total Akt expression, a feedback mechanism commonly observed in cancer cells in response to pathway inhibition. Furthermore, HK03 clearly reduced Erk phosphorylation, indicating that it may inhibit melanoma progression through both direct YAP-TEAD disruption and suppression of Akt and Erk signaling pathways (Sun et al., 2015). Further mechanistic studies will be important to delineate the precise regulatory dynamics among these pathways and to fully elucidate the anticancer mechanisms of HK03.

Importantly, HK03 significantly reduced the migratory capacity of B16-F10 cells, as evidenced by a wound healing assay over 12 h (Fig. 5). This effect supports its potential as an anti-metastatic agent. This observation underscores the potential of HK03 to interfere with cancer cell motility, a key feature of metastasis. By targeting YAP-TEAD interactions, HK03 may disrupt the intricate signaling networks that facilitate tumor progression and dissemination.

Despite the promising findings presented in this study, several limitations are acknowledged to provide appropriate context for the interpretation of the results. First, the YAP-TEAD inhibition data were generated using a single-dose (20 μM) preliminary screening format, and full IC50 or quantitative potency measurements were not conducted. Future studies will incorporate dose–response curves, kinetic analyses, and selectivity profiling across different TEAD paralogs and related transcriptional regulators. Second, although HK03 demonstrated strong functional effects on YAP-TEAD signaling and downstream targets, our assays did not examine broader selectivity against unrelated pathways or potential off-target activities, which will be essential for evaluating drug-likeness and lead-optimization potential. Third, some in vitro experiments were performed under simplified conditions that may not fully capture the complexity of TEAD regulation in vivo; therefore, follow-up studies will include expanded mechanistic experiments, including chromatin immunoprecipitation and transcriptomic profiling. Finally, the optimization of Honokiol analogues including systematic SAR expansion improved metabolic stability analyses, and pharmacokinetic characterization would be pursued to advance HK03 and related analogues toward more potent and selective YAP-TEAD inhibitors.

In conclusion, our findings highlight HK03 as a novel small-molecule inhibitor of the YAP-TEAD interaction, with significant implications for targeted cancer therapy. By downregulating components of the Hippo pathway and inhibiting critical signaling mechanisms, HK03 represents a promising candidate for further investigation in the context of cancer treatment, offering a multifaceted approach to combating tumor growth and metastasis.

bt-34-1-154-supple.pdf (336.9KB, pdf)

ACKNOWLEDGMENTS

This research was supported by Basic Science Research program through National Research Foundation of Korea (NRF) funded by the Ministry of Education (No. NRF-2021R1F1A1063321 for I.R.), and by the National Research Foundation of Korea (NRF-2020R1A6A1A03043708 and NRF-2022R1A2C1092715 for S.S.), as well as the Regional Innovation System & Education (RISE) program through the (Chungbuk Regional Innovation System & Education Center), funded by the Ministry of Education (MOE) and the (Chungcheongbuk-do), Republic of Korea (2025-RISE-11-014-03 for S.H.).

Footnotes

CONFLICT OF INTEREST

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

AUTHOR CONTRIBUTIONS

Chaelin Lee: Writing - review & editing, Writing - original draft, Validation, Resources, Investigation, Conceptualization. Hien Thi Thu Do: Writing - review & editing, Writing - original draft, Visualization, Validation, Resources, Investigation, Conceptualization. Xiang Fei: Writing - review & editing, Writing - original draft, Validation, Resources, Investigation, Conceptualization. Sanha Lee: Writing - review & editing, Validation, Investigation. Soonsil Hyun: Writing - review & editing, Resources, Conceptualization. Seung-Yong Seo: Writing - review & editing, Writing - original draft, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Conceptualization. Inmoo Rhee: Writing - review & editing, Writing - original draft, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Conceptualization.

REFERENCES

  1. Banik K., Ranaware A. M., Deshpande V., Nalawade S. P., Padmavathi G., Bordoloi D., Sailo B. L., Shanmugam M. K., Fan L., Arfuso F., Sethi G., Kunnumakkara A. B. Honokiol for cancer therapeutics: a traditional medicine that can modulate multiple oncogenic targets. Pharmacol. Res. 2019;144:192–209. doi: 10.1016/j.phrs.2019.04.004. [DOI] [PubMed] [Google Scholar]
  2. Bum-Erdene K., Zhou D., Gonzalez-Gutierrez G., Ghozayel M. K., Si Y., Xu D., Shannon H. E., Bailey B. J., Corson T. W., Pollok K. E., Wells C. D., Meroueh S. O. Small-molecule covalent modification of conserved cysteine leads to allosteric inhibition of the TEADYap protein-protein interaction. Cell Chem. Biol. 2019;26:378–389.e13. doi: 10.1016/j.chembiol.2018.11.010. [DOI] [PubMed] [Google Scholar]
  3. Caraban B. M., Aschie M., Deacu M., Cozaru G. C., Pundiche M. B., Orasanu C. I., Voda R. I. A narrative review of current knowledge on cutaneous melanoma. Clin. Pract. 2024;14:214–241. doi: 10.3390/clinpract14010018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cheng Y. C., Hueng D. Y., Huang H. Y., Chen J. Y., Chen Y. Magnolol and honokiol exert a synergistic anti-tumor effect through autophagy and apoptosis in human glioblastomas. Oncotarget. 2016;7:29116–29130. doi: 10.18632/oncotarget.8674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chu C.-Y., Chang C.-C., Prakash E., Kuo M.-L. Connective tissue growth factor (CTGF) and cancer progression. J. Biomed. Sci. 2008;15:675–685. doi: 10.1007/s11373-008-9264-9. [DOI] [PubMed] [Google Scholar]
  6. Couzens A. L., Xiong S., Knight J. D. R., Mao D. Y., Guettler S., Picaud S., Kurinov I., Filippakopoulos P., Sicheri F., Gingras A. C. MOB1 mediated phospho-recognition in the core mammalian Hippo pathway. Mol. Cell. Proteomics. 2017;16:1098–1110. doi: 10.1074/mcp.M116.065490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cunningham R., Hansen C. G. The Hippo pathway in cancer: YAP/TAZ and TEAD as therapeutic targets in cancer. Clin. Sci. 2022;136:197–222. doi: 10.1042/CS20201474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dey A., Varelas X., Guan K. L. Targeting the Hippo pathway in cancer, fibrosis, wound healing and regenerative medicine. Nat. Rev. Drug Discov. 2020;19:480–494. doi: 10.1038/s41573-020-0070-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Fu M., Hu Y., Lan T., Guan K. L., Luo T., Luo M. The Hippo signalling pathway and its implications in human health and diseases. Signal Transduct. Target. Ther. 2022;7:376. doi: 10.1038/s41392-022-01191-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hashem S., Ali T. A., Akhtar S., Nisar S., Sageena G., Ali S., Al-Mannai S., Therachiyil L., Mir R., Elfaki I., Mir M. M., Jamal F., Masoodi T., Uddin S., Singh M., Haris M., Macha M., Bhat A. A. Targeting cancer signaling pathways by natural products: Exploring promising anti-cancer agents. Biomed. Pharmacother. 2022;150:113054. doi: 10.1016/j.biopha.2022.113054. [DOI] [PubMed] [Google Scholar]
  11. Holden J. K., Crawford J. J., Noland C. L., Schmidt S., Zbieg J. R., Lacap J. A., Zang R., Miller G. M., Zhang Y., Beroza P., Reja R., Lee W., Tom J. Y. K., Fong R., Steffek M., Clausen S., Hagenbeek T. J., Hu T., Zhou Z., Shen H. C., Cunningham C. N. Small molecule dysregulation of TEAD lipidation induces a dominant-negative inhibition of Hippo pathway signaling. Cell Rep. 2020;31:107809. doi: 10.1016/j.celrep.2020.107809. [DOI] [PubMed] [Google Scholar]
  12. Hou C. H., Lin F. L., Hou S. M., Liu J. F. Cyr61 promotes epithelial-mesenchymal transition and tumor metastasis of osteosarcoma by Raf-1/MEK/ERK/Elk-1/TWIST-1 signaling pathway. Mol. Cancer. 2014;13:236. doi: 10.1186/1476-4598-13-236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Huang K., Chen Y., Zhang R., Wu Y., Ma Y., Fang X., Shen S. Honokiol induces apoptosis and autophagy via the ROS/ERK1/2 signaling pathway in human osteosarcoma cells in vitro and in vivo. Cell Death Dis. 2018;9:157. doi: 10.1038/s41419-017-0166-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Johnson R., Halder G. The two faces of Hippo: targeting the Hippo pathway for regenerative medicine and cancer treatment. Nat. Rev. Drug Discov. 2014;13:63–79. doi: 10.1038/nrd4161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kaneda A., Seike T., Danjo T., Nakajima T., Otsubo N., Yamaguchi D., Tsuji Y., Hamaguchi K., Yasunaga M., Nishiya Y., Suzuki M., Saito J. I., Yatsunami R., Nakamura S., Sekido Y., Mori K. The novel potent TEAD inhibitor, K-975, inhibits YAP1/TAZ-TEAD protein-protein interactions and exerts an anti-tumor effect on malignant pleural mesothelioma. Am. J. Cancer Res. 2020;10:4399–4415. [PMC free article] [PubMed] [Google Scholar]
  16. Kumar R., Hong W. Hippo signaling at the hallmarks of cancer and drug resistance. Cells. 2024;13:564–577. doi: 10.3390/cells13070564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lee J. S., Sul J. Y., Park J. B., Lee M. S., Cha E. Y., Ko Y. B. Honokiol induces apoptosis and suppresses migration and invasion of ovarian carcinoma cells via AMPK/mTOR signaling pathway. Int. J. Mol. Med. 2019a;43:1969–1978. doi: 10.3892/ijmm.2019.4122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lee S.-H., Fei X., Lee C., Do H. T. T., Rhee I., Seo S.-Y. Synthesis of either C2- or C4'-alkylated derivatives of honokiol and their biological evaluation for anti-inflammatory activity. Chem. Pharm. Bull. 2019b;67:966–976. doi: 10.1248/cpb.c19-00207. [DOI] [PubMed] [Google Scholar]
  19. Lee Y. J., Lee Y. M., Lee C. K., Jung J. K., Han S. B., Hong J. T. Therapeutic applications of compounds in the Magnolia family. Pharmacol. Ther. 2011;130:157–176. doi: 10.1016/j.pharmthera.2011.01.010. [DOI] [PubMed] [Google Scholar]
  20. Leong S. P., Naxerova K., Keller L., Pantel K., Witte M. Molecular mechanisms of cancer metastasis via the lymphatic versus the blood vessels. Clin. Exp. Metastasis. 2022;39:159–179. doi: 10.1007/s10585-021-10120-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li Q., Sun Y., Jarugumilli G. K., Liu S., Dang K., Cotton J. L., Xiol J., Chan P. Y., DeRan M., Ma L., Li R., Zhu L. J., Li J. H., Leiter A. B., Ip Y. T., Camargo F. D., Luo X., Johnson R. L., Wu X., Mao J. Lats1/2 sustain intestinal stem cells and Wnt activation through TEAD-dependent and independent transcription. Cell Stem Cell. 2020;26:675–692.e8. doi: 10.1016/j.stem.2020.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lin C. J., Chen T. L., Tseng Y. Y., Wu G. J., Hsieh M. H., Lin Y. W., Chen R. M. Honokiol induces autophagic cell death in malignant glioma through reactive oxygen species-mediated regulation of the p53/PI3K/Akt/mTOR signaling pathway. Toxicol. Appl. Pharmacol. 2016;304:59–69. doi: 10.1016/j.taap.2016.05.018. [DOI] [PubMed] [Google Scholar]
  23. Lu W., Wang J., Li Y., Tao H., Xiong H., Lian F., Gao J., Ma H., Lu T., Zhang D., Ye X., Ding H., Yue L., Zhang Y., Tang H., Zhang N., Yang Y., Jiang H., Chen K., Zhou B., Luo C. Discovery and biological evaluation of vinylsulfonamide derivatives as highly potent, covalent TEAD autopalmitoylation inhibitors. Eur. J. Med. Chem. 2019;184:111767. doi: 10.1016/j.ejmech.2019.111767. [DOI] [PubMed] [Google Scholar]
  24. Ma S., Meng Z., Chen R., Guan K. L. The Hippo pathway: biology and pathophysiology. Annu. Rev. Biochem. 2019;88:577–604. doi: 10.1146/annurev-biochem-013118-111829. [DOI] [PubMed] [Google Scholar]
  25. Maruyama Y., Kuribara H. Overview of the pharmacological features of honokiol. CNS Drug Rev. 2006;6:35–44. doi: 10.1111/j.1527-3458.2000.tb00136.x. [DOI] [Google Scholar]
  26. Misra J. R., Irvine K. D. The Hippo signaling network and its biological functions. Annu. Rev. Genet. 2018;52:65–87. doi: 10.1146/annurev-genet-120417-031621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mokhtari R. B., Ashayeri N., Baghaie L., Sambi M., Satari K., Baluch N., Bosykh D. A., Szewczuk M. R., Chakraborty S. The Hippo pathway effectors YAP/TAZ-TEAD oncoproteins as emerging therapeutic targets in the tumor microenvironment. Cancers. 2023;15:3468–3506. doi: 10.3390/cancers15133468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mottaghi S., Abbaszadeh H. Natural lignans honokiol and magnolol as potential anticarcinogenic and anticancer agents. A comprehensive mechanistic review. Nutr. Cancer. 2022;74:761–778. doi: 10.1080/01635581.2021.1931364. [DOI] [PubMed] [Google Scholar]
  29. Ong C. P., Lee W. L., Tang Y. Q., Yap W. H. Honokiol: a review of its anticancer potential and mechanisms. Cancers (Basel) 2019;12:48–92. doi: 10.3390/cancers12010048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pobbati A. V., Han X., Hung A. W., Weiguang S., Huda N., Chen G. Y., Kang C., Chia C. S., Luo X., Hong W., Poulsen A. Targeting the central pocket in human transcription factor TEAD as a potential cancer therapeutic strategy. Structure. 2015;23:2076–2086. doi: 10.1016/j.str.2015.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Pobbati A. V., Hong W. A combat with the YAP/TAZ-TEAD oncoproteins for cancer therapy. Theranostics. 2020;10:3622–3635. doi: 10.7150/thno.40889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sanchez-Vega F., Mina M., Armenia J., Chatila W. K., Luna A., La K. C., Dimitriadoy S., Liu D. L., Kantheti H. S., Saghafinia S., Chakravarty D., Daian F., Gao Q., Bailey M. H., Liang W. W., Foltz S. M., Shmulevich I., Ding L., Heins Z., Ochoa A., Gross B., Gao J., Zhang H., Kundra R., Kandoth C., Bahceci I., Dervishi L., Dogrusoz U., Zhou W., Shen H., Laird P. W., Way G. P., Greene C. S., Liang H., Xiao Y., Wang C., Iavarone A., Berger A. H., Bivona T. G., Lazar A. J., Hammer G. D., Giordano T., Kwong L. N., McArthur G., Huang C., Tward A. D., Frederick M. J., McCormick F., Meyerson M. Cancer Genome Atlas Research Network, author; Van Allen, E. M., Cherniack, A. D., Ciriello, G., Sander, C., Schultz, N., author Oncogenic signaling pathways in the cancer genome atlas. Cell. 2018;173:321–337.e10. doi: 10.1016/j.cell.2018.03.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sarmasti Emami S., Zhang D., Yang X. Interaction of the Hippo pathway and phosphatases in tumorigenesis. Cancers (Basel) 2020;12:2438–2461. doi: 10.3390/cancers12092438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sun Y., Liu W. Z., Liu T., Feng X., Yang N., Zhou H. F. Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J. Recept. Signal Transduct. Res. 2015;35:600–604. doi: 10.3109/10799893.2015.1030412. [DOI] [PubMed] [Google Scholar]
  35. Thompson B. J. YAP/TAZ: drivers of tumor growth, metastasis, and resistance to therapy. Bioessays. 2020;42:e1900162. doi: 10.1002/bies.201900162. [DOI] [PubMed] [Google Scholar]
  36. Usach I., Alaimo A., Fernandez J., Ambrosini A., Mocini S., Ochiuz L., Peris J. E. Magnolol and honokiol: two natural compounds with similar chemical structure but different physicochemical and stability properties. Pharmaceutics. 2021;13:224–238. doi: 10.3390/pharmaceutics13020224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yamaguchi N. Multiple roles of vestigial-like family members in tumor development. Front. Oncol. 2020;10:1266. doi: 10.3389/fonc.2020.01266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhang F., Hao F., An D., Zeng L., Wang Y., Xu X., Cui M. Z. The matricellular protein Cyr61 is a key mediator of platelet-derived growth factor-induced cell migration. J. Biol. Chem. 2015;290:8232–8242. doi: 10.1074/jbc.M114.623074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhao W., Wang M., Cai M., Zhang C., Qiu Y., Wang X., Zhang T., Zhou H., Wang J., Zhao W., Shao R. Transcriptional co-activators YAP/TAZ: potential therapeutic targets for metastatic breast cancer. Biomed. Pharmacother. 2021;133:110956. doi: 10.1016/j.biopha.2020.110956. [DOI] [PubMed] [Google Scholar]
  40. Zhong Z., Jiao Z., Yu F. X. The Hippo signaling pathway in development and regeneration. Cell Rep. 2024;43:113926. doi: 10.1016/j.celrep.2024.113926. [DOI] [PubMed] [Google Scholar]
  41. Zhou Y., Huang T., Cheng A. S., Yu J., Kang W., To K. F. The TEAD family and its oncogenic role in promoting tumorigenesis. Int. J. Mol. Sci. 2016;17:138–153. doi: 10.3390/ijms17010138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhou Y., Li H., Liang X., Du H., Suo Y., Chen H., Liu W., Duan R., Huang X., Li Q. The CCN1 (CYR61) protein promotes skin growth by enhancing epithelial-mesenchymal transition during skin expansion. J. Cell. Mol. Med. 2020;24:1460–1473. doi: 10.1111/jcmm.14828. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

bt-34-1-154-supple.pdf (336.9KB, pdf)

Articles from Biomolecules & Therapeutics are provided here courtesy of Korean Society of Applied Pharmacology

RESOURCES