Copper modulates cell fate through the PLK1–FOXO3a–β-catenin signaling pathway by differentially regulating cuproptosis and EMT

Abstract

Copper is essential for cellular homeostasis and can induce cuproptosis, a novel form of cell death. However, its effect on cancer progression, specifically through the regulation of epithelial-mesenchymal transition (EMT)—a primary driver of metastasis and treatment resistance in human cancers—remains unclear. This study assessed the dual role of copper in colorectal cancer cells, focusing on the polo-like kinase 1-forkhead box O3a-beta catenin (PLK1-FOXO3a-β-catenin) signaling pathway. Treatment with CuCl₂ (hereby referred to as Cu) alone facilitated EMT in SW480 and LoVo cells by upregulating PLK1 and downregulating FOXO3a that enhanced β-catenin activity without inducing cell death. In contrast, co-treatment with Cu and copper ionophore elesclomol (Cu-ES) triggered cuproptosis, a unique copper-dependent form of cell death, accompanied by mitochondrial dysfunction, dihydrolipoamide S-acetyltransferase aggregation, and ATP depletion. Specifically, Cu-ES treatment suppressed EMT by reducing PLK1 and activating FOXO3a that suppressed β-catenin-mediated transcription. Additionally, while Cu treatment alone had minimal effect on FOXO3a nuclear localization, Cu-ES treatment significantly enhanced FOXO3a nuclear translocation and its interaction with β-catenin, resulting in EMT gene repression. The PLK1 inhibitor BI-2536 recapitulated the effects of Cu-ES and exhibited synergistic activity when combined with Cu-ES, enhancing both cell death and EMT suppression. These findings highlight a novel regulatory mechanism of EMT through copper signaling and support copper-based combination therapies as a promising approach to simultaneously inhibit tumor growth and metastasis in colorectal cancer.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10495-025-02211-z.

Introduction

Colorectal cancer (CRC) is the third most frequently diagnosed malignancy worldwide, with over 1.9 million novel cases annually, and remains a leading cause of cancer-related mortality [1, 2]. Although early-stage CRC is manageable through surgery and chemotherapy, metastatic CRC poses significant challenges, with a 5-year survival rate of approximately 12% [3]. Conventional chemotherapies—5-fluorouracil, oxaliplatin, and irinotecan—are limited by drug resistance and toxicity [4]. Epithelial-mesenchymal transition (EMT) is a mechanism underlying metastasis, therapy resistance, and cancer cell stemness [5–8]. It involves the loss of E-cadherin and gain of transcription factors (Snail and Twist)-mediated mesenchymal traits, with Wnt/β-catenin signaling functioning as a primary upstream regulator [9]. In CRC, β-catenin accumulates in the nucleus owing to adenomatous polyposis coli mutations, upregulating genes that facilitate proliferation and EMT [10]. Additionally, E-cadherin downregulation releases β-catenin from cell junctions, facilitating nuclear translocation and transcriptional activity. EMT enhances the migratory and invasive properties of cancer cells and contributes to stemness and resistance to apoptosis and chemotherapy [9, 11–13]. Therefore, targeting EMT offers a promising therapeutic strategy to suppress metastasis and enhance therapeutic outcomes.

Copper is a crucial trace element involved in mitochondrial respiration, antioxidant defense, and protein folding. However, its dysregulation is implicated in oncogenesis [14–17]. Copper homeostasis is regulated by copper transporters, chaperones, and efflux pumps, reflecting its crucial role in maintaining physiological functions [18–20]. In contrast, excessive copper can induce cytotoxicity through oxidative stress and protein aggregation, highlighting its dual role [21, 22]. However, elevated intracellular copper levels can facilitate oncogenesis through enhanced proliferation, angiogenesis, and survival signaling [23, 24]—mitogen-activated protein kinase pathway activation and vascular endothelial growth factor-mediated angiogenesis [14, 25, 26].

The oncogenic dependence on copper has facilitated the exploration of copper-modulating strategies for cancer therapy, for example, cuproptosis—a novel form of regulated cell death distinct from apoptosis, ferroptosis, or necroptosis [27]. Cuproptosis is triggered by copper accumulation within the mitochondria, thereby aggregating lipoylated proteins—dihydrolipoamide S-acetyltransferase (DLAT)—resulting in proteotoxic stress, mitochondrial dysfunction, and cell death [27]. This process is enhanced by elesclomol (ES)—that transports copper ions into cells and mitochondria [28].

Recent transcriptomic and proteomic analyses have implicated cuproptosis-related genes in cancer progression and prognosis. In hepatocellular carcinoma, cuproptosis-associated gene expression profiles associate with patient survival [29, 30], whereas in gastric cancer, genetic and epigenetic alterations in cuproptosis regulators modulate disease outcomes [31]. Cuproptosis is induced more effectively in metabolically active cancer cells, including melanoma, breast, and drug-resistant cancers [32, 33]. However, how copper-induced stress interacts with EMT remains unclear.

Polo-like kinase 1 (PLK1), a mitotic regulator, is overexpressed in numerous human cancers and associated with poor prognosis [34, 35]. It facilitates EMT and epithelial cell motility by activating v-Raf-1 murine leukemia viral oncogene homolog 1/extracellular signal-regulated kinase signaling pathway [36] and regulates the functions of forkhead box O3a (FOXO3a), Fas-associated death domain-containing protein, and p53, through phosphorylation [37–39]. FOXO3a undergoes direct phosphorylation, resulting in cytoplasmic retention and functional inactivation. As a tumor suppressor, it plays crucial roles in apoptosis, DNA repair, and oxidative stress responses, with nuclear localization being crucial for suppressing malignant progression [40–42]. However, the potential involvement of the PLK1–FOXO3a signaling pathway in copper-induced cell death remains unclear.

In this study, we demonstrate that copper modulates cell fate in CRC by differentially regulating EMT and cuproptosis through the PLK1–FOXO3a–β-catenin signaling pathway. Our findings highlight a novel mechanistic association between copper-induced cell death and EMT suppression, offering novel therapeutic insights into copper-based anticancer strategies.

Materials and methods

Cell culture and reagents

Human CRC cell lines SW480 (KCLB 10228) and LoVo (KSCB 10229) were obtained from the Korean Cell Line Bank (KCLB, Seoul, Republic of Korea) and cultured in Roswell Park Memorial Institute 1640 medium (Welgene Inc., Gyeongsan, Republic of Korea) supplemented with 10% fetal bovine serum (Merck Millipore, Burlington, MA, USA) and 1% penicillin–streptomycin (Welgene). Cells were maintained at 37 °C in a humidified 5% CO₂ incubator (Thermo Fisher Scientific Inc., Waltham, MA, USA). Copper chloride (hereby referred to as Cu; Sigma-Aldrich, St. Louis, MO, USA) and ES (Sigma-Aldrich, St. Louis, MO, USA) were dissolved in distilled water and dimethyl sulfoxide (DMSO), respectively. Cell death inhibitors, such as benzyloxycarbonyl-Val-Ala-Asp(OMe)-fluoromethylketone, 3-methyladenine, ferrostatin-1, necrostatin-1, and tetrathiomolybdate (TTM), were purchased from MedChemExpress (Princeton, NJ, USA), dissolved in DMSO at recommended stock concentrations, and used at 1:1000 dilution. For PLK1 inhibition, BI-2536 (MedChemExpress) was prepared at 50 μM in DMSO and used at 5–500 nM for viability assays and 10 nM for functional experiments. For combination treatment, cells were pre-treated with BI-2536 (10 nM) for 12 h, followed by Cu-ES co-treatment (Cu 10 μM + ES 10 nM) for an additional 12 h. Control groups received equivalent volumes of DMSO.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell viability assay

Cell viability was measured using the MTT assay (VWR Chemicals, Radnor, PA, USA). MTT was prepared in phosphate-buffered saline (PBS) (Welgene) at a concentration of 2.5 mg/mL. SW480 and LoVo cells were seeded at a density of 8 × 10³ cells per well in 96-well plates and incubated for 16 h. Subsequently, the cells were treated with Cu (5–200 μM), ES (5–50 μM), or BI-2536 (10–500 nM), either alone or in combination, for 24, 48, or 72 h. At each time point, 200 μL of 0.5 mg/mL MTT solution was added to each well and incubated at 37 °C for 3 h. The solution was removed and 100 μL DMSO was added to dissolve the formazan crystals. Absorbance was measured at 570 nm (reference wavelength, 690 nm) using a microplate reader (Allsheng, Hangzhou, China).

Cell cycle analysis

SW480 and LoVo cells (5 × 10⁵) were seeded in 60 mm dishes and treated with indicated drugs for 12 h. The cells were harvested, washed twice with PBS, and fixed overnight at 4 °C in cold 75% ethanol. After fixation, the cells were washed and stained with propidium iodide (PI) (50 μg/mL) and RNase A (20 μg/mL) in PBS for 20 min in the dark. DNA content was analyzed by flow cytometry using a NovoCyte system (Agilent Technologies, Santa Clara, CA, USA).

Annexin V/PI dual staining assay

Apoptotic cell death was assessed using Annexin V-fluorescein isothiocyanate and PI dual staining. SW480 and LoVo cells (5 × 10⁵) were seeded in 60 mm culture dishes, treated with specified compounds for 12 h, harvested, and washed with cold PBS. After centrifugation, the cells were resuspended in 500 μL of Annexin V binding buffer, and stained with 10 μL Annexin V-fluorescein isothiocyanate and 5 μL PI, following the manufacturer’s protocol (BioLegend, San Diego, CA, USA). Samples were incubated in the dark at room temperature for 15 min and subsequently analyzed using a NovoCyte flow cytometer (Agilent Technologies).

Wound-healing assay

SW480 and LoVo cells (1 × 10⁶) were seeded in 60 mm dishes and cultured to 90–95% confluence. The cells were pretreated for 12 h with BI-2536 (10 nM), Cu (5 or 10 μM) or a Cu–ES combination (5 μM + 5 nM or 10 μM + 10 nM). Linear scratches were created using sterile 200 μL pipette tips, and detached cells were removed by PBS washing. Wound closure was monitored using phase-contrast microscopy at 0, 24, and 48 h.

Transwell migration assay

SW480 and LoVo cells were pre-treated for 12 h with Cu (5 and 10 μM) or Cu–ES combinations (5 μM + 5 nM and 10 μM + 10 nM) and incubated in serum-free medium for 4 h. Cells (5 × 10⁴) in 100 μL serum-free medium were seeded into the upper chambers of 8.0 μm pore-size Transwell inserts (Corning Inc., Corning, NY, USA), with 10% fetal bovine serum-containing medium in the lower chamber serving as a chemoattractant. After 24 h, non-migrated cells were removed, and migrated cells were fixed with 4% paraformaldehyde, stained with 0.5% crystal violet, and visualized using light microscopy.

ATP determination

Intracellular ATP levels were measured using an ATP determination kit (Invitrogen, Carlsbad, CA, USA). Cells (5 × 10⁵) were seeded in 60 mm dishes, treated with drugs for 12 h, and lysed in 1 × lysis buffer. After centrifugation (2500 rpm, 5 min, 4 °C), supernatants were collected. A reaction buffer containing luciferin and firefly luciferase was prepared following the manufacturer's protocol. Luminescence was measured using a luminometer (BioTek, Winooski, VT, USA), and ATP concentrations were determined from a standard curve.

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis

Total RNA was extracted using TRIzol reagent (Ambion, Austin, TX, USA) following the manufacturer’s protocol. RNA purity and concentration were assessed using a Nano Spectrophotometer (BMG Labtech, Ortenberg, Germany). cDNA was synthesized from 1 μg of RNA in a 20 μL reaction using M-MLV reverse transcriptase (Promega, Madison, WI, USA) and oligo dT primers. Quantitative real-time PCR was performed using SYBR Green qPCR PreMIX (Enzynomics, Daejeon, Korea) under the following conditions: initial denaturation at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Melting curve analysis was conducted from 60 to 95 °C to confirm specificity. Relative gene expression was calculated using the 2^(-ΔΔCt) method and normalized to β-actin. Primer sequences are listed in Table 1.

Table 1.

Primer sequences list

Primer name	TM	Sequence (5′ > 3′)
PLK1_F	59.3	CCTGCACCGAAACCGAGTTA
PLK1_R	59.3	AGCACCTCGGGAGCTATGTA
FOXO3_F	59.3	TCTAACGCCAGCACAGTCAG
FOXO3_R	59.3	CTGCCATATCAGTCAGCCGT
β-actin F	59.3	CCA CCA TGT ACC CTG GCA TT
β-actin R	61.4	CGG ACT CGT CAT ACT CCT GC
β-catenin_F	59.3	GCTGGGACCTTGCATAACCT
β-catenin_R	63.4	GCTTGCTTTCTTGGTTGCCA
E-cadherin_F	59.3	CCCAGGAGCCAGACACATTT
E-cadherin_R	59.3	TTAGGGCTGTGTACGTGCTG
Vimentin_F	57.3	GAGAACTTTGCCGTTGAAGC
Vimentin_R	59.4	TCCAGCAGCTTCCTGTAGGT

Western blotting

SW480 and LoVo cells were treated with Cu and ES at various concentrations for 12 h or BI-2536 (10 nM) for 24 h, harvested, washed with cold PBS, and lysed using radio-immunoprecipitation assay buffer supplemented with protease and phosphatase inhibitors (Roche, Basel, Switzerland). Protein concentrations were determined using the Bradford assay (Thermo Fisher Scientific). Equal amounts of protein were separated on 8–12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis gels and transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% skim milk for 30 min, incubated overnight at 4 °C with primary antibodies (1:1,000), followed by horseradish peroxidase-conjugated secondary antibodies (1:10,000) for 1 h at room temperature. Immunoreactive bands were detected using ECL reagent (GE Healthcare, Chicago, IL, USA) and visualized using a chemiluminescence system (Bio-Rad, Hercules, CA, USA). The following primary antibodies were used: poly(ADP-ribose) polymerase 1, cleaved caspase-3, caspase-9, receptor-interacting protein kinase 1, receptor-interacting protein kinase 3, solute carrier family 7 member 11, vimentin, and cellular myelocytomatosis oncogene (Cell Signaling Technology, Danvers, MA, USA); heme oxygenase 1, glutathione peroxidase 4, and DLAT (Abcam, Cambridge, UK); E-cadherin and β-catenin (BD Biosciences, San Jose, CA, USA); cyclin D1, cyclin D3, FOXO3a, and β-actin (Santa Cruz Biotechnology, Dallas, TX, USA); PLK1 (ABclonal, Woburn, MA, USA); and ferredoxin 1 (FDX1) (Proteintech, Rosemont, IL, USA).

Immunofluorescence analysis

Cells (1 × 10⁵) were seeded on coverslips and treated with Cu and ES for 12 h. After fixation with 4% paraformaldehyde, cells were permeabilized with 0.1% Triton X-100 and blocked with 5% skim milk for 1 h. Primary antibodies (1:100) were applied for 1 h, followed by Alexa Fluor 594-conjugated secondary antibodies (1:200, Invitrogen). Nuclei were counterstained with 4',6-diamidino-2-phenylindole (1:1000, Invitrogen). Coverslips were mounted, and fluorescence images were observed using a confocal microscope (Nikon Instruments Inc., Tokyo, Japan) and analyzed using NIS-Elements software.

Cytoplasmic and mitochondrial reactive oxygen species (ROS) analysis

Cells (5 × 10⁵) were seeded in 60 mm dishes and treated with specified drugs for 12 h. For ROS detection, cells were incubated with 5 μM MitoSOX Red (for mitochondrial superoxide; Invitrogen) or 10 μM 2′,7′-dichlorodihydrofluorescein diacetate (for cytoplasmic hydrogen peroxide; Invitrogen) at 37 °C. After washing with PBS, fluorescence was analyzed using a NovoCyte Flow Cytometer (Agilent). For imaging, 2 × 10⁵ cells were seeded in confocal dishes and treated similarly. Following staining with MitoSOX Red, 2′,7′-dichlorodihydrofluorescein diacetate, and Hoechst 33,342 (Sigma-Aldrich), fluorescent signals were captured using a Nikon confocal microscope and analyzed using NIS-Elements software.

Cytoplasmic and nuclear fractionation

Following drug treatment, the cells were washed with cold PBS, harvested by scraping, and centrifuged (2000 rpm, 4 min, 4 ℃) twice. Cell pellets were resuspended in hypotonic buffer (20 mM Tris–HCl [pH 7.4], 10 mM KCl, 2 mM MgCl₂, 1 mM ethylene glycol-bis[β-aminoethyl ether]-N,N,N′,N′-tetraacetic acid, 0.5 mM dithiothreitol, and protease/phosphatase inhibitors) and incubated on ice for 5 min. NP-40 (0.3–0.5%) was added and incubated for another 5 min. Samples were centrifuged (3500 rpm, 5 min) to separate the cytoplasmic supernatant and nuclear pellet. The cytoplasmic fraction was further clarified by centrifugation (13,000 rpm, 10 min, 4 ℃). The nuclear pellet was washed thrice with isotonic buffer (20 mM Tris–HCl [pH 7.4], 150 mM KCl, 2 mM MgCl₂, 1 mM ethylene glycol-bis[β-aminoethyl ether]-N,N,N′,N′-tetraacetic acid, 0.5 mM dithiothreitol, and inhibitors) and lysed in hypertonic buffer (20 mM Tris–HCl [pH 7.4], 500 mM NaCl, 2 mM MgCl₂, 1 mM ethylene glycol-bis[β-aminoethyl ether]-N,N,N′,N′-tetraacetic acid, 0.5 mM dithiothreitol, and inhibitors) for 30 min. After centrifugation (13,000 rpm, 30 min, 4 ℃), the nuclear protein fraction was collected.

Co-immunoprecipitation (co-IP)

Nuclear protein lysates (100 μg) were pre-cleared with 1 μg control IgG and 20 μL Protein G/A agarose beads at 4 °C for 1 h with rotation. After centrifugation (1500 rpm, 5 min, 4 °C), supernatants were divided into two aliquots (50 μg each) and incubated overnight at 4 °C with either 1 μg control IgG or 1 μg specific antibody. Subsequently, 15 μL Protein G/A beads (Calbiochem [Merck], San Diego, CA, USA) were added and incubated for 2 h at 4 °C. Immunocomplexes were pelleted by centrifugation, washed four times with cold radio-immunoprecipitation assay buffer, and resuspended in 50 μL sodium dodecyl sulfate sample buffer. Samples were boiled at 95 °C for 5 min, centrifuged, and the supernatants were collected for western blotting.

mRNA-sequencing analysis

LoVo cells were seeded in 60 mm dishes for 16 h and treated with vehicle, Cu (10 μM), ES (10 nM), or their combination for 24 h. Total RNA was extracted using the TRIzol reagent. RNA quality and quantity were assessed using the Agilent TapeStation 4000 and Invitrogen Qubit 4 fluorometer, respectively. RNA-seq libraries were prepared using the CORALL RNA-Seq V2 Library Prep Kit, including poly(A) mRNA isolation, cDNA synthesis, fragmentation, and Illumina indexing. Library size and concentration were assessed through TapeStation and qPCR. Sequencing was performed on an Illumina NovaSeq 6000 platform with paired-end 100 bp reads.

Data analysis

Raw sequencing data quality was assessed using FastQC. Adapter trimming and removal of low-quality reads were performed using Fastp. Cleaned reads were aligned to the reference genome using STAR, and transcripts were quantified using Salmon. Read counts were normalized using TMM and CPM methods through the Python "conorm" package. Data mining and visualization were conducted using ExDEGA software (Ebiogen Inc., Seoul, Korea).

Gene expression analysis using UALCAN

PLK1 and FOXO3 gene expression levels in colorectal adenocarcinoma were analyzed using UALCAN (http://ualcan.path.uab.edu/), a comprehensive web portal that uses The Cancer Genome Atlas cancer OMICS datasets. Expression profiles were assessed across various sample types, pathological stages, and lymph node metastasis status.

Statistical analysis

All experimental data were analyzed using GraphPad Prism 8.0 software. The results are expressed as the mean ± standard deviation (SD) from at least three independent experiments. Image quantification was performed using ImageJ, and flow cytometry data were processed using FlowJo software. Gene Ontology and Kyoto Encyclopedia of Genes and Genome pathway enrichment analyses were conducted using DAVID software. Statistical significance between groups was determined using Student’s t-test or one-way analysis of variance, with statistical significance set at P < 0.05.

Results

Cu-ES treatment induces cuproptosis in CRC cells

MTT assays assessed the anticancer efficacy of Cu and ES in human CRC cell lines (SW480 and LoVo). Treatment with Cu alone showed a concentration-dependent effect, where lower concentrations (< 25 μM) exerted little to no cytotoxicity, while higher concentrations (> 50 μM) induced slight but measurable reductions in cell viability. Similarly, ES alone (5–50 nM) caused modest but statistically significant cytotoxicity. In striking contrast, combined treatment with Cu and ES (Cu-ES) resulted in a dramatic increase in cell death, as further confirmed by annexin V-fluorescein isothiocyanate/PI dual staining (Fig. 1A and Fig. S1A). Specifically, treatment with 50 μM Cu alone exhibited limited cytotoxicity, whereas the combination of Cu and ES (50 μM Cu + 50 nM ES) induced a dramatically enhanced level of cell death. To elucidate the underlying cell death mechanism, we analyzed the primary markers of apoptosis, necroptosis, and ferroptosis. Cu-ES treatment did not increase cleaved caspase-3, caspase-9, poly(ADP-ribose) polymerase 1, receptor-interacting protein kinase 1, or receptor-interacting protein kinase 3 levels (Fig. S1B). Among ferroptosis-related proteins, only heme oxygenase 1 was modestly upregulated, whereas glutathione peroxidase 4 and solute carrier family 7 member 11 remained unaltered (Fig. S1C and S1D). Only tetrathiomolybdate (TTM), a copper chelator, restored cell viability, whereas inhibitors targeting apoptosis, necroptosis, or ferroptosis had no effect (Fig. 1B)—indicating a copper-dependent, non-classical cell death pathway. To confirm whether this form of cell death corresponds to cuproptosis, we assessed the primary molecular markers. Western blotting revealed a dose-dependent reduction in FDX1 expression (Fig. 1C and S1E), a primary cuproptosis regulator, further confirmed by immunofluorescence staining (Fig. S1F). DLAT aggregation, a characteristic of cuproptosis, increased dose-dependently (Fig. 1D, E, S1G and H). Cu-ES treatment dose-dependently increased both cytoplasmic and mitochondrial ROS (measured by flow cytometry and live-cell imaging; Fig. 1F, G and S2A), accompanied by a concentration-dependent reduction in intracellular ATP levels (Fig. S2B), indicating mitochondrial dysfunction and impaired energy metabolism. These findings demonstrated that Cu-ES treatment induces cuproptosis in CRC cells through FDX1 downregulation, DLAT aggregation, mitochondrial oxidative stress, and ATP depletion.

Fig. 1.

Combination treatment with CuCl₂ and elesclomol (ES) induces cuproptosis in colorectal cancer cells. A Time-dependent alterations in the viability of SW480 and LoVo colorectal cancer cells treated with CuCl₂ (Cu; 5–200 μM), ES (5–50 nM), or their combination for 48 h. Viability is assessed using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Data are presented as the mean ± standard deviation (n = 3). **P < 0.01 and ***P < 0.001 vs. untreated control; ns: not significant. B Effects of various cell death pathway inhibitors on Cu-ES (25 μM + 25 nM)-induced cytotoxicity. The cells are pre-treated with benzyloxycarbonyl-Val-Ala-Asp(OMe)-fluoromethylketone (apoptosis inhibitor, 10 μM), 3-MA (autophagy inhibitor, 5 μM), ferrostatin-1 (ferroptosis inhibitor, 10 μM), necrostatin-1 (necroptosis inhibitor, 20 μM), or tetrathiomolybdate (copper chelator, 10 μM) for 1 h, followed by Cu-ES treatment for 48 h. Cell viability is analyzed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. Data are presented as the mean ± standard deviation (n = 3). ***P < 0.001 vs. Cu-ES group. C Western blotting of ferredoxin 1 protein levels in response to increasing doses of Cu-ES for 12 h. β-actin is used as the loading control. D Detection of dihydrolipoamide S-acetyltransferase (DLAT) protein aggregation using western blotting after 12 h of Cu-ES treatment. Aggregated and total DLAT protein levels are examined in SW480 and LoVo cells. E Immunofluorescence analysis of DLAT localization following Cu-ES treatment. DLAT (red), nuclei (4',6-diamidino-2-phenylindole, blue), and merged images are shown. Scale bar = 20 μm. F Measurement of cytoplasmic reactive oxygen species generation by 2′,7′-dichlorodihydrofluorescein diacetate staining and flow cytometry in cells treated with Cu (50 μM) or Cu-ES for 12 h. G Mitochondrial reactive oxygen species production measured using MitoSOX staining and flow cytometry under similar conditions

Cu and Cu-ES treatments exhibits opposing effects on cell migration and EMT-related gene expression

SW480 and LoVo cells were pretreated with Cu (5 or 10 μM) or Cu-ES (5 μM + 5 nM or 10 μM + 10 nM) for 12 h, followed by wound-healing assays (Fig. 2A). Based on the MTT assay results showing minimal cytotoxicity at this time point (Fig. S3A), a 12-h pretreatment was selected to assess migration changes independently of cell death effects. Cu treatment enhanced cell migration, whereas Cu-ES suppressed it. Transwell migration assays confirmed these effects (Fig. 2B). To further explore whether these opposing effects were associated with EMT, we analyzed EMT-related gene expression using qRT-PCR and western blotting. Cu treatment (5, 10, 25, and 50 μM) dose-dependently reduced and increased E-cadherin and vimentin mRNA levels, respectively, indicating EMT induction. In contrast, Cu-ES (5–50 μM Cu + 5–50 nM ES) reversed these effects, indicating EMT suppression. Notably, β-catenin mRNA levels increased slightly under both treatment conditions (Fig. 2C). Western blotting (Fig. 2D and S3B) and immunofluorescence analyses demonstrated alterations consistent with mRNA expression trends (Fig. 2E and S3C). Immunofluorescence revealed nuclear β-catenin translocation in Cu-ES-treated cells. Despite its nuclear translocation, β-catenin transcriptional activity appeared inhibited under Cu-ES conditions, indicating involvement of regulatory mechanisms limiting its function.

Fig. 2.

CuCl₂ facilitates epithelial-mesenchymal transition, whereas Cu-elesclomol (ES) combination treatment inhibits colorectal cancer cell migration and epithelial-mesenchymal transition progression A Wound healing assay is performed to assess the migratory capacity of SW480 and LoVo cells following 12 h pre-treatment with Cu (5 and 10 μM) or Cu-ES (5 μM + 5 nM and 10 μM + 10 nM). Representative images at 0, 24, and 48 h post-wounding are shown; yellow dashed lines indicate the wound edges. B Transwell migration assay is performed to assess the migratory ability of SW480 and LoVo cells under treatment conditions similar to those used in the wound healing assay. Migrated cells are stained with crystal violet. C Quantitative reverse transcription-polymerase chain reaction analysis of the mRNA expression levels of epithelial-mesenchymal transition markers (E-cadherin, vimentin, and β-catenin) in cells treated with increasing concentrations of Cu (upper panels) or Cu-ES (lower panels) for 12 h. Gene expression is normalized to β-actin. Data are presented as the mean ± standard deviation (n = 3). D Western blotting of E-cadherin, vimentin, and β-catenin protein levels under similar treatment conditions as those in (C). β-actin is used as the loading control. E Immunofluorescence staining of β-catenin, E-cadherin, and vimentin in cells treated with Cu (25 μM), Cu-ES (25 μM + 25 nM), or untreated control for 12 h. Red: target proteins; blue: 4',6-diamidino-2-phenylindole nuclear staining; and merged images are shown. Scale bar = 20 μm. *ns: not significant; *P < 0.05, **P < 0.01, and ***P < 0.001 vs. untreated control

Transcriptomic analysis indicates differential regulation of the PLK1–FOXO3a pathway underlying the dual effects of copper treatments on β-catenin signaling

mRNA sequencing analysis in LoVo cells demonstrated that Cu (10 μM) and ES (10 nM) alone altered 50 and 40 genes, respectively, whereas Cu-ES (Cu 10 μM + ES 10 nM) altered 523 genes (Fig. 3A). In total, 560 differentially expressed genes were clustered into 12 expression patterns, mostly upregulated under Cu-ES treatment. Gene Ontology analysis revealed upregulated genes involved in copper ion response, chaperone-mediated protein folding, and endoplasmic reticulum stress and oxidative stress responses, whereas downregulated genes were associated with nucleosome organization, chromatin remodeling, cell cycle regulation, organelle organization, and cell migration (Fig. 3B). To explore the signaling pathways potentially involved in β-catenin regulation, Gene Ontology (GO) term–based enrichment analysis was performed using the DAVID database. Among the significantly enriched pathways, FOXO signaling was one of the most prominent (Fig. 3C). Heatmap analysis further revealed increased expression of FOXO3 and decreased expression of PLK1 following Cu-ES treatment. Notably, FOXO3a, a nuclear transcription factor known to interact with β-catenin [43], exhibited opposite expression patterns under Cu and Cu-ES treatments (Fig. 3D). Consistently, PLK1, which suppresses FOXO3a activity through phosphorylation and nuclear export [37], also showed an inverse expression pattern between Cu and Cu-ES treatments. Furthermore, FOXO3a transcriptional target genes—including CCND2, GADD45G, GADD45B, and GABARAPL1—displayed opposite expression trends between the two treatments, with Cu-ES promoting their upregulation, consistent with enhanced FOXO3a activity. Analysis of The Cancer Genome Atlas dataset using the UALCAN database revealed increased PLK1 expression in CRC tissues compared to that in normal tissues (Fig. 3E, left panel), peaking in advanced stages (Fig. 3E, right panel). In contrast, FOXO3a expression remained significantly unaltered across cancer stages. These results indicated that copper and Cu-ES treatments modulate EMT and migration by differentially regulating the PLK1–FOXO3a–β-catenin pathway.

Fig. 3.

Transcriptomic profiling identified differential gene expression and polo-like kinase 1–forkhead box O3a (FOXO3a) signaling pathway modulation in response to CuCl₂ and Cu-elesclomol (ES) treatments. A mRNA sequencing analysis is performed on LoVo cells treated for 12 h with CuCl₂ (10 μM) alone, elesclomol (10 nM) alone, or the Cu-ES combination (10 μM + 10 nM). The Venn diagram (left) illustrates the number of differentially expressed genes across the treatment groups. Differentially expressed gene expression profiles are further categorized into 12 distinct clusters based on their expression patterns (right), with red and green indicating upregulation and downregulation, respectively. B Gene Ontology analysis is performed for differentially expressed genes modulated by Cu-ES treatment, demonstrating enriched biological processes for upregulated (top) and downregulated (bottom) genes, plotted as -log₁₀(p-value). C Functional pathway enrichment analysis using DAVID identified significantly altered pathways in response to Cu-ES treatment, with pathway significance presented as -log₁₀(p-value) and corresponding gene counts. D Heatmap of selected genes associated with the FOXO signaling pathway (FOXO3, growth arrest and DNA damage-inducible beta, polo-like kinase 1, cyclin D2, growth arrest and DNA damage-inducible gamma, and gamma-aminobutyric acid receptor-associated protein-like 1). Expression alterations are normalized using Z-scores across treatment groups. Red indicates high expression, and blue indicates low expression. E mRNA expression levels of polo-like kinase 1 and FOXO3a in colorectal cancer are analyzed using the UALCAN database. Box plots illustrate expression in normal (blue) vs. primary tumor tissues (red), across cancer stages (Stage 1–4). Data are presented as median with interquartile range

Dual effects of Cu and Cu-ES treatments are mediated by PLK1–FOXO3a expression and FOXO3a–β-catenin transcriptional regulation

qRT-PCR revealed that Cu (5–50 μM) dose-dependently upregulated PLK1 and downregulated FOXO3a (Fig. 4A), whereas Cu-ES combination treatment (5–50 μM Cu + 5–50 nM ES) downregulated PLK1 and upregulated FOXO3a. Western blotting confirmed an inverse relationship between PLK1 and FOXO3a protein levels (Fig. 4B and S4A). Nuclear-cytoplasmic fractionation revealed increased nuclear FOXO3a accumulation with Cu-ES treatment (25 μM + 25 nM) than Cu (25 μM) (Fig. 4C and S4B)—that was further supported by immunofluorescence analysis (Fig. 4D and S4C). Co-IP using nuclear extracts revealed that FOXO3a interacts with β-catenin only in the Cu-ES treatment group (25 μM + 25 nM) but not with Cu alone (Fig. 4E). Analysis of β-catenin target genes revealed that Cu increased cyclin D1, cyclin D3, and cellular myelocytomatosis oncogene protein levels, but were significantly reduced under Cu-ES treatment (Fig. 4F and S4D). These results indicate that Cu-ES treatment induces FOXO3a nuclear accumulation, which binds to β-catenin and suppresses its transcriptional function—thereby explaining the differential outcomes in EMT and cell motility observed between Cu and Cu-ES treatments.

Fig. 4.

Cu-elesclomol (ES) combination differentially regulates the polo-like kinase 1 (PLK1)–forkhead box O3a (FOXO3a) pathway and disrupts FOXO3a–β-catenin transcriptional activity. A Quantitative reverse transcription-polymerase chain reaction is performed to measure PLK1 and FOXO3a mRNA expression in SW480 and LoVo cells following 12 h of treatment with Cu (5, 10, 25, and 50 μM) or Cu-ES combination (same Cu concentrations + matched elesclomol doses in nM). mRNA levels are normalized to β-actin. *ns: not significant; *P < 0.05, **P < 0.01, and ***P < 0.001 vs. untreated control. B Western blotting is used to assess PLK1 and FOXO3a protein levels under similar treatment conditions. β-actin is used as a loading control. C Subcellular fractionation followed by immunoblotting is used to analyze the nuclear and cytoplasmic localization of FOXO3a and β-catenin in cells treated with CuCl₂ (25 μM) or Cu-ES (25 μM + 25 nM) for 12 h. Lamin B1 and β-actin confirmed the nuclear and cytoplasmic fractions, respectively. D Immunofluorescence staining visualized FOXO3a localization under similar conditions. FOXO3a (red) and 4',6-diamidino-2-phenylindole (blue) are merged to assess nuclear translocation. Scale bar = 20 μm. E Co-immunoprecipitation is performed to assess the interaction between FOXO3a and β-catenin. β-catenin antibody is used for pulldown, with lamin B1 confirming nuclear input and IgG as a negative control. F Western blotting is used to assess the expression of β-catenin target genes (cyclin D1, cyclin D3, and cellular myelocytomatosis oncogene) under similar treatment conditions. β-actin is used as the loading control

PLK1 inhibition enhances FOXO3a expression and nuclear localization, facilitating its binding to β-catenin

Dose–response analysis revealed that BI-2536 induced cell death at 10 nM by specifically inhibiting PLK1 activity, as assessed by MTT assays. Because 10 nM BI-2536 caused minimal cytotoxicity, whereas higher concentrations (≥ 50 nM) resulted in pronounced cell death (Fig. S5A), cells were pretreated with 10 nM BI-2536 for 12 h, followed by replacement with fresh basal medium, to evaluate its anti-migratory effects independently of cytotoxicity. At this concentration, BI-2536 significantly reduced cell migration in both assays, indicating that PLK1 positively regulates migratory capacity (Fig. 5A, B). Furthermore, qRT-PCR and western blot analyses showed that BI-2536 upregulated E-cadherin, FOXO3a, and cyclin B1, while downregulating vimentin, cyclin D1, and cyclin D3. These findings suggest that PLK1 inhibition suppresses EMT and enhances FOXO3a expression at the transcriptional level, consistent with the effects observed following Cu-ES treatment (Fig. 5C, D, and S5B). Nuclear-cytoplasmic fractionation and immunofluorescence staining revealed that BI-2536 treatment increased nuclear FOXO3a accumulation, resembling the pattern induced by Cu-ES combination treatment (Fig. 5E, F, S5C and S5D). Co-IP analysis revealed that BI-2536 treatment significantly enhanced nuclear FOXO3a–β-catenin binding following PLK1 inhibition (Fig. 5G). These findings indicate that PLK1 inhibition facilitates FOXO3a upregulation, nuclear translocation, and enhanced binding to β-catenin, thereby attenuating β-catenin–driven transcription and EMT—supporting the PLK1–FOXO3a–β-catenin pathway as the primary mediator of divergent responses to Cu and Cu-ES treatments in CRC cells.

Fig. 5.

Polo-like kinase 1 inhibition by BI-2536 mimics the cellular and molecular effects of Cu-elesclomol (ES) combination treatment. A Wound healing assays are performed to assess the migratory capacity of SW480 and LoVo cells treated with the vehicle control or BI-2536 (10 nM) for 24 h. Representative images at 0, 24, and 48 h are indicated with yellow dashed lines, indicating wound margins (left panels), and quantification of wound closure percentages is provided (right panels). Data are presented as the mean ± standard deviation (n = 3). *P < 0.05 and ***P < 0.001 vs. untreated control. B Transwell migration assay is performed under similar conditions. Migrated cells are stained with crystal violet (left panels), and cell migration is quantified (right panels). Data are presented as the mean ± standard deviation (n = 3). *P < 0.05 and ***P < 0.001 vs. untreated control. (C) Quantitative reverse transcription-polymerase chain reaction analysis is used to measure the mRNA expression levels of E-cadherin, vimentin, and FOXO3a in cells treated with vehicle control or BI-2536 (10 nM) for 24 h. Expression levels are normalized to β-actin. Data are presented as the mean ± standard deviation (n = 3). **P < 0.01 and ***P < 0.001 vs. untreated control. D Western blotting is performed to assess protein levels of E-cadherin, vimentin, forkhead box O3a (FOXO3a), cyclin B1, cyclin D1 and cyclin D3 under similar treatment conditions, with β-actin as a loading control. E Subcellular localization of β-catenin and FOXO3a is analyzed using cytoplasmic and nuclear fractionation, followed by western blotting. Fraction purity is confirmed using β-actin (cytoplasmic marker) and lamin B1 (nuclear marker). F Immunofluorescence staining is performed to visualize FOXO3a subcellular localization after BI-2536 treatment. Red fluorescence indicates FOXO3a, blue indicates 4',6-diamidino-2-phenylindole nuclear staining, and merged images are shown. Scale bar = 20 μm. G Co-immunoprecipitation is used to assess the interaction between FOXO3a and β-catenin. β-catenin antibody is used for pulldown, and protein levels in total lysates are presented below. IgG served as the negative control, and lamin B1 is used as the nuclear marker

PLK1 inhibition potentiates Cu-ES–mediated disruption of EMT and cuproptosis through the FOXO3a–β-catenin signaling pathway in CRC cells

MTT assays, Annexin V/PI staining, and cell cycle analysis demonstrated that BI-2536 treatment (12 h) followed by Cu-ES (12 h) significantly enhanced cell death (Fig. 6A, B and S6A). To explore the effect of this sequential treatment on EMT-related gene expression, we performed qRT-PCR analysis. BI-2536 treatment followed by Cu-ES significantly upregulated E-cadherin and downregulated vimentin (Fig. 6C), and increased FOXO3a levels. Western blotting confirmed these observations. These findings confirmed the synergistic effects of PLK1 inhibition and subsequent Cu-ES treatment (Fig. 6D and S6B). Immunofluorescence staining and nuclear-cytoplasmic fractionation revealed significant nuclear FOXO3a accumulation (Fig. 6E, S6C and S6D). Co-IP analysis revealed enhanced FOXO3a–β-catenin interaction (Fig. 6F), consistent with the proposed role of the PLK1–FOXO3a–β-catenin signaling pathway as a crucial regulator of EMT. Additionally, western blotting and immunofluorescence analyses revealed increased DLAT aggregation and reduced FDX1 expression (Fig. 6G, H, S6E and S6F), indicating that the synergistic effects extend to cuproptosis regulation. These findings indicated that the PLK1–FOXO3a–β-catenin pathway represents a crucial regulatory node controlling both EMT and cuproptosis in CRC cells. Sequential targeting of this pathway with PLK1 pre-treatment followed by Cu-ES treatment may represent a promising therapeutic strategy.

Fig. 6.

BI-2536 enhances Cu-elesclomol (ES)–induced cell death and modulates forkhead box O3a, epithelial-mesenchymal transition, and cuproptosis-related pathways. A Annexin V-fluorescein isothiocyanate/propidium iodide dual staining followed by flow cytometry is performed to analyze cell death in SW480 and LoVo cells treated with vehicle control, BI-2536 (10 nM), Cu-ES (10 μM + 10 nM), or BI-2536 (10 nM) pre-treatment followed by Cu-ES (10 μM + 10 nM) for 12 h. Representative dot plots (left) and quantification of dead cell percentages (right) are presented. B Cell cycle profiles are assessed using flow cytometry after propidium iodide staining of cells treated under similar conditions. Representative histograms (left) and quantitative analysis of cell cycle distribution (right) are shown. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. untreated control. C Quantitative reverse transcription-polymerase chain reaction is conducted to assess mRNA expression levels of epithelial-mesenchymal transition markers (E-cadherin and vimentin) and FOXO3a in cells treated with vehicle control, Cu-ES (10 μM + 10 nM), or BI-2536 pre-treatment (10 nM) followed by Cu-ES. Expression levels are normalized to β-actin. Data are presented as the mean ± standard deviation (n = 3). *P < 0.05, **P < 0.01, and ***P < 0.001 vs. untreated control. D Western blotting is used to examine the protein expression of E-cadherin, vimentin, and FOXO3a. E Immunofluorescence staining is performed to determine FOXO3a subcellular localization in treated cells. FOXO3a is stained red, nuclei are counterstained with 4',6-diamidino-2-phenylindole (blue), and merged images are shown. Scale bar = 20 μm. F Co-immunoprecipitation is conducted to assess the interaction between β-catenin and FOXO3a. The upper panel represents proteins pulled down with anti-β-catenin antibody, whereas the lower panel represents total protein levels in the lysates. IgG served as the negative control and lamin B1 is used as the nuclear marker. G Western blotting is performed to assess dihydrolipoamide S-acetyltransferase aggregation and ferredoxin 1 expression. Aggregated and total DLAT protein levels are presented in the upper and middle panels, respectively, and ferredoxin 1 expression is presented in the lower panel. β-actin is used as a loading control. H Immunofluorescence staining is used to assess the subcellular localization of dihydrolipoamide S-acetyltransferase in cells. Dihydrolipoamide S-acetyltransferase (red), 4',6-diamidino-2-phenylindole (blue), and merged images are shown. Scale bar = 20 μm

Discussion

Dysregulation of metal ion homeostasis is a characteristic of various malignancies, with evidence associating it with tumor progression, metastasis, and therapy resistance [17]. Among metal ions, copper plays a significant role in cancer biology [23]. Increased copper levels have been documented in various tumor types and are associated with enhanced angiogenesis, proliferation, and metastatic potential [15, 24, 25]. Recently, copper has been implicated in cuproptosis, a regulated form of cell death characterized by mitochondrial protein aggregation and metabolic disruption [22, 27]. This discovery has positioned copper as a pro-tumorigenic element and potential therapeutic target. Notably, cancer cells accumulate copper more readily than normal cells, and copper ionophores selectively induce cuproptosis in malignant cells [44]. However, primary questions regarding biomarker identification, mechanistic clarity, and therapeutic selectivity remain unresolved. Additionally, the paradox of copper supporting tumor growth under homeostatic conditions while inducing cell death upon overload remains poorly understood.

In this study, we identified a novel regulatory mechanism in CRC that links copper metabolism to EMT and cell death through the PLK1–FOXO3a–β-catenin pathway. While the individual components of this axis have been previously characterized in cancer biology, our work is the first to demonstrate its regulation by copper-dependent mechanisms, establishing it as a molecular switch that integrates copper signals to determine cell fate (Fig. 7). We found that cellular responses to copper depend critically on both its chemical form and mode of delivery. Specifically, Cu alone upregulated PLK1 and suppressed FOXO3a, thereby promoting EMT and invasion, whereas Cu–ES reversed these effects by downregulating PLK1, inducing FOXO3a nuclear translocation, and triggering cuproptosis. This bidirectional, copper-dependent regulation defines a novel mechanistic link between metal ion homeostasis and tumor suppressor pathway control.

Fig. 7.

Schematic model illustrating copper-induced regulation of cuproptosis and epithelial-mesenchymal transition through the polo-like kinase 1-forkhead box O3a-beta-catenin pathway. Copper treatment increases polo-like kinase 1 expression, resulting in forkhead box O3a inhibition and β-catenin nuclear translocation that enhances epithelial-mesenchymal transition-related gene expression. In contrast, co-treatment with CuCl₂ and elesclomol (Cu-ES) facilitates cuproptosis through dihydrolipoamide S-acetyltransferase aggregation and mitochondrial dysfunction while simultaneously suppressing polo-like kinase 1 and activating forkhead box O3a. Nuclear forkhead box O3a interacts with β-catenin to inhibit its transcriptional activity, thereby repressing epithelial-mesenchymal transition

PLK1, a mitotic kinase overexpressed in CRC and associated with poor prognosis [35, 45], regulates glucose metabolism [46] and facilitates EMT [36]. Here, we further demonstrate that PLK1 suppresses FOXO3a, [37] reducing epithelial marker expression while enhancing mesenchymal gene expression to promote EMT. FOXO3a, a tumor-suppressive transcription factor, mediates cell cycle arrest, apoptosis, and oxidative stress responses [41, 42], and its nuclear localization is critical for transcriptional activity and favorable prognosis [42, 47, 48]. We show that nuclear FOXO3a physically interacts with β-catenin, inhibiting its transcriptional activity and suppressing mesenchymal gene expression, thus stabilizing epithelial identity and antagonizing EMT. PLK1 inhibition restored FOXO3a activity and reversed EMT phenotypes, confirming its central role in copper-mediated EMT regulation.

Low-dose Cu activated mitogen-activated protein kinase and transforming growth factor beta/Smad signaling pathways [49, 50], upregulated EMT-associated transcription factors (Snail and Twist) [51], and reduced E-cadherin while increasing vimentin expression [52]. These findings align with increased tissue copper levels, enhanced metastasis, and poor clinical outcomes in patients with CRC [53]. In contrast, Cu–ES facilitated cuproptosis via mitochondrial stress, FDX1 depletion, and DLAT aggregation [27]. PLK1 inhibition using BI-2536 further enhanced Cu–ES–induced cell death [27], suggesting a potential combinatorial strategy, although pharmacokinetic limitations of BI-2536 may constrain its standalone efficacy [54, 55].

Although our study did not include in vivo xenograft experiments, the therapeutic potential of Cu-ES is supported by extensive preclinical evidence. Cu-ES has demonstrated significant anticancer efficacy in xenograft models of CRC [28, 56], glioblastoma [57], ovarian cancer [58], and hepatocellular carcinoma [59], consistently showing substantial tumor growth inhibition. Mechanistically, p53 enhances Cu-ES–induced cuproptosis via FDXR-mediated FDX1 upregulation, promoting mitochondrial protein aggregation and cell death [60]. Engineered RAP-anchored copper-escorting liposomes targeting FDX1 in glioblastoma have also exhibited potent tumor suppression in xenograft models [61]. Beyond cuproptosis, FDX1 activates IRF3/IFN-β signaling to promote PANoptosis in diffuse large B-cell lymphoma, demonstrating the multifaceted cytotoxic mechanisms elicited by Cu-ES [62]. Furthermore, cuproptosis has been shown to inhibit tumor progression and enhance cisplatin sensitivity in ovarian cancer [58]. Collectively, these studies suggest that FDX1-dependent Cu-ES–induced cell death pathways are likely to translate into significant antitumor effects in vivo, providing a strong rationale for future xenograft studies and potential clinical applications.

Finally, the clinical relevance of the PLK1–FOXO3a–β-catenin axis is supported by the correlation of PLK1 overexpression with poor prognosis in CRC [63], and the prevalence of aberrant Wnt/β-catenin signaling in approximately 80% of CRC cases [64]. Future studies using CRC-specific xenograft models and tissue microarrays will be essential to validate these findings in vivo, elucidate the precise transcriptional regulators driving PLK1 expression, and identify predictive biomarkers for copper-targeted therapies.

In conclusion, we demonstrate that the PLK1–FOXO3a–β-catenin signaling axis functions as a copper-dependent cell fate switch, integrating copper metabolism, EMT, and programmed cell death. PLK1 inhibition enhances copper overload–induced cytotoxicity while mitigating pro-metastatic effects under sublethal conditions. These findings advance our understanding of copper signaling in cancer and provide a mechanistic framework for developing combination therapies that simultaneously target metastasis and survival pathways in CRC.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

H.L performed most experiments and wrote main manuscript text. J.P., D.K., D.K., M.Y., W.C., H.N. assisted and performed some of experiments. S.C. performed bio-informatics analysis. Y.T.O and K.K. supported the experiments by grants and wrote main manuscript text with organizing figures.

Funding

This work was supported by funding from the National Research Foundation of Korea (2016R1D1A3B02006754), and the National Research Foundation of Korea grant (RS-2025-00515674), Republic of Korea. Additional support was also provided by the RISE Program through the Kangwon RISE Center, funded by the MOE and Kangwon-do (2025-RISE10-002). We thank the helpful assistants of the Korea Basic Science Institute (KBSI) and the National Research Facilities & Equipment Center (NFEC). We also would like to thank Editage (www.editage.co.kr) for English language editing.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Conflict of interest

The authors declare no competing interests.