Skip to main content
RNA Biology logoLink to RNA Biology
. 2026 Jan 9;23(1):1–23. doi: 10.1080/15476286.2026.2613892

RGG-motif protein Scd6 affects oxidative stress response by regulating cytosolic caTalase T1 (Ctt1)

Sweta Tiwari a, Chitra Togra a, Sudharshan Sj b, Purusharth I Rajyaguru a,
PMCID: PMC12795261  PMID: 41517915

ABSTRACT

In response to stress, cells undergo gene expression reprogramming to cope with external stimuli. Cells utilize a conserved stress response mechanism called global downregulation of translation, leading to the storage of translationally repressed mRNAs in RNA granules. During oxidative stress induced by H2O2, genes responsible for combating oxidative stress, such as catalases, are strongly induced. However, the post-transcriptional regulatory events affecting these genes during H2O2 stress are not well-explored. Scd6, an RGG-motif-containing protein in yeast, acts as a translational repressor through its interaction with eIF4G1. This study identifies the role of Scd6 in oxidative stress response by regulating cytoplasmic catalase T1 (CTT1). We observe that peroxide stress induces the assembly of Scd6 puncta, which do not colocalize with P-bodies or stress granules. Scd6 overexpression increased sensitivity, while deletion enhanced tolerance to H2O2 treatment. Increased ROS accumulation and decreased Ctt1 protein levels were observed upon Scd6 overexpression due to translation repression of CTT1 mRNA. CTT1 mRNA interacts with Scd6. smFISH analysis and RNA immunoprecipitation studies reveal that localization of Scd6 to puncta upon peroxide stress reduces its interaction with CTT1 mRNA, allowing derepression. The role of Scd6 in peroxide stress response is conserved since the human homolog LSm14A also localizes to puncta upon H2O2 stress, and its overexpression reduces survival in response to peroxide stress. Overall, this study identifies a unique example of translation regulation whereby stress-induced localization of the translation repressor protein to puncta leads to derepression of the target mRNA.

KEYWORDS: Post-transcriptional control, catalase, Scd6, reactive oxygen species, oxidative stress

Introduction

Under stress conditions, reprogramming gene expression is necessary for a cell to respond to external stimuli. As translation is a highly complex and energy-intensive process, its regulation under stress conditions is crucial for the cell. Global downregulation of translation is a conserved stress response mechanism employed by cells to re-orient their gene expression programmes [1,2]. Translationally repressed mRNAs are often stored in RNA-protein complexes known as RNA granules or RNP condensates [3], which are conserved and have dynamic structures. Upon various stresses such as glucose starvation, heat shock and nitrogen starvation, cells form membrane-less cytoplasmic bodies such as stress granules or P bodies [4–8]. Cytoplasmic RNA granules are sites of mRNA storage and degradation [4].

Upon H2O2-induced oxidative stress, there is a strong induction of genes involved in combating oxidative stress such as catalases [5] and glutathione peroxidase. These enzymes can neutralize H2O26. While previous studies have established correlations between transcriptional changes and H2O2 stress [2,7–9], post-transcriptional regulatory events remain poorly explored. Catalase is a haem-containing antioxidant enzyme that is induced in response to oxidative stress, heat shock and starvation [10,11]. In yeast, cytoplasmic catalase is coded by CTT1 (Cytoplasmic CaTalase T1) gene and peroxisomal catalase is encoded by the CTA1(Catalase A) gene [12]. Transcriptional regulation of CTT1 has been reported by proteins such as Msn2p/Msn4p, Hog1p, Hap1p, Yap1p, and Zap1p, which act on upstream activating elements (UAS) in the CTT1 promoter [11,13,14].

RNA-binding proteins play a key role in mediating various steps required for the translational regulation. RGG motif proteins are an emerging and second-largest class of RNA binding proteins [15,16]. These proteins are characterized by the presence of Glycine and Arginine repeats, also termed RGG/RG Box [16]. RGG motif proteins play functional roles in various physiological processes such as transcription, pre-mRNA splicing, DNA damage, regulation of apoptosis and mRNA translation [16]. Apart from interacting with RNA, the RGG-motif proteins can also interact with proteins [16]. Often RGG-motifs are fused to canonical RNA and protein interaction domains, which enhance their ability to regulate mRNA fate [17,18].

Scd6, an RGG motif-containing protein in S. cerevisiae, represses translation by preventing the formation of the 43S pre-initiation complex by binding to eIF4G via its RGG-motif [19]. However, the integrity of the cap-binding complex is not lost during repression which suggests that the repressed mRNA can re-enter translation in response to specific physiological cues. Arginine methylation of the RGG-motif augments the interaction between Scd6 and eIF4G, which enhances the translation repression [20]. Scd6 binds itself in RGG-motif dependent manner and self-association regulates its repression activity [21]. Although Scd6 has important roles as a translational repressor and an indirect decapping activator [22], knowledge about its impact and detailed analysis of specific mRNA targets remains unknown. Interestingly, RNA-Seq analysis of polysome-associated mRNAs in the scd6∆ strain suggests an increased translational efficiency of CTT1 mRNA [23].

In this study, we explored the role of Scd6 in the oxidative stress response by translational regulation of CTT1. Scd6 represses CTT1 mRNA translation under-unstressed conditions via its interaction. However, the peroxide treatment reduces this interaction as it induces localization of Scd6 to puncta, devoid of CTT1 mRNA, leading to its derepression. Our results identified a physiological role for Scd6 in the oxidative stress response, which has been extended to the human homolog LSm14A.

Results

Scd6 localizes to puncta in response to H2O2 stress

Scd6 is known to localize to stress granules and P bodies upon glucose starvation, genotoxic stress and sodium azide stress [19,24,25]. We hypothesized that Scd6 might localize to cytoplasmic puncta in response to other stresses; therefore, we tested the localization of Scd6 in response to 4 mM H2O2 using live-cell imaging. We observed that Scd6 localized to the puncta upon treatment with 4 mM H2O2 (Figure 1A,B). To understand whether the Scd6 puncta contained mRNA, we examined the impact of cycloheximide treatment on Scd6 granules. Cycloheximide (CHX) is a well-established inhibitor of translation elongation that stabilizes polysomes by stalling ribosomes on mRNAs, thereby preventing the release of non-translating mRNAs into the cytoplasm which is an essential prerequisite for RNA granule formation [26]. The Scd6 puncta that formed in response to H2O2 treatment disappeared in response to CHX treatment (Figure 1A,B), suggesting that puncta likely contains mRNA. We observed that the number of Scd6 puncta formed in response to H2O2 stress decreased upon transferring the cells to H2O2-free medium (recovery), suggesting that these puncta are potentially dynamic (Figure 1A,B). Figure 1B has also been re-plotted with error bars representing ± SD, and these versions are included in Supplementary Figure S1A. For improved clarity and representation, the middle sections are presented throughout the manuscript. Additionally, the projected images corresponding to Figure 1A, along with their quantification, are provided in Supplementary Figure S1B and S1C.

Figure 1.

Figure 1.

Scd6 localizes to cytoplasmic puncta upon H2O2 stress- (A) Live cell imaging of WT cells transformed with pRS316 Scd6-GFP plasmid in untreated, 4 mM H2O2,CHX and recovery conditions (60 minutes) (B) Quantification for the Scd6 puncta formation in (A), (C) Live cell imaging of Scd6-GFP strain transformed with pRS416 Edc3mCh in untreated, 4 mM H2O2 treated condition (D) Quantification for Scd6-GFP, Edc3mCherry puncta formation, (E) Live cell imaging of Pab1RFP cells transformed with pRS316 Scd6GFP plasmid in untreated, 4 mM H2O2 treated condition. Data plots represent mean ± SEM from n = 3, where ‘n’ represents number of independent experiments. Two tailed paired student’s t- test was used to calculate the statistical significance ‘*’. Asterisks indicate levels of statistical significance: p < 0.05 (*), p < 0.01 (**).

To determine the identity of the Scd6 puncta formed in response to H2O2 treatment, we examined the colocalization of Scd6 with Edc3 (core P body marker) and Pab1 (SG marker). Edc3 localized to the puncta upon H2O2 treatment [26]. We observed the induction of Scd6 and Edc3 puncta upon 4 mM H2O2 treatment (Figure 1C,D). Figure 1D has also been re-plotted with error bars representing ± SD and is included in Figure S1D. Co-localization experiments between Scd6 and Edc3 (a P-body marker) indicated that Scd6 localized very poorly to P-bodies upon H2O2 treatment (Figure S1E). To further test whether Scd6 granules formed upon H2O2 treatment were stress granules, co-localization experiments were performed between Scd6 and the stress granule marker, Pab1. Live-cell imaging was performed on a Pab1RFP strain transformed with pRS316 Scd6GFP plasmid. The H2O2 treatment did not induce Pab1 puncta formation (Figure 1E), although Scd6 puncta were visible. This is consistent with previous observations where H2O2 treatment did not induce stress granules in S. cerevisiae [26]. To assess whether the kinetics of stress granule formation are delayed under H2O2 treatment, cells were exposed to H2O2 for extended durations to monitor the temporal dynamics of granule assembly. Pab1-containing stress granules were not detected, even after prolonged exposure to hydrogen peroxide for up to 90 min (Figure S1F). In contrast, Scd6 displayed more punctate structures with longer treatment durations, as shown in Figure S1F. The change in the localization of Scd6 to dynamic cytoplasmic puncta provided an important clue about the possible role of Scd6 in response to H2O2 stress. We examined two additional markers to further assess the identity of the Scd6 puncta induced upon H2O2 stress: Pub1 (a stress granule marker) and Lsm1 (a core P-body marker). Consistent with previous reports that stress granules are not formed during H2O2 stress, Pub1 also failed to form puncta (Figure S4G). Lsm1 did not show puncta induction under these conditions, whereas Scd6 did (Figure S4H).

Modulation of Scd6 levels influences cellular tolerance to H2O2-induced oxidative stress

Since Scd6 was localized to puncta upon H2O2 treatment (Figure 1), we wondered whether Scd6 plays a role in H2O2-induced oxidative stress. To test the physiological role of Scd6 in oxidative stress, we performed a colony-forming unit (CFU) count assay and a growth curve analysis of the scd6∆ strain in the presence of 4 mM H2O2. From the colony-forming unit count assay, we observed that scd6∆ cells were more tolerant to 4 mM H2O2 stress than wild-type cells (Figure 2A). Growth curve analysis of wild type (WT) and scd6∆ confirmed this observation (Figure 2B). Growth curve analysis was performed across a range of H2O2 concentrations from 1 to 4 mM (Figure S2 A-C and Figure 2B). Notably, among the tested concentrations, an increased tolerance of scd6Δ cells was observed at 4 mM H2O2 (Figure 2B). In contrast, the overexpression of Scd6 from a 2µ plasmid rendered cells more sensitive to oxidative stress, as demonstrated by the colony-forming unit (CFU) assay (Figure 2C) and growth curve analysis (Figure 2D). This sensitivity appeared to be dependent on the RGG motif of Scd6, as the Scd6ΔRGG mutant did not exhibit the same H2O2-induced sensitivity as observed with the full-length protein (Figure 2C,D). For the growth curve assays, we used the ctt1∆ strain as a control, which is known to exhibit hypersensitivity to peroxide treatment [5]. Consistent with the previous observations, ctt1∆ strain showed sensitivity to H2O2 treatment (Figure 2B,D). Growth curve analysis was conducted for 1–4 mM H2O2, and at all the tested concentrations, overexpression of Scd6 increased the sensitivity of cells to H2O2 stress in a manner dependent on its RGG motif (Figure S2 D-F and Figure 2D). Based on these results, it appears that the modulation of Scd6 levels influences the cellular response to H2O2-induced stress.

Figure 2.

Figure 2.

Modulation of Scd6 levels influences cellular tolerance to H2O2-induced oxidative stress -mid-log phase WT cells and scd6∆ treated with 4 mM H2O2 for 30 minutes were plated and scored for their absolute CFU count (treated/untreated) (A) CFU count assay (B) Growth curve showing the survival of WT, scd6∆ and ctt1∆. both the CFU count assay and the growth curve analysis were performed under same conditions (p < 0.0001 for WT vs. WT H2O2, scd6∆ vs. scd6∆ H2O2 and ctt1∆ vs. ctt1∆ H2O2). (C) CFU count assay (D) Growth curve showing the survival of WT strain transformed with pYES EV/Scd6GST/Scd6GSTRGG and ctt1∆ upon 4 mM H2O2 treatment. Data plots represent mean ± SEM for n = 6. Two-tailed paired student’s t- test was used to calculate the statistical significance ‘*’ for the CFU count assays. Tukey’s test for variance was used to calculate the statistical significance ‘*’ for growth curve-experiments (n = 4) (p < 0.0001 for EV vs. EV H2O2, Scd6GST vs. Scd6GST H2O2, Scd6GSTRGG vs. Scd6GSTRGG H2O2 and ctt1∆ vs. ctt1∆ H2O2) (E) Quantification for relative ROS % upon Scd6 overexpression in untreated and H2O2 treated condition. Absolute intensities were not plotted due to variability in ROS intensity ranges across experiments (F) Live-cell imaging for DCFDA stained yeast cells for the relative ROS % in WT, scd6∆ and ctt1∆. Violin plot depicting the raw integrated density plotted for the DCFDA signal. Data plots represent mean ± SEM from n = 3, where ‘n’ represents number of independent experiments. One-way ANOVA was used to calculate the statistical significance ‘*’. Asterisks indicate levels of statistical significance: p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p < 0.0001 (****).

Reactive oxygen species levels are modulated by Scd6 in response to H2O2 treatment

H2O2 stress leads to increased levels of cellular reactive oxygen species (ROS). The increased sensitivity to H2O2 stress in cells overexpressing Scd6 from a 2µ plasmid indicated that ROS levels could increase under the same conditions. To test this hypothesis, we performed DCFDA staining to assess ROS levels. Upon H2O2 treatment, we observed an increased ROS accumulation in cells overexpressing Scd6 compared to those carrying the empty vector control (Figure 2E). Conversely, live-cell imaging following DCFDA staining of scd6∆ cells indicated significantly reduced accumulation of ROS compared to the WT cells upon H2O2 exposure (Figure 2F). This observation was consistent with the fluorescence intensity measurements obtained using a plate reader (data not shown). The ctt1∆ strain was used as a positive control to confirm ROS accumulation under H2O2 stress conditions [12,27,28] (Figure 2F). This result suggests a possible role of Scd6 in modulating changes in ROS accumulation in response to H2O2 treatment.

Scd6 modulates Ctt1 protein levels

Catalase plays an important role in mitigating H2O2 stress. A high-throughput study suggested that Cytosolic CaTalse T1 (CTT1) mRNA had more ribosome occupancy and translational efficiency in scd6∆ mutant without significant change in mRNA stability [23]. Therefore, we hypothesize that the observed changes in ROS levels under scd6∆ and Scd6 overexpression conditions may be associated with alterations in Ctt1 protein levels.

Scd6 functions as a translational repressor, and one possible mechanism by which it may influence Ctt1 levels is through repression of its translation. If Scd6 play a role in repressing CTT1 translation in the absence of stress, then it could be anticipated that Ctt1 levels would increase in the absence of Scd6 due to the derepression of CTT1 mRNA. Therefore, we checked Ctt1GFP protein levels in scd6∆, which were observed to be higher than the WT in mid-log phase cells (Figure 3A,B). After H2O2 treatment, we observed the induction of Ctt1 in WT but not in scd6∆. The absolute values for Figure 3A,B are replotted in Figure S3A. Under these conditions, there was no significant difference in CTT1 mRNA levels between WT and scd6∆ (Figure S3B). These findings suggested that Scd6 may contribute to the H2O2 stress response, possibly by modulating Ctt1 protein levels.

Figure 3.

Figure 3.

Scd6 affects Ctt1 levels via its RGG-motif- (A) Ctt1-GFP protein levels in WT and scd6∆ under untreated and 4 mM H2O2 condition (B) Quantification for (A). Data plots represent mean ± SEM from n = 5. Data plots represent mean ± SEM from n = 9. (C) Ctt1-GFP protein levels upon Scd6GST overexpression in untreated and 4 mM H2O2-treated (30 minutes) (D) Quantification for Ctt1 protein levels in (C) Data plots represent mean ± SEM from n = 5. Data plots represent mean ± SEM from n = 7 (E) Ctt1-GFP protein levels upon Scd6GST/Scd6GST∆RGG overexpression upon 4 mM H2O2 treatment for 30 minutes (F) Quantification for (E). The GFP, GST signal was detected using α-GFP, α-GST antibody. Ponceau was used as a loading control. Data plots represent mean ± SEM from n = 3 (G) Polysome profile analysis of WT cells under untreated and H2O2-treated conditions. (H) Log2 fold-change (log2fc) values depicting the distribution of CTT1 mRNA across polysomal fractions in WT cells. Data are presented as mean ± SEM from n = 4 independent experiments. Statistical significance was assessed using a one-way ANOVA. Asterisks indicate levels of statistical significance: p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p < 0.0001 (****).

Since scd6Δ cells exhibit increased Ctt1 levels, it is plausible that the overexpression of Scd6GST from a high-copy number plasmid, such as 2µ may contribute to the repression of CTT1 mRNA. qRT-PCR analysis of SCD6 mRNA levels confirmed the overexpression of Scd6 under Scd6GST overexpression condition (Figure S3C). Additionally, to verify the protein expression, a GST-tagged version of Scd6 was introduced into a Scd6-myc background. Western blot analysis comparing this construct to an empty vector control further confirmed the expression of the tagged protein, as shown in Figure S3D. We tested the effect of Scd6 overexpression from a 2µ plasmid on Ctt1 protein levels in 4 mM H2O2-treated mid-log phase cells. We observed increased protein levels of Ctt1 upon exposure to H2O2 stress in WT; however, Scd6 overexpression in cells treated with H2O2 not only inhibited the induction of Ctt1 levels but also led to a significant decrease in Ctt1 protein levels (Figure 3C,D). Interestingly, Scd6 overexpression did not affect Ctt1 levels in the absence of stress (Figure 3C,D). Notably, we also observed a reduction in Scd6GST levels under conditions of H2O2 stress (Figure 3C). The absolute data points corresponding to Figure 3D have been replotted and are presented in Figure S3E. No significant difference was observed in CTT1 mRNA levels upon overexpression of Scd6 with respect to EV (Figure S3F).

Scd6 can repress mRNA translation by binding to eIF4G via its RGG motif, thus inhibiting the formation of the 43S pre-initiation complex [19]. We hypothesized that the RGG motif of Scd6 affects Ctt1 protein levels. Therefore, we checked Ctt1 protein levels upon overexpression of Scd6GST∆RGG and observed that the overexpression of this variant did not decrease Ctt1GFP protein levels similar to the full-length Scd6GST (Figure 3E,F). This indicated that the RGG motif of Scd6 is important for mediating CTT1 repression. The absolute data points corresponding to Figure 3E have been replotted and are presented in Figure S3G. The overexpression of Scd6GST∆RGG did not sensitize cells to H2O2 stress unlike full-length Scd6GST, highlighting the critical role of the RGG motif in this response (Figure 2C,D).

CTT1 levels increased upon exposure to peroxide stress. One possible explanation is that CTT1 regulation may occur, at least in part, at the translation level in response to H2O2 stress. To explore this, we examined the association between CTT1 mRNA and the polysomes under H2O2-treated conditions. Under untreated conditions, WT cells displayed typical polysome profiles with visible 40S, 60S, 80S, and polysome peaks (Figure 3G). In contrast, H2O2-treated samples showed a marked collapse of polysomes (Figure 3G), consistent with previous reports that acute oxidative stress disrupts global translation, often through inhibition of the initiation or elongation steps [8]. We observed an increase in CTT1 mRNA association with polysomes in WT cells upon 4 mM H2O2 treatment (Figure 3H), suggesting translational upregulation under oxidative stress. This observation indicates that elevated CTT1 localization to polysomes indicates a stress-induced translational activation of CTT1 mRNA.

Scd6 interacts with CTT1 mRNA and this interaction is reduced upon peroxide stress

We observed that in response to 4 mM H2O2 treatment, there was translational upregulation of CTT1 mRNA in the polysomes. Since Scd6 affects Ctt1 protein levels without affecting mRNA levels, we hypothesized that Scd6 could interact with CTT1 mRNA to regulate its translation. To investigate the interaction between Scd6 and CTT1 mRNA in WT cells under the same conditions, we assessed CTT1 mRNA binding to endogenous myc-tagged Scd6. RNA immunoprecipitation (RIP) was performed using an anti-myc antibody in a strain expressing Scd6-myc, and the enrichment of CTT1 was checked using two independent primer pairs targeting different regions of the CTT1 transcript (Figure 4A). Scd6-myc was enriched in the immunoprecipitated fraction, confirming the efficiency of the pull-down assay (Figure 4B). We detected the enrichment of CTT1 mRNA in Scd6-myc pull-down cells compared to wild-type cells (Figure 4C). Interestingly, upon treatment with H2O2, the enrichment of CTT1 mRNA in Scd6-myc pull-downs was markedly reduced (Figure 4C). This suggests that Scd6–CTT1 mRNA interaction may be modulated in response to oxidative stress. The absolute values in Figure 4C are shown in Figure S4A. RAD50, previously reported to interact with Scd6 [29], served as a positive control, while ACT1 was used as a negative control. As anticipated, RAD50 mRNA was enriched (Figure S4B), whereas ACT1 mRNA was not (Figure S4C). Notably, unlike Scd6 expressed from a 2µ plasmid, endogenous Scd6 protein levels appeared to increase upon peroxide treatment (Figure 3C, Figure S4 D and E).

Figure 4.

Figure 4.

Scd6 interacts with CTT1 in unstressed conditions and dissociates upon H2O2 stress-induced granule formation –(A) Schematic for primer positions on CTT1 (B) Blot represents input and PD for endogenous Scd6myc pull-down in untagged and Scd6myc cells. The myc signal was detected using α-myc antibody. PGK1 was used as a control. (C) Log2 fold-change (Log2FC) for CTT1 in the PD fraction showing the enrichment of CTT1 mRNA in the Scd6myc pull-down using primer 1, primer 2. Statistical significance was assessed using a one-way ANOVA. (D) CTT1 mRNA was detected using smiFISH (single molecule inexpensive fluorescent in-situ hybridisation) using Cy5 labelled secondary probe. WT cells used were transformed with pRS316 Scd6GFP. (E) quantitation for (D) (i) Scd6GFP puncta/cell (ii) CTT1 mRNA puncta/cell (iii) pie chart depicting the % colocalization of CTT1 mRNA with Scd6GFP upon H2O2 treatment (iv) Raw integrated density quant to depict the CTT1 mRNA present in the same spatial coordinates as of Scd6GFP in untreated and H2O2-treated condition. Data plots represent mean ± SEM from n = 3, where ‘n’ represents number of independent experiments. Paired t-test was used to calculate the statistical significance. Asterisks indicate levels of statistical significance: p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p < 0.0001 (****).

Scd6 was observed to localize to puncta upon H2O2 stress (Figure 1A) and under the same conditions its interaction with CTT1 mRNA appeared to be significantly reduced compared to the unstressed state, where Scd6 is primarily diffused in the cytoplasm (Figure 4C). This observation led us to speculate that the stress-induced localization of Scd6 to puncta might contribute to a reduced interaction with CTT1 mRNA, potentially facilitating the derepression of CTT1 mRNA leading to increased translation during H2O2 stress as observed in the polysome experiment (Figure 3H). We performed (single-molecule inexpensive fluorescence in situ hybridization – smFISH) to test this. In the smiFISH experiments, we observed that Scd6 puncta formed upon peroxide stress largely lacked CTT1 mRNA signal (Figure 4D and E iii). ctt1∆ was used as a control for smFISH experiments to ensure the specificity of CTT1 smFISH probes (Figure S4F). We observed the absence of any signal in ctt1∆ cells with CTT1-specific probes. In response to the peroxide treatment, we observed an induction of Scd6 puncta formation (Figure 4E i). CTT1 mRNA expression was also induced under similar conditions (Figure 4E ii). To assess the relative association of Scd6 with CTT1 mRNA under unstressed conditions, we measured the raw integrated density of the CTT1 mRNA puncta and the corresponding Scd6 signal at the same spatial coordinates. We observed that the relative association of Scd6 with CTT1 mRNA decreased after peroxide treatment (Figure 4E iv). Taken together with the previously presented data, these findings suggest a possible mechanism underlying the derepression of CTT1 mRNA during peroxide stress, which may contribute to the translational induction of Ctt1 and support the peroxide stress response.

Based on the observed translational activation of CTT1 under H2O2-induced stress (Figure 3G,H) and the corresponding decrease in its interaction with Scd6 (Figure 4C), we hypothesized that dissociation of CTT1 mRNA from Scd6 May be a necessary step for its efficient translation under oxidative conditions. Supporting this idea, smiFISH experiments also revealed that Scd6 relocalizes to the cytoplasmic puncta upon stress, and that these granules lack detectable CTT1 mRNA signals (Figure 4D). We further speculated that if Scd6 targets CTT1 mRNA, its overexpression might increase the interaction between the two, potentially limiting their stress-induced dissociation and, in turn, influencing CTT1 translation during oxidative stress. Therefore, we investigated whether this effect might be associated with an interaction between Scd6 (expressed from a 2µ plasmid) and CTT1 mRNA by RNA immunoprecipitation (RIP) experiments using two independent primer pairs targeting different regions of the CTT1 transcript (Figure S5A). The enrichment of Scd6 in the pull-down samples (Figure S5B). Under unstressed conditions, we detected enrichment of CTT1 mRNA in Scd6 pull-downs, suggesting a potential interaction between Scd6 and CTT1 mRNA (Figure S5C). However, Scd6 protein levels appeared to decrease after H2O2 treatment (Figure 3C and S5B). Despite this reduction, we observed a marked enrichment of CTT1 mRNA in Scd6 immunoprecipitates under stress conditions when Scd6 was overexpressed (Figure S5C), suggesting that peroxide stress may enhance the association between Scd6 and CTT1 mRNA. This enhanced interaction is also correlated with the decreased polysomal association of CTT1 mRNA upon Scd6 overexpression (Figure S5D). However, further investigation is required to determine whether this interaction is directly and functionally significant in the regulation of CTT1 expression. To assess the specificity of this interaction, we tested the association of Scd6 with two other mRNAs. CTA1 and RAD50, previously reported to interact with Scd6 [29], served as a positive control, while ACT1 was used as a negative control. As expected, CTA1 and RAD50 mRNA was enriched (Figure S5 E and F), whereas ACT1 mRNA was not (Figure S5G). To investigate whether the interaction between CTT1 mRNA and Scd6 depends on the RGG motif – previously implicated in RNA binding and protein–protein interactions, we performed RNA immunoprecipitation (RIP) using strains expressing either full-length Scd6 or the RGG deletion mutant (Scd6ΔRGG). The enrichment of Scd6 in the pull-down fractions confirmed the efficiency of the RIP (Figure S5H). CTT1 mRNA was enriched in immunoprecipitated from cells expressing full-length Scd6; however, this enrichment was absent in the Scd6ΔRGG samples (Figure S5 I), suggesting that the interaction between Scd6 and CTT1 mRNA is dependent on the RGG motif.

Since Scd6 has been reported to undergo arginine methylation (AM) [20], we wondered whether the AM status of Scd6 was altered upon peroxide stress, inducing a change in the Scd6-CTT1 interaction in wild-type cells. We observed a marginal but significant decrease in the mono-methylation of Scd6 after H2O2 treatment (Figure S6).

LSm14A (Scd6 human ortholog) contributes to peroxide stress response

Scd6 orthologs have been reported in various model organisms including LSm14A in humans [30]. Therefore, we tested if the role of Scd6 in peroxide stress response is conserved in human cells. Therefore, we performed microscopy to assess LSm14A localization in HeLa cells in response to H2O2 treatment. Under unstressed conditions, LSm14A was localized to the cytoplasmic puncta. Upon treatment with H2O2, the number of LSm14A puncta increased (Figure 5A,D), suggesting enhanced recruitment of LSm14A to cytoplasmic puncta in response to oxidative stress. Upon treatment with peroxide, we observed an increase in the formation of G3BP1 puncta (Figure 5B), suggesting enhanced stress granule assembly under oxidative stress conditions. In contrast, the number of DCP1 puncta appeared to decrease under the same conditions (Figure 5D,E), indicating a potential reduction in P-body formation or altered dynamics in response to stress. Colocalization studies with G3BP1 (SG marker) and DCP1 (PB marker) revealed that the colocalization of LSm14A decreased with DCP1 and increases with G3BP1 upon H2O2 (Figure 5C,F). Overexpression of Scd6 rendered yeast cells more sensitive to H2O2 treatment (Figure 2C,D). To determine whether LSm14A, the human homolog of Scd6, exhibits similar behaviour, we conducted an MTT assay. The results indicated that overexpression of LSm14A increased the sensitivity of HeLa cells to H2O2 treatment compared to that of the empty vector control (Figure 5G). Overall, the localization of Scd6 in cytoplasmic granules appears to be conserved; however, the specific context and functional implications of this localization may vary.

Figure 5.

Figure 5.

LSm14A localizes to puncta upon oxidative stress (A) Microscopic images of immunostaining of G3BP1 in LSm14AGFP transfected HeLa cells treated with water (vehicle control) and 1 mM H2O2 for 2 h. Endogenous G3BP1 was detected using α-G3BP1 antibody. (B) Quantification for LSm14AGFP and G3BP1 puncta per cell as in (A). (C) Percentage colocalization of LSm14AGFP puncta with G3BP1 upon H2O2 treatment. (D) Microscopic images of immunostaining of DCP1 in LSm14AGFP transfected HeLa treated with water and 1 mM H2O2 for 2 h. Endogenous DCP1 was detected using α-DCP1 antibody. (E) Quantification for LSm14AGFP and DCP1 puncta per cell as in (D). (F) Percentage colocalization of LSm14AGFP puncta with DCP1 upon H2O2 treatment. Data plots represent mean ± SEM from n = 3, where ‘n’ represents number of independent experiments. Two tailed paired t- test was used to calculate the statistical significance ‘*’. (G) Cell viability assays in eGFP or LSm14AGFP transfected HeLa cells treated with 2 mM H2O2 for 2 h. Data plots represent mean ± SEM from n = 5, where ‘n’ represents number of independent experiments. Two tailed paired student’s t- test was used to calculate the statistical significance ‘*’. Asterisks indicate levels of statistical significance: p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p < 0.0001 (****).

Discussion

In this study, we report on the role of the RNA-binding protein Scd6 in H2O2 stress response mediated by the CTT1 mRNA regulation. The key observations supporting this finding are as follows: (1) Scd6 localizes to dynamic puncta upon H2O2 treatment (Figure 1), (2) scd6Δ cells are more tolerant to H2O2 treatment (Figure 2A,B), whereas Scd6 overexpression increased sensitivity to peroxide stress (Figure 2C,D), (3) There is increased ROS accumulation upon peroxide stress in cells overexpressing SCD6 (Figure 2E), (4) Deletion of SCD6 increases Ctt1 protein levels (Figure 3A,B) in unstressed cells and SCD6 overexpression reduces Ctt1 protein levels in RGG-motif dependent manner in response to H2O2 treatment (Figure 3C–F) (5) CTT1 undergoes translational activation in response to H2O2 treatment (Figure 3G,H) (6) Scd6 interacts with CTT1 mRNA and this interaction diminishes upon peroxide stress (Figure 4C) (7) Colocalization of CTT1 mRNA reduces with Scd6 granules upon stress (Figure 4D,E) (8) LSm14A (human homolog of Scd6) localizes to a punctum upon H2O2 treatment (Figure 5A–F) and (9) LSm14A overexpression increases sensitivity to peroxide stress (Figure 5G).

Scd6 was localized to distinct puncta upon H2O2 treatment, which decreases after the removal of stress, highlighting their dynamic nature (Figure 1A). The Scd6 puncta observed following H2O2 treatment were no longer visible after cycloheximide (CHX) treatment (Figure 1A,B), indicating that these puncta may contain RNA. Colocalization experiments suggested that these Scd6 puncta did not colocalise with Edc3 (P-body marker) (Figure 1C,D, and S1E). We did not observe stress granule formation under similar conditions, consistent with previous observations [26] (Figure 1E and S1F), indicating that the Scd6 puncta assembled in response to peroxide stress are perhaps neither PBs nor SGs. Since Scd6 does not colocalize with Edc3 (a P-body marker) and Pab1 puncta (SG marker) are not formed upon H2O2 treatment, it is possible that Scd6 forms distinct puncta in response to H2O2-induced stress. Another possibility is that these Scd6 puncta represent a distinct subset of P-bodies and stress granules lacking Edc3 and Pab1, differing in composition from the canonical PBs and SGs. To further evaluate the identity of the Scd6 puncta, we also examined additional markers representing both granule types. Pub1, another stress granule marker, did not form puncta under H2O2 stress, consistent with the absence of stress granules in this condition. Similarly, the core P-body marker Lsm1 also failed to show puncta induction, whereas Scd6 robustly formed puncta.

Overexpression and deletion of SCD6Δ appeared to influence the survival of yeast cells under H2O2-induced oxidative stress. Although scd6Δ cells exhibited a relatively greater tolerance, Scd6 overexpression was associated with increased sensitivity to H2O2 treatment (Figure 2A–D). These findings suggest a potential role of Scd6 in modulating cellular response to oxidative stress. Growth curve analyses for Scd6 deletion and overexpression were performed across a range of peroxide concentrations (1–4 mM) to assess cellular responses to varying levels of oxidative stress (Figure S2, Figure 2). The sensitivity and tolerance correlate with the status of ROS. Cells overexpressing Scd6 overexpression, which showed sensitivity to H2O2 treatment, were found to have significantly higher ROS levels (Figure 2E). In contrast, cells with Scd6 deletion displayed reduced ROS levels compared to the WT cells following H2O2 treatment, suggesting enhanced oxidative stress tolerance in the absence of Scd6 (Figure 2F). This result established the physiological role of Scd6 in response to H2O2-mediated oxidative stress.

Ctt1 protein levels were elevated in untreated scd6Δ cells. However, upon H2O2 treatment, a reduction in Ctt1 levels was observed in these cells, which may seem counterintuitive (Figure 3A,B). The increased basal levels of Ctt1 in scd6Δ cells likely resulted from de-repression owing to the absence of Scd6. One possible explanation is that elevated basal levels of Ctt1 protein may fulfil the need for Ctt1, thereby diminishing the requirement for further induction under oxidative stress. In this context, feedback regulatory mechanisms might restrict additional Ctt1 expression in response to H2O2, allowing the cell to maintain homoeostasis and preventing excessive or unnecessary protein synthesis. This remains to be tested experimentally in the future. Scd6 is a translational repressor protein. Since Ctt1 is an important enzyme implicated in the peroxide stress response, we tested the impact of Scd6 on Ctt1 protein levels. Ctt1 levels were induced in response to the peroxide stress (Figure 3C,D); however, Scd6 overexpression from a 2µ plasmid inhibits this induction (Figure 3D). We observed that Scd6 overexpression reduced Ctt1 protein levels in an RGG-dependent manner (Figure 3E,F).

Evident changes in Ctt1 protein levels, without corresponding alterations in CTT1 mRNA levels (Figure S3 A-B and E-F) upon Scd6 deletion or overexpression, suggested the involvement of post-transcriptional regulatory mechanisms. To explore the possibility that CTT1 mRNA undergoes translational activation in response to oxidative stress, we assessed its translational status using polysome profiling combined with qRT-PCR to determine its association with translationally active and inactive ribosomal fractions. Oxidative stress was induced using 4 mM H2O2, which is known to trigger acute cellular stress. It is well established that such conditions result in global translational repression, typically characterized by the collapse of polysomes due to the inhibition of translation initiation or stalling of elongation. Consistent with this, our polysome profiles of H2O2-treated cultures displayed a marked reduction in polysome content, indicative of a widespread translational shutdown (Figure 3G). Despite this global repression, certain stress-responsive mRNAs, particularly those encoding detoxification enzymes and molecular chaperones, can bypass translational inhibition and remain actively translated through alternative mechanisms, including cap-independent initiation, upstream open reading frames (uORFs), and regulation by RNA-binding proteins. Our results indicate that CTT1 mRNA remains associated with translationally active polysome fractions, even under oxidative stress, supporting the notion of its selective translation under these conditions (Figure 3H).

Endogenous Scd6 levels were found to be upregulated upon treatment with 4 mM H2O2, suggesting a potential role for Scd6 in the cellular response to oxidative stress induced by this condition (Figure 4B, S4D and E). Under similar oxidative stress conditions that promote translational activation of CTT1 mRNA, we observed a dissociation of CTT1 mRNA from Scd6, which was otherwise associated under unstressed conditions (Figure 4C). This stress-induced dissociation suggested that release from Scd6 may be a prerequisite for the translation ofCTT1 mRNA during oxidative stress. This was further confirmed by smFISH analysis, wherein Scd6 puncta induced by peroxide stress largely excluded CTT1 mRNA (Figure 4D,E). In this experiment, Scd6GFP was expressed from a CEN (pRS316) plasmid whose expression levels were closer to the wild type than the relatively high levels of Scd6 when expressed from 2µ plasmid. Assembly of RNA granules is often associated with translation repression and mRNA storage [31]. CTT1 mRNA was largely excluded from the Scd6 puncta (Figure 4D,E). One possibility is that Scd6 relocalizes to the cytoplasmic puncta under these conditions, which might contribute to the regulation of other translationally repressed transcripts. An obvious future direction would be to identify mRNAs that colocalize in these puncta. This could provide further insights into the role of Scd6 in peroxide-mediated oxidative stress response beyond derepressing CTT1 mRNA.

We further hypothesized that if Scd6 targets CTT1 mRNA, its overexpression could enhance this interaction and potentially hinder the stress-induced dissociation observed under oxidative conditions. Such sustained association may interfere with the selective translational activation of CTT1 mRNA during oxidative stress, thereby impacting Ctt1 protein expression. Based on the RIP experiments using Scd6 overexpression, we report that CTT1 mRNA is a binding target of Scd6 (Figure S5C). RNA immunoprecipitation revealed enrichment of CTT1 mRNA in Scd6 (expressed from a 2µ plasmid) pull-downs under both stressed and unstressed conditions (Figure S5C). Notably, this association was enhanced (Figure S5C) under stress despite the reduced Scd6 protein levels (Figures 3C and 5B). While overexpression artefacts may partly explain the enhanced interaction between Scd6GST and CTT1 mRNA, additional factors likely contributed to the observed differences between endogenous and overexpressed Scd6. These include potential disruptions in stress-induced post-translational modifications that normally facilitate mRNA release and alter protein stability under oxidative stress – where endogenous Scd6 is stabilized (Figure S4 D and E), whereas Scd6GST appears destabilized (Figure S5B). We speculate that the bulky GST tag on Scd6GST may interfere with certain post-translational modifications that occur in endogenous Scd6, which could potentially contribute to differences in protein stability between the tagged and native forms. Differences in the post-translational modifications (if any) of endogenous Scd6 and overexpression of Scd6GST remain to be experimentally determined. Together, these factors suggest that Scd6GST may not fully mimic the behaviour of endogenous Scd6 under stress conditions. We plan to explore these possibilities in future studies to better understand the mechanisms underlying the differential behaviour of endogenous and overexpressed Scd6 under oxidative stress.

An interesting aspect of the results presented in this work is the switch that allows changes in the Scd6 protein-CTT1 mRNA interaction. The interaction under unstressed conditions is significantly diminished in response to peroxide stress. This is important as it likely allows derepression of CTT1 mRNA. Furthermore, the diminished interaction between Scd6 protein and CTT1 mRNA correlated with reduced Scd6 mono-methylation (Figure S6). The reduction in methylation was not very strong but significant. A limitation of this experiment is that it was carried out in the SCD6 overexpression (2µ plasmid) background. It is important to ascertain the methylation status of endogenous Scd6 in response to H2O2 stress. We attempted this experiment, however, detection of the methylation status of endogenous Scd6 has been technically challenging due to the low copy number of Scd6 (3200 molecules/cell) [32]. Scd6 is a substrate of conserved and predominant methyltransferase Hmt1, which catalyse both monomethylation and asymmetric dimethylation. In the absence of reliable dimethylation-specific antibodies for yeast proteins, we currently do not know the dimethylation status of Scd6 under unstressed conditions or in response to peroxide stress. This information could provide useful insights. Hmt1 could affect the oxidative stress response by altering Scd6 methylation; however, we have refrained from assessing the phenotype of HMT1 deletion and/or overexpression strains as the phenotype(s) in this strain could be complicated due to methylation changes of several known nuclear and cytoplasmic substrate proteins. Creating mutants of arginine residues that are specifically altered in methylation upon peroxide stress will be our future endeavour.

Scd6 is a conserved protein, and homologs of Scd6 in humans, worms, flies, frogs, and plants have been implicated in translational repression and/or mRNA decay (Table 1). The human homolog od Scd6, LSm14A displayed enhanced localization to puncta upon H2O2 treatment (Figure 5A,D), and its colocalization analysis using G3BP1 (a stress granule marker) and DCP1 (a P-body marker) revealed a decrease in the overlap of LSm14A with DCP1 and a corresponding increase in colocalization with G3BP1 following H2O2 treatment (Figure 5C,F). These observations suggest that LSm14A may relocalize from P bodies to stress granules in response to oxidative stress. Based on our observations, the localization of Scd6 to cytoplasmic granules appears to be conserved across species; however, the specificity and context of this localization differ. In yeast, Scd6 forms distinct puncta that do not colocalize with canonical stress granules or P-bodies (Figure 1), whereas in HeLa cells, its human homolog LSm14A, predominantly localizes to stress granules following H2O2 treatment (Figure 5C). To better understand the nature of these H2O2-induced Scd6 granules, we aimed to further characterize their RNA content and molecular composition in future studies. The MTT assay results demonstrated that overexpression of LSm14A enhanced the sensitivity of HeLa cells to H2O2 treatment, as compared to cells expressing the empty vector control (Figure 5G). Despite differences in granule identity, both Scd6 and LSm14A may contribute to increased sensitivity to oxidative stress, indicating a potentially conserved physiological role. To explore whether this sensitivity is associated with translational control mechanisms, we plan to identify and analyse the mRNA targets of LSm14A in future experiments.

Table 1.

Listing the orthologues of Scd6 family of proteins and their mRNA targets.

Name of the orthologue Organism Target mRNA Pathway involved Mode of regulation Reference
Scd6 S. cerevesiae GTO3, LCL1, HVG1, PRM7, RTN2, FMP45, BSC5, PGM2, CTT1, CRS5, GCY1, RTC3, TSL1, TOS8 Translation,
mRNA decay
Translation repression, Decapping activator Ziedan et al. [23], Nissan et al. [22],
Sum2 S. pombe N/A mRNA decay Decapping activity Fromm et al. [33],
SCD6 T.brucei N/A mRNA decay/storage Localizes to RNA granules Kruger et al. [34]
CAR-1 C.elegans 2RSSE.1
aagr-2
aak-2
aat-5
abcf-2
abts-1
abts-3
acc-4
ace-3
Translation, mRNA storage, Intacellular trafficking Translation repression and mRNA storage Squirell et al. [35], Tang et al. [36],
TraI D.melanogaster sar1 Translation, Intracellular protein trafficking, endocytosis Translation repression and mRNA storage Wilhem et al. [37],
DCP5 A.thaliana EXPL-1, SEN1, DCP2 Translation, mRNA decay Translation repression, mRNA depcapping Xu and Chua [38],
xRAP55 X. laevis N/A Translation
Translation repression Tanaka et al, [39]
Lsm14 M.musculus N/A Mieosis Mieotic progression Zhang et al, [40]
LSm14A/hRAP55 Human FAM111B,
LIG4,
SASS6
mRNA storage, Mitotic sindle formation mRNA storage, Stablizes the mitotic spindle Mili, Georgesse, and Kenani, [41]

Overall, this study identifies a unique mechanism underlying the translation regulation of CTT1 mRNA by Scd6 (Figure 6). Under normal conditions, CTT1 mRNA binds to Scd6 leading to its repression. In response to peroxide stress, Scd6 assembles indistinct puncta from which CTT1 mRNA is largely excluded due to reduced CTT1-Scd6 interactions. This likely allows derepression of CTT1 mRNA and increases Ctt1 protein levels, allowing the cells to mount an oxidative stress response.

Figure 6.

Figure 6.

Proposed model for the de-repression of CTT1 upon peroxide stress.

Materials and methods

Yeast strains and plasmids

The yeast strains used in this study were BY4741 and its derivatives (Table 2). These strains were grown either in yeast extract/peptone media or synthetic dropout minimal medium at 30°C 220 rpm. The plasmids used in the study have been listed in Table 3.

Table 2.

The strains used in the study.

Strain number Name Description
yPIR1 Wild type MATa his3Δ1 leu2 met15 ura3 (BY4741)
yPIR24 scd6∆ MATa his3Δ1 leu2 ura3 his3 met15 scd6∆::KanMX
yPIR71 Ctt1-GFP MATa his3Δ1 leu2 met15 ura3 Ctt1-GFP
yPIR13 Scd6-GFP MATa leu2 ura3 his3 met15 SCD61-GFP (HIS)
yPIR72 Ctt1-GFP scd6∆ MATa his3Δ1 leu2 met15 ura3 Ctt1-GFP scd6∆::KanMX
yPIR104 Pab1RFP A gift from Prof. Beidong Liu’s Lab
yPIR153 ctt1∆ MATa his3Δ1 leu2 ura3 his3 met15 ctt1∆::KanMX

Table 3.

List of the plasmids used in the study.

Plasmid number Name Description
pPIR95 pYES EV 2µ empty vector, Ura and AmpR selection marker
pPIR97 pYES Scd6GST Expressing Scd6GST under its own promoter, Ura selection marker
pPIR180 pYES Scd6GST∆RGG Expressing Scd6GST∆RGG under its own promoter, Ura selection marker
pPIR51 pRS316 Scd6GFP CEN plasmid expressing Scd6GFP, Ura and AmpR selection marker
pPIR130 pGP EV pGP564,2µ empty vector, Leu- selection marker
pPIR168 pGP Scd6GFP pGP-Scd6GFP,Expressing Scd6GFP under its own promoter, Leu and KanR selection marker
pPIR52 pRS416 Edc3mCh Expressing Edc3mCh, Ura selection marker
pPIR308 peGFP peGFP-C1, empty vector for mammalian expression
pPIR98 pLSm14aGFP Expressing LSm14AGFP under pCMV promoter, AmpR selection marker

Yeast transformation

WT cells were diluted from an overnight grown primary culture to 0.1 OD600 and grown to 0.6 OD600. The cells were pelleted at 5000 rpm. The pellets were washed twice with water followed by washing with 100 mM LiAc (2 times). After washing, the cells were resuspended in 300 μl of 100 mM LiAc and further aliquoted into three different microcentrifuge tubes. To the cell suspension, 240 μl of 50% PEG (v/v), 36 μl of 1 M LiAc, and 25 μl of salmon sperm DNA (100 mg/ml) were added individually and vortexed vigorously for 15 s. Template DNA was not added to the control. The mixture was then incubated at 30°C for 30 min, followed by 15 min of heat shock at 42°C. The cells were then pelleted. The pellet was resuspended in 100 μl of H2O and plates on SD Ura-/SD Leu- plates and incubated at 30°C for 2 days [42].

H2O2 treatment

Yeast cells were diluted to an OD600 of 0.1 from an overnight grown primary culture and allowed to grow till 0.4–0.8 OD600. These cells were then treated with 4 mM H2O2 for 30 min at 30°C and 220 rpm in dark [5,34]. The cells were then pelleted at 4200 rpm for 1 min at room temperature and stored at −80°C until further use.

Colony-forming unit (CFU) assay

The yeast cells were diluted to an OD600 of 0.1 from an overnight-grown primary culture and allowed to reach 0.8 OD600. After it reached 0.8 OD600, the cultures were split into two parts: to one part, 4 mM H2O2 was added, and an equal amount of water was added to the other half of the culture. Both were incubated at 30°C for 30 min at 220 rpm. The cells were then serially diluted, followed by plating different dilutions on yeast extract/peptone media and synthetic dropout minimal media agar plates. The plates were incubated at 30°C for 2 days. The colony forming unit (CFU) count was used to determine survival [34]. The percentage survival was normalized to that of the untreated cells. Statistical analysis was performed using GraphPad Prism Version 8.0.

Growth curve assay

Yeast cells were diluted from an overnight-grown primary culture at an initial OD600 of 0.1 and grown until they reached mid-log phase (0.8 OD600). At this point, the cultures were divided into two equal parts: one was treated with 4 mM H2O2, while the other received an equal volume of MQ water as a control. Both cultures were incubated at 30°C for 30 min with shaking at 220 rpm. Following treatment, cells were adjusted to an OD600 of 0.1, serially diluted, and inoculated into 96-well plates at 30°C. OD600 readings were recorded every 30 min for 24-48 h using a Tecan Infinite Pro 500 plate reader to monitor growth kinetics. A two-tailed paired Student’s t- test was used to calculate the statistical significance ‘*’ for the CFU count assays. Tukey’s test for variance was used to calculate the statistical significance ‘*’ for growth curve-experiments

Detection of Intracellular reactive oxygen species (ROS) using H2DCFDA staining

Intracellular ROS levels were monitored using 2,7-dichlorofluorescein diacetate (H2DCFDA) staining. WT cells with scd6∆/Scd6 of 0.8 OD600 were treated with 4 mM H2O2 for 30 min at 30°C followed by washing with 1× Phosphate Buffer Saline (PBS). These cells were incubated with 100 µM H2DCFDA [43] for 30 min followed by washing with 1x PBS. After resuspending the cells in 1× PBS, the cells were imaged using Deltavision RT (Real Time) microscope, and fluorescence was measured at an excitation wavelength of 485 nm and emission wavelength of 524 nm using Tecan Infinite Pro 500.

For the microscopic quantification of ROS, 30 cells were used for each condition. The FITC channel was adjusted at 0.2 s of exposure and 32% transmittance for the DCFDA signal. The Raw integrated intensity was measured and plotted for each cell for three independent experiments as shown in Figure 2F.

Cycloheximide treatment

Yeast cells were diluted to an OD600 of 0.1 in 10 ml SD Ura with 2% glucose from an overnight grown primary culture and allowed to grow till 0.4–0.5 OD600. These cultures were divided into two parts, 5 ml culture was treated with 4 mM H2O2 (2.04 µl of 9.8 M stock), and the same volume of H2O was added to another 5 ml culture (untreated) followed by 30 min incubation at 30°C at 220rpm in the dark. The H2O2-treated culture was washed off using SD Ura-. To the 5 ml of H2O2 treated culture, either 5 µl of 100 µg/ml cyloheximide [44,45] was added. The cells were incubated for 10 min at 30°C and 220 rpm under dark. These cells were then pelleted and used for live cell imaging.

Microscopy

For yeast, the cells were pelleted at 10,000 rpm for 15 s, spotted on glass cover slip and observed using live cell imaging. Yeast images were acquired using a Deltavision RT microscope system running softWoRx 3.5.1 software (Applied Precision, LLC), using an Olympus 100×, oil immersion 1.4 NA objective. The Green Fluorescent Protein (GFP) channel was adjusted at 0.5 s of exposure and 50% transmittance. The Red fluorescent channel (mCherry) was adjusted at 0.6 s of exposure and 50% transmittance. For the quantification of puncta per cell, we analysed 100 cells/per experiment. Puncta were counted individually for each cell and then normalized to the total number of cells analysed within the imaging field, yielding the puncta per cell value. Statistical analyses were performed using GraphPad Prism Version 8.0. Statistical significance was calculated using a two-tailed unpaired/paired t-test. Microscopy experiments shown in Figure S1G and S1H were performed using a Nikon T2 confocal microscope with an exposure time of 300 ms and 50% laser transmittance.

Polysome profiling

Wild-type BY4741 cells harbouring either an empty vector (EV) or Scd6GST expressed from the pYES plasmid were cultured in 200 mL SD – Ura medium containing 2% glucose until they reached an OD600 of approximately 0.8. The cells were then treated with 4 mM H2O2 for 30 min at 30°C in a shaking incubator in the dark conditions. After H2O2 treatment, the cells were treated with cycloheximide (100 µg/mL) for 15 min at 30°C in a shaking incubator to arrest the translation. Following treatment, cells were rapidly chilled on ice and harvested by centrifugation at 4°C. The pellets were washed with diethyl pyrocarbonate (DEPC) treated, autoclaved Milli-Q water and resuspended in 400 µL of lysis buffer (10 mM Tris pH 7.4, 100 mM NaCl, 30 mM MgCl2, 100 µg/mL cycloheximide, 10 U RiboLock RNase inhibitor, 1× Complete Mini EDTA-free protease inhibitor tablet [Roche; 04693132001], and 1 mM PMSF [SRL; 84,375]). Cells were lysed by bead beating with glass beads using a FastPrep homogenizer at 4°C for 15 min (22-s cycles at 4.5 m/s). The obtained lysates were centrifuged at 5500 rpm for 5 min, and the supernatant was collected. Lysate equivalent to approximately 1000 OD254 units was layered onto a 10–50% sucrose gradient prepared in sucrose gradient buffer (140 mM KCl, 5 mM MgCl2, 5 mM Tris-HCl pH 7.5, and 100 µg/mL cycloheximide). The gradients were centrifuged at 39,000 rpm for 2 h at 4°C in a Beckman SW41Ti rotor. Gradient fractions were collected using a BioComp Gradient Profiler. Fractions corresponding to free mRNPs and 80S monosomes were pooled and designated as the untranslated fraction, whereas fractions containing polysomes were pooled and classified as the translated fraction.

Pull-downs and western blotting

For glutathione pull-downs [20], 150 ml culture pellets of yeast cells were split into two tubes and lysed using bead beating for 30 min. The lysis buffer contained 10 mM Tris (pH 7.5), 100 mM NaCl, 0.5 mM EDTA and 0.1% NP40. Post-bead beating, cells were spun at 5500rpm for 10 min at 4°C. The dilution buffer (10 mM Tris pH 7.5, 100 mM NaCl) was added to the supernatant. The input was collected from the mix and 50 µl of equilibrated glutathione sepharose 4B (GE healthcare) was added to the reaction mix. The reaction mixture was incubated for 2 hat 4°C followed by spin at 1500rpm for 30 s. The beads were washed two times using the dilution buffer. The beads were resuspended with 200 µl of dilution buffer. About 2.5% of Input and 5% PD were loaded on 8% SDS-PAGE gel. Ponceau was used as a loading control in all the blots unless specified. The remaining pull-down fraction was used for RNA isolation using TRIzol method. To determine the methylation status of Scd6, pGP564 EV and pGP564 Scd6GFP were transformed into BY4741. About 7.5 µl of equilibrated magnetic GFP trap beads (ChromoTek) was added to the reaction mix. The rest of the procedure for GFP trap pull-down was the same as described for the glutathione pull-down. Mono methyl arginine (MMA) antibody (Cell Signaling Technology) CST, catalogue (no. 8711; 1:1000 dilution) was used to detect the methylation signal of Scd6 with α-rabbit as the secondary antibody.

For Protein A pull-down, the cutures were collected as described for glutathione pull-down. The cultures were lysed using the lysis buffer mentioned for the glutathione pull-down. The lysate was incubated with anti‐Myc antibody for 1 h in binding buffer (50 mM Tris pH8, 150 mm NaCl and 0.15% NP40). Twenty microlitre of Protein A Beads (GE Healthcare) were added to each tube followed by incubation for 2 h of binding on the nutator at 4°C. The pellet was washed thrice with binding buffer, 5% of the pull-down fraction was resuspended in 1× laemmli buffer followed by boiling for 5 min at 100°C. Fifty percentage of the pellet was loaded on SDS/PAGE gel for western analysis to confirm the pull-down. The remainder of the pull-down fraction was used for RNA isolation followed by qRT-PCR for RNA Immunoprecipitation.

All the antibodies used in the study have been listed in Table 4.

Table 4.

List of antibodies used in the study.

Antibody Description
α-GFP BioLegend, Catalog no. 338,001
α-mono methyl arginine CST, catalogue no. 8711
α-PGK1 abcam, Catalogue no. ab113687
α-Mouse Jackson ImmunoResearch Laboratories, Code No. 115- 035–003
α-Rabbit Jackson ImmunoResearch Laboratories, Code No. 111- 035–003
α-GST CST 26H1 Mouse mAb Catalogue no. 2624
α-Myc Sigma, catalogue no. C3956
α- G3BP1 Santa Cruz Biotechnology,sc-365338
α-DCP1 Santa Cruz Biotechnology, sc-100706
Alexa FluorTM 568 goat α -Mouse Invitrogen, catalogue no. A11004

RNA isolation

Hot acidic phenol method: RNA isolation was performed using the hot acidic phenol method [46]. Mid-log phase cells were harvested by centrifugation. The cell pellet was resuspended in DEPC-treated autoclaved MQ. The cells were collected by a flash spin at 10k rpm. The cell pellet was resuspended in 400 μl of TES solution (10 mM Tris Chloride pH 7.5, 10 mM EDTA and 0.5% SDS). 400 μl of hot acidic phenol was added to the tube, followed by vigorous vortexing for 10 s. The tubes were incubated at 65°C for 60 min and vortexed every 15 min. After incubation, it was kept on ice for 5 min followed by spinning at 14,000rpm for 10 min at 4°C. The aqueous layer obtained by this step was transferred into another tube already having 400 μl of Chloroform. The mixture was then vortexed vigorously for 10 s. The tubes were spun at 14,000 rpm for 10 min, 4°C. The aqueous layer was then carefully transferred into another tube. To this tube, 1/10th vol of 3 M NaAc pH 5.2 and 2.5 vol of EtOH were added. This mixture was snap-chilled using liquid N2. The tubes were spun at 14000 rpm for 10 min at 4°C. The pellet was washed twice with 70% EtOH, air-dried, and resuspended using 100 μl DEPC MQ. RNA quality was checked by 1% agarose formamide gel electrophoresis. The RNA was used to assess Scd6 and CTT1 mRNA levels shown in Figures S3 C,D and E was isolated using the TES method protocol.

TRIzol method for RNA isolation: RNA was isolated from yeast samples using the TRIzol (G Biosciences, Cat. No. 786–652) and the chloroform extraction method. Briefly, lysates, pull-down, or polysomal fractions were mixed with 1 mL of TRIzol reagent and 200 µL of chloroform. After vigorous vortexing, samples were centrifuged at 14,000 rpm for 20 min. The aqueous phase was then subjected to isopropanol precipitation by flash freezing, followed by centrifugation at 15,000 rpm for 30 min at 4°C. The resulting RNA pellet was washed once with 70% ethanol at room temperature, air-dried, and resuspended in an appropriate volume of DEPC-treated Milli-Q water. RNA samples were then treated with DNase I (Thermo Scientific, Cat. No. EN0521) prior to cDNA synthesis. cDNA libraries were prepared from 1 µg of RNA using random primers. The resulting cDNA was diluted 1:10 for lysate samples and 1:1 for pull-down and polysome fractions and used as templates for RT-qPCR. Reactions were performed in 10 µL volumes for 35 cycles using TB Green Premix Ex Taq II (Tli RNase H Plus; TaKaRa, Cat. No. RR820B) using gene-specific primers (Bioserve).

Reverse transcription and quantitative real-time PCR

The isolated RNA was treated with DNase I (Thermo, EN0525). 5 μg of total RNA, 2.5 units of DNase I, and DNase I Buffer with MgCl2 were added for a 30 μl reaction. The mixture was then incubated at 37°C for 30 min. After incubation, 3 μl 50 mM EDTA was added to stop the DNase I reaction. The DNase I-treated RNA was analysed using 1.2% agarose formamide gel electrophoresis to assess RNA quality. DNaseI treated RNA was then used for cDNA synthesis. According to the manufacturer’s protocol, 1 µg of RNA was used to synthesize cDNA using the RevertAid RT Reverse Transcription Kit (Thermo, K1691). cDNA was diluted at 1:10, and real-time PCR was performed using TB Green™ Premix Ex Taq™ (TaKaRa). For qRT-PCR, three technical replicates were assembled with 2 μl cDNA/reaction and 0.5 µM of each primer in a BioRad iQ5 Real-Time PCR Detection System. The PCR conditions were 95°C for 12 min for the initial denaturation, followed by 30 cycles of 95°C for 20 sec, 46°C for 30 sec, and 72°C for 30 s. The DNA was quantified in every cycle during extension. Melt curve acquisition was performed out at 64°C for 8 sec. Ct values were extracted using automatic baseline and manual thresholds. ΔΔCt method was used to calculate the final log2 Fold Change values, which were then plotted on a 19 box and whisker plot using GraphPad Prism 8.0.

For quantification of relative mRNA enrichment in RIP and polysome profiling assays, ∆Ct values for each target gene were calculated by subtracting the Ct value of the internal control gene PGK1 from the Ct value of the gene of interest. Subsequently, ∆∆Ct values were determined by subtracting the ∆Ct of total RNA from the ∆Ct of immunoprecipitated (pull-down) RNA. Finally, the relative enrichment values were obtained by normalizing 2(−∆∆Ct) to the corresponding Scd6 pull-down signal intensities.

smFISH

Wild-type (WT) yeast cells were diluted from an overnight primary culture to an initial optical density (OD600) of 0.1 and grown to an OD600 of 0.5. The cells were treated with H2O2 for 30 min in the dark conditions. Following H2O2 treatment, cells were fixed with 3.7% paraformaldehyde (PFA) for 45 min at room temperature. The fixed cells were washed with cold Buffer B (1.2 M sorbitol and 100 mM KHPO4, pH 7.5, prepared in nuclease-free water). For spheroplasting, the fixed cells were incubated in a spheroplasting buffer, consisting of 890 µL Buffer B, 100 µL of 200 mM VRC, 10 µL of 25 kU/mL lyticase, and 2 µL β-mercaptoethanol, for 5 min at 30°C. Post-spheroplasting, after which the cells were washed again with Buffer B and incubated in 70% ethanol for 4 h at −20°C.

Approximately 50 µL of cells was washed twice with Stellaris wash buffer (2X SSC, 10% formamide [deionized] in nuclease-free water). CTT1-specific probes (Table 5) were annealed to secondary FLAPX A647 (CCTCCTAAGTTTCGAGCTGGACTCAGTG) probe (Cy5-labelled). The annealing reaction contained 200 pmol of CTT1-specific probe, 250 pmol of FLAP probe, and 10X NEB Buffer 3 in nuclease-free water. Next, 3 µL of the FLAP-CTT1 probe mix was added to the smFISH hybridization buffer, composed of 10 µg/mL E. coli tRNA, 100 µL of 200 mM VRC, 200 µL of 10 mg/mL BSA, 1 mL of 20X SSC, 2 mL of 50% dextran sulphate, and 10% formamide. Hybridization mix was added to the cells, which were incubated overnight on a nutator at 37°C in the dark.

Table 5.

List of smiFISH probes for CTT1.

Probe # Probe (5’- > 3’) with 5 Flap X sequence at 3’ end Probe position *
1 gctgattgatcttattggcaCCTCCTAAGTTTCGAGCTGGACTCAGTG 80
2 gcttttcttcttttttaccgCCTCCTAAGTTTCGAGCTGGACTCAGTG 123
3 atgggtgatgagagtacggaCCTCCTAAGTTTCGAGCTGGACTCAGTG 174
4 cgtctggtcttgagtattgaCCTCCTAAGTTTCGAGCTGGACTCAGTG 201
5 ttttccagcagatggaagtcCCTCCTAAGTTTCGAGCTGGACTCAGTG 238
6 cggaactctttctctatcgaCCTCCTAAGTTTCGAGCTGGACTCAGTG 269
7 gttcgaactccagtctacaaCCTCCTAAGTTTCGAGCTGGACTCAGTG 318
8 atggagcggcgtatgtaataCCTCCTAAGTTTCGAGCTGGACTCAGTG 357
9 ggacatttgtaacccacattCCTCCTAAGTTTCGAGCTGGACTCAGTG 382
10 tcaccaccaacggtggaaaaCCTCCTAAGTTTCGAGCTGGACTCAGTG 415
11 aagaaacacctcttgggtctCCTCCTAAGTTTCGAGCTGGACTCAGTG 459
12 attgttgaagacccagtcatCCTCCTAAGTTTCGAGCTGGACTCAGTG 506
13 gcgtctctgaggaagaagacCCTCCTAAGTTTCGAGCTGGACTCAGTG 532
14 ttcagatgagactgagggtcCCTCCTAAGTTTCGAGCTGGACTCAGTG 589
15 cagtatatggtagtgtcctgCCTCCTAAGTTTCGAGCTGGACTCAGTG 616
16 atggattgattccggattcaCCTCCTAAGTTTCGAGCTGGACTCAGTG 650
17 acctctatcaccaaacatgtCCTCCTAAGTTTCGAGCTGGACTCAGTG 680
18 cagagtacgcgttcatactaCCTCCTAAGTTTCGAGCTGGACTCAGTG 717
19 taccttctttgttgaccatgCCTCCTAAGTTTCGAGCTGGACTCAGTG 750
20 gtatccgacaagacgtggaaCCTCCTAAGTTTCGAGCTGGACTCAGTG 787
21 atctccagtcaaggtttcaaCCTCCTAAGTTTCGAGCTGGACTCAGTG 812
22 tgaacagctttgcctgattaCCTCCTAAGTTTCGAGCTGGACTCAGTG 867
23 cttttcgccattttgcaattCCTCCTAAGTTTCGAGCTGGACTCAGTG 890
24 ggtgtcattgtttgcacataCCTCCTAAGTTTCGAGCTGGACTCAGTG 925
25 cctgaacttagttgcttgttCCTCCTAAGTTTCGAGCTGGACTCAGTG 947
26 tgtggccatattttcgttagCCTCCTAAGTTTCGAGCTGGACTCAGTG 982
27 gttagggtgatggtaccaaaCCTCCTAAGTTTCGAGCTGGACTCAGTG 1024
28 tgttcgttggactgaatgcaCCTCCTAAGTTTCGAGCTGGACTCAGTG 1083
29 agaaggcttaatacctgggaCCTCCTAAGTTTCGAGCTGGACTCAGTG 1109
30 aagtctggcttgtagaacggCCTCCTAAGTTTCGAGCTGGACTCAGTG 1136
31 ctatgacgttgagtgtctggCCTCCTAAGTTTCGAGCTGGACTCAGTG 1165
32 ttgacgggcaattgctgataCCTCCTAAGTTTCGAGCTGGACTCAGTG 1198
33 agtatggacatcccaagtttCCTCCTAAGTTTCGAGCTGGACTCAGTG 1227
34 gtgtattgggaatcacctttCCTCCTAAGTTTCGAGCTGGACTCAGTG 1249
35 ctttggaagttcactgctttCCTCCTAAGTTTCGAGCTGGACTCAGTG 1288
36 taatttggctcaggaccgaaCCTCCTAAGTTTCGAGCTGGACTCAGTG 1333
37 agatacttcgtcgttgtcttCCTCCTAAGTTTCGAGCTGGACTCAGTG 1394
38 tcgtcaagaactatccctttCCTCCTAAGTTTCGAGCTGGACTCAGTG 1423
39 gttcctgttttctcacagaaCCTCCTAAGTTTCGAGCTGGACTCAGTG 1455
40 ggcatcaacaatatgctcgtCCTCCTAAGTTTCGAGCTGGACTCAGTG 1490
41 tcatatagagctcttggctgCCTCCTAAGTTTCGAGCTGGACTCAGTG 1561
42 tctgttcatcgttgtataccCCTCCTAAGTTTCGAGCTGGACTCAGTG 1584
43 tttgatcttacaagcgtggcCCTCCTAAGTTTCGAGCTGGACTCAGTG 1631
44 gcgtaactctctttttgactCCTCCTAAGTTTCGAGCTGGACTCAGTG 1659
45 cccaaatcttcgtttagcaaCCTCCTAAGTTTCGAGCTGGACTCAGTG 1690
46 ccaagcattctgcaatgactCCTCCTAAGTTTCGAGCTGGACTCAGTG 1713
47 aaccttcaaggtcaacaggtCCTCCTAAGTTTCGAGCTGGACTCAGTG 1746
48 ccttaattggcacttgcaatCCTCCTAAGTTTCGAGCTGGACTCAGTG 1783

Following hybridization, the cells were centrifuged and washed with Stellaris wash buffer for 30 min at 37°C in a nutator. This was followed by a wash with 2X SSC +0.1% Triton-X 100 at room temperature (RT) for 15 min and a final wash with 1X SSC for 15 min with gentle rocking at RT. The cells were resuspended in 1X PBS and mounted on coverslips. DAPI stain was added to the Fluoromount-G mounting reagent. The slides were allowed to rest for 4–5 h before imaging. Images were obtained using a DeltaVision RT microscope. Thirty cells counted for each condition for quantification shown in Figure 5D. To assess the relative association of Scd6 with the CTT1 mRNA under unstressed conditions, we measured the raw integrated density of CTT1 mRNA puncta and the corresponding Scd6 signal at the same spatial coordinates. The Scd6 intensity was then normalized to the CTT1 mRNA intensity, and the resulting ratio was plotted on the Y-axis to reflect the relative enrichment of Scd6 at CTT1 mRNA puncta (Figure 4 E iv).

Cell culture and transfections

Glass coverslips were pre-coated with poly-L-lysine (0.05 mg/ml) for 2 h followed by three PBS washes. HeLa cells (procured from cell repository, NCCS Pune) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) with 1X antibiotic-antimycotic (Thermo, 15,240,062), 10% FBS (foetal bovine serum, Gibco, A52567), and 5% CO2 at 37°C on pre-coated glass coverslips. Mycoplasma contamination was checked once every month using the PCR-based approach as described earlier [47] or transfections of eGFP and LSm14AGFP plasmids, Lipofectamine 2000 reagent (Invitrogen) was used (as per manufacturer’s protocol) followed by treatment of cells with H2O2 at 1 mM concentration for 2 h.

MTT assay

HeLa cells were seeded in a 12-well plate in DMEM medium with 1X antibiotic-antimycotic (Thermo, 15,240,062), 10% FBS, and 5% CO2 at 37°C. Twenty-four h post transfections with eGFP and LSm14AGFP plasmids, cells were subjected to 2 mM H2O2 treatment for 2 h. HeLa cells were washed thrice with 1X PBS and MTT 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) reagent (5 mg/ml) was then added to cells and kept at 37°C for 2 h in CO2 incubator. After 2 h of incubation, MTT containing media was discarded, and 300 μl of DMSO was added to each well. The plate was then kept at 37°C for 15 min to solubilize the formazan crystals, and the absorbance was measured using a microplate reader at a wavelength of 570 nm.

Immunocytochemistry

HeLa cells were treated with H2O2 treatment (1 mM for 2 h and autoclaved MQ as vehicle control), fixed with formaldehyde and permeabilized with permeabilization buffer (1X PBS with 0.13% Triton® X-100 0694-1 L, VWR) for 20 min at room temperature. Cells were then washed thrice with 1X PBS followed by blocking with 1% BSA and 0.3% Triton® X-100 in 1X PBS for 2 h at room temperature. Cover slips were incubated overnight at 4°C with primary antibodies (anti G3BP1, sc-365338, Santa Cruz Biotechnology and anti-DCP1a, sc-100706, Santa Cruz Biotechnology, dilution 1:100 in blocking solution) in humid chamber followed by three washes with PBST. The cells were then incubated with Alexa FluorTM 568 goat anti-mouse secondary antibody (Invitrogen), diluted 1:300 in blocking solution followed by three washes with PBST. Nucleus was stained with DAPI (D1306, Thermo) for 20 min at room temperature, and coverslips were mounted on glass slides using Fluoromount-G (00–4958-02, Thermo). G3BP1 and DCP1a signals were captured using the Deltavision RT microscope system running softWoRx 3,5,1 software and imaging was performed as described earlier. The exposure time and transmittance settings for FITC (Fluorescein isothiocyanate) and TRITC to detect GFP-tagged protein and G3BP1 and Dcp1a were 0.2 s and 10% and 0.5% and 10%, respectively, for HeLa cells. For DAPI, the exposure time and transmittance settings were 0.1 s and 2%, respectively. All images were deconvoluted using standard softWoRx deconvolution algorithms. Images were analysed in ImageJ software. For each experiment, GFP-tagged LSm14A puncta from 30 cells were counted for quantification. Statistical significance was calculated using the paired t-test.

Supplementary Material

Supplementaryfigures1to3_Tiwarietal2025.docx
Supplementaryfigures4to6_Tiwarietal2025.docx
KRNB_A_2613892_SM0117.docx (993.7KB, docx)

Acknowledgments

We acknowledge Mathew Eastham and Mark Ashe for their smiFISH related assistance. ST acknowledges Kumkum Nag for help with measuring Ctt1 protein level experiments in scd6∆.

A bioRxiv preprint of this article is available at: https://doi.org/10.1101/2023.09.05.55632948.

Funding Statement

PIR thanks the Department of Science and Technology [CRG/2022/000594/IBS] and Department of Biotechnology [BT/PR51975/BMS/85/23/2024] for the funding. DST-FIST is acknowledged for its infrastructure support. ST and CT acknowledge GATE –Institute fellowship from IISc, Bangalore. SJ was supported by a postdoctoral fellowship from the DBT [BT/PR40106/BRB/10/1918/2020]; Department of Biotechnology, Ministry of Science and Technology, India [BT/PR40106/BRB/10/1918/2020]; Department of Science and Technology, Ministry of Science and Technology, India [CRG/2022/000594/IBS]; IISc-GATE Fellowship; GATE-IISc fellowship.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Author contributions statement

ST and PIR conceived the study. PIR supervised the study. PIR acquired the funding. ST, CT and SJ performed the experiments. ST and CT collected, analysed and processed the data. ST and PIR interpreted the analysis. ST and PIR wrote the manuscript. ST and PIR reviewed and edited the manuscript.

Data availability statement

The authors confirm that the data supporting the findings of this study are available in the article and its supplementary materials. Any further underlying data will be made available upon reasonable request.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/15476286.2026.2613892

References

  • [1].Ashe MP, De Long SK & Sachs AB.. Glucose depletion rapidly inhibits translation initiation in yeast. Mol Biol Cell. 2000;11(3):833–848. doi: 10.1091/mbc.11.3.833 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Gerashchenko MV, Lobanov AV, Gladyshev VN. Genome-wide ribosome profiling reveals complex translational regulation in response to oxidative stress. Proc Natl Acad Sci USA. 2012;109(43):17394–17399. doi: 10.1073/pnas.1120799109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Anderson P, Kedersha N. RNA granules: post-transcriptional and epigenetic modulators of gene expression. Nat Rev Mol Cell Biol. 2009;10(6):430–436. doi: 10.1038/nrm2694 [DOI] [PubMed] [Google Scholar]
  • [4].Anderson P, Kedersha N. RNA granules. J Cell Biol. 2006;172(6):803–808. doi: 10.1083/jcb.200512082 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5].Martins D, English AM. Catalase activity is stimulated by H2O2 in rich culture medium and is required for H2O2 resistance and adaptation in yeast. Redox Biol. 2014;2:308–313. doi: 10.1016/j.redox.2013.12.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Cohen G, Fessl F, Traczyk A, et al. Isolation of the catalase a gene of Saccharomyces cerevisiae by complementation of the cta1 mutation. Molec Gen Genet. 1985;200(1):74–79. doi: 10.1007/BF00383315 [DOI] [PubMed] [Google Scholar]
  • [7].Cunningham J, Sfakianos AP, Kritsiligkou P, et al. Paralogous translation factors target distinct mRNAs to differentially regulate tolerance to oxidative stress in yeast. Nucleic Acids Res. 2023;51(16):8820–8835. doi: 10.1093/nar/gkad568 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Shenton D, Smirnova JB, Selley JN, et al. Global translational responses to oxidative stress impact upon multiple levels of protein synthesis. J Biol Chem. 2006;281(39):29011–29021. doi: 10.1074/jbc.M601545200 [DOI] [PubMed] [Google Scholar]
  • [9].Kershaw CJ, Costello JL, Castelli LM, et al. The yeast La related protein Slf1p is a key activator of translation during the oxidative stress response. PLOS Genet. 2015;11(1):e1004903. doi: 10.1371/journal.pgen.1004903 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Herrero E, Ros J, Bellí G, et al. Redox control and oxidative stress in yeast cells. Biochim et Biophys Acta (BBA) - Gener Subj. 2008;1780(11):1217–1235. doi: 10.1016/j.bbagen.2007.12.004 [DOI] [PubMed] [Google Scholar]
  • [11].Martínez-Pastor MT, Marchler G, Schüller C, et al. The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). Embo J. 1996;15(9):2227–2235. doi: 10.1002/j.1460-2075.1996.tb00576.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Martins D, Nguyen D, English AM. Ctt1 catalase activity potentiates antifungal azoles in the emerging opportunistic pathogen Saccharomyces cerevisiae. Sci Rep. 2019;9(1):9185. doi: 10.1038/s41598-019-45070-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Lee J, Godon C, Lagniel G, et al. Yap1 and Skn7 control two specialized oxidative stress response regulons in yeast. J Biol Chem. 1999;274(23):16040–16046. doi: 10.1074/jbc.274.23.16040 [DOI] [PubMed] [Google Scholar]
  • [14].Marchler G, Schüller C, Adam G, et al. A Saccharomyces cerevisiae UAS element controlled by protein kinase A activates transcription in response to a variety of stress conditions. Embo J. 1993;12(5):1997–2003. doi: 10.1002/j.1460-2075.1993.tb05849.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Ozdilek BA, Thompson VF, Ahmed NS, et al. Intrinsically disordered RGG/RG domains mediate degenerate specificity in RNA binding. Nucleic Acids Res. 2017;45(13):7984–7996. doi: 10.1093/nar/gkx460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Thandapani P, O’Connor TR, Bailey TL, et al. Defining the RGG/RG motif. Mol Cell. 2013;50(5):613–623. doi: 10.1016/j.molcel.2013.05.021 [DOI] [PubMed] [Google Scholar]
  • [17].Brandariz-Núñez A, Zeng F, Lam QN, et al. Sbp1 modulates the translation of Pab1 mRNA in a poly(a)- and rgg-dependent manner. RNA. 2018;24(1):43–55. doi: 10.1261/rna.062547.117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Balasubramanian S, Maharana S, Srivastava A. “Boundary residues” between the folded RNA recognition motif and disordered RGG domains are critical for FUS–RNA binding. J Biol Chem. 2023;299(12):105392. doi: 10.1016/j.jbc.2023.105392 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Rajyaguru P, She M, Parker R. Scd6 targets eIF4G to repress translation: RGG motif proteins as a class of eIF4G-binding proteins. Mol Cell. 2012;45(2):244–254. doi: 10.1016/j.molcel.2011.11.026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Poornima G, Shah S, Vignesh V, et al. Arginine methylation promotes translation repression activity of eIF4G-binding protein, Scd6. Nucleic Acids Res. 2016;44:9358–9368. doi: 10.1093/nar/gkw762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Poornima G, Mythili R, Nag P, et al. RGG-motif self-association regulates eIF4G-binding translation repressor protein Scd6. RNA Biol. 2019;16(9):1215–1227. doi: 10.1080/15476286.2019.1621623 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Nissan T, Rajyaguru P, She M, et al. Decapping activators in Saccharomyces cerevisiae act by multiple mechanisms. Mol Cell. 2010;39(5):773–783. doi: 10.1016/j.molcel.2010.08.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Zeidan Q, He F, Zhang F, et al. Conserved mRNA-granule component Scd6 targets Dhh1 to repress translation initiation and activates Dcp2-mediated mRNA decay in vivo. PLOS Genet. 2018;14(12):e1007806. doi: 10.1371/journal.pgen.1007806 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Parbin S, Mohanan G, Gole S, et al. DekTV and YVG motifs in the Lsm domain are important for the activity of Scd6, a conserved translation repressor protein. Biochim Biophys Acta Gene Regul Mech. 2020;1863(2):194474. doi: 10.1016/j.bbagrm.2019.194474 [DOI] [PubMed] [Google Scholar]
  • [25].Mohanan G, Roy R, Malka-Mahieu H, et al. Genotoxic stress triggers Scd6-dependent regulation of translation to modulate the DNA damage response | EMBO reports. Available from: https://www.embopress.org/doi/full/10.1038/s44319-025-00443-3 [DOI] [PMC free article] [PubMed]
  • [26].Buchan JR, Muhlrad D, Parker R. P bodies promote stress granule assembly in Saccharomyces cerevisiae. J Cell Biol. 2008;183(3):441–455. doi: 10.1083/jcb.200807043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Drakulic T, Temple M, Guido R, et al. Involvement of oxidative stress response genes in redox homeostasis, the level of reactive oxygen species, and ageing in Saccharomyces cerevisiae. FEMS Yeast Res. 2005;5(12):1215–1228. doi: 10.1016/j.femsyr.2005.06.001 [DOI] [PubMed] [Google Scholar]
  • [28].Muhtadi R, Lorenz A, Mpaulo SJ, et al. Catalase T-deficient fission yeast meiocytes show resistance to ionizing radiation. Antioxidants. 2020;9(9):881. doi: 10.3390/antiox9090881 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Tsvetanova NG, Klass DM, Salzman J, et al. Proteome-wide search reveals unexpected RNA-binding proteins in Saccharomyces cerevisiae. PLOS ONE. 2010;5(9):e12671. doi: 10.1371/journal.pone.0012671 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Roy D, Rajyaguru PI. Suppressor of clathrin deficiency (Scd6)-an emerging RGG-motif translation repressor. WIREs RNA. 2018;9(5). doi: 10.1002/wrna.1479 [DOI] [PubMed] [Google Scholar]
  • [31].Tian S, Curnutte HA, Trcek T. RNA granules: a view from the RNA perspective. Molecules. 2020;25(14):3130. doi: 10.3390/molecules25143130 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Chong YT, Koh JY, Friesen H, et al. Yeast proteome dynamics from single cell imaging and automated analysis. Cell. 2015;161(6):1413–1424. doi: 10.1016/j.cell.2015.04.051 [DOI] [PubMed] [Google Scholar]
  • [33].Fromm SA, Truffault V, Kamenz J, et al. The structural basis of Edc3- and Scd6-mediated activation of the Dcp1: dcp2 mRNA decapping complex. Embo J. 2012;31(2):279–290. doi: 10.1038/emboj.2011.408 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Tran K, Green EM. Assessing yeast cell survival following hydrogen peroxide exposure. Bio-Protoc. 2019;9(2):e3149. doi: 10.21769/BioProtoc.3149 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Squirrell JM, Eggers ZT, Luedke N, et al. CAR-1, a protein that localizes with the mRNA decapping component DCAP-1, is required for cytokinesis and ER organization in Caenorhabditis elegans embryos. Mol Biol Celll. 2006;17(1):336–344. doi: 10.1091/mbc.e05-09-0874 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Tang NH, Kim KW, Xu S, et al. The mRNA decay factor CAR-1/LSM14 regulates axon regeneration via mitochondrial calcium dynamics. Curr Biol. 2020;30(5):865–876.e7. doi: 10.1016/j.cub.2019.12.061 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Wilhelm JE, Buszczak M, Sayles S. Efficient protein trafficking requires trailer hitch, a component of a ribonucleoprotein complex localized to the ER in Drosophila. Dev Cell. 2005;9(5):675–685. doi: 10.1016/j.devcel.2005.09.015 [DOI] [PubMed] [Google Scholar]
  • [38].Xu J, Chua N-H. Arabidopsis decapping 5 is required for mRNA decapping, P-body formation, and translational repression during postembryonic development. Plant Cell. 2009;21(10):3270–3279. doi: 10.1105/tpc.109.070078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [39].Tanaka KJ, Ogawa K, Takagi M, et al. RAP55, a cytoplasmic mRNP component, represses translation in xenopus oocytes. J Biol Chem. 2006;281(52):40096–40106. doi: 10.1074/jbc.M609059200 [DOI] [PubMed] [Google Scholar]
  • [40].Zhang T, Li Y, Li H, et al. RNA-associated protein LSM family member 14 controls oocyte meiotic maturation through regulating mRNA pools. Journal of Reproduction and Development. 2017;63(4):383–388. doi: 10.1262/jrd.2017-018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [41].Mili D, Georgesse D, Kenani A. Localization and role of RAP55/LSM14 in HeLa cells: a new finding on the mitotic spindle assembly. Acta Biochim Pol. 2015;62(3):613–619. doi: 10.18388/abp.2015_1107 [DOI] [PubMed] [Google Scholar]
  • [42].Gietz RD, Schiestl RH. Frozen competent yeast cells that can be transformed with high efficiency using the LiAc/SS carrier DNA/PEG method. Nat Protoc. 2007;2(1):1–4. doi: 10.1038/nprot.2007.17 [DOI] [PubMed] [Google Scholar]
  • [43].Pereira MD, Eleutherio EC, Panek AD. Acquisition of tolerance against oxidative damage in Saccharomyces cerevisiae. BMC Microbiol. 2001;1(1):11. doi: 10.1186/1471-2180-1-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Brengues M, Teixeira D, Parker R. Movement of eukaryotic mRNAs between polysomes and cytoplasmic processing bodies. Science. 2005;310(5747):486–489. doi: 10.1126/science.1115791 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [45].Teixeira D, Sheth U, Valencia-Sanchez MA, et al. Processing bodies require RNA for assembly and contain nontranslating mRNAs. RNA. 2005;11(4):371–382. doi: 10.1261/rna.7258505 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [46].Collart MA, Oliviero S. Preparation of yeast RNA. Curr Protoc Mol Biol. 2001. Chapter 13, Unit13.12. doi: 10.1002/0471142727.mb1312s23 [DOI] [PubMed] [Google Scholar]
  • [47].Uphoff CC, Drexler HG. Comparative PCR analysis for detection of mycoplasma infections in continuous cell lines. In Vitro Cell Dev Biol Anim. 2002;38(2):79–85. doi: [DOI] [PubMed] [Google Scholar]
  • [48].Tiwari S, Sj S, Rajyaguru PI. RGG-motif protein Scd6 affects oxidative stress response by regulating cytosolic catalase T1 (Ctt1). bioRxiv. 2023. 2023.09.05.556329. doi: 10.1101/2023.09.05.556329 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementaryfigures1to3_Tiwarietal2025.docx
Supplementaryfigures4to6_Tiwarietal2025.docx
KRNB_A_2613892_SM0117.docx (993.7KB, docx)

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available in the article and its supplementary materials. Any further underlying data will be made available upon reasonable request.


Articles from RNA Biology are provided here courtesy of Taylor & Francis

RESOURCES